Journal of Plastic, Reconstructive & Aesthetic Surgery (2012) 65, 219e227

Fat grafting accelerates revascularisation and

decreases fibrosis following thermal injury*
Steven M. Sultan a, Jason S. Barr a, Parag Butala a, Edward H. Davidson b,
Andrew L. Weinstein a, Denis Knobel a, Pierre B. Saadeh a,
Stephen M. Warren a, Sydney R. Coleman a, Alexes Hazen a,*

a
Institute of Reconstructive Plastic Surgery, New York University Medical Center, 560 First Avenue, TCH-169, New York,
NY 10017, USA
b
University of Pittsburgh Division of Plastic Surgery, University of Pittsburgh Medical Center, Pittsburgh, PA, USA

Received 21 April 2011; accepted 24 August 2011

KEYWORDS Summary Background: Fat grafting has been shown clinically to improve the quality of burn
Burn; scars. To date, no study has explored the mechanism of this effect. We aimed to do so by
Fat graft; combining our murine model of fat grafting with a previously described murine model of
Stem cell thermal injury.
Methods: Wild-type FVB mice (n Z 20) were anaesthetised, shaved and depilitated. Brass rods
were heated to 100
C in a hot water bath before being applied to the dorsum of the mice for
10 s, yielding a full-thickness injury. Following a 2-week recovery period, the mice underwent
Doppler scanning before being fat/sham grafted with 1.5 cc of human fat/saline. Half were
sacrificed 4 weeks following grafting, and half were sacrificed 8 weeks following grafting. Both
groups underwent repeat Doppler scanning immediately prior to sacrifice. Burn scar samples
were taken following sacrifice at both time points for protein quantification, CD31 staining
and Picrosirius red staining.
Results: Doppler scanning demonstrated significantly greater flux in fat-grafted animals than
saline-grafted animals at 4 weeks (fat Z 305  15.77 mV, saline Z 242  15.83 mV;
p Z 0.026). Enzyme-linked immunosorbent assay (ELISA) analysis in fat-grafted animals
demonstrated significant increase in vasculogenic proteins at 4 weeks (vascular endothelial
growth factor (VEGF): fat Z 74.3  4.39 ng ml e1 , saline Z 34.3  5.23 ng ml e1; p Z 0.004)
( s t r o m a l c e l l - d e r i v e d f a c t o r - 1 ( S D F - 1 ) : f a t Z 5 1 . 8  1 . 2 3 n g m l e1 , s a l i n e g r a f -
ted Z 10.2  3.22 ng mle1; p < 0.001) and significant decreases in fibrotic markers at 8 weeks
(transforming growth factor-ß1(TGF-ß): saline Z 9.30  0.93, fat Z 4.63  0.38 ng ml e1 ;
p Z 0 . 0 0 2 ) ( m a t r i x m e t a l l o p e p t i d a s e 9 ( M M P 9 ) : s a l i n e Z 1 3 . 0 5  1 . 2 1 n g m l e1 ,

*
Presented in part at: iFats Annual Conference e Dallas, TX, USA, October 2010, Northeastern Society of Plastic Surgeons Annual Meeting
e Washington D.C., USA, October 2010.
* Corresponding author. Tel.: þ1 212 263 8745; fax: þ1 212 263 2138.
E-mail address: alexes.hazen@nyumc.org (A. Hazen).

1748-6815/$ - see front matter ª 2011 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.
doi:10.1016/j.bjps.2011.08.046
220 S.M. Sultan et al.

fat Z 6.83  1.39 ng mle1; p Z 0.010). CD31 staining demonstrated significantly up-regulated
vascularity at 4 weeks in fat-grafted animals (fat Z 30.8  3.39 vessels per high power field
(hpf), saline Z 20.0  0.91 vessels per high power field (hpf); p Z 0.029). Sirius red staining
demonstrated significantly reduced scar index in fat-grafted animals at 8 weeks
(fat Z 0.69  0.10, saline Z 2.03  0.53; p Z 0.046).
Conclusions: Fat grafting resulted in more rapid revascularisation at the burn site as measured
by laser Doppler flow, CD31 staining and chemical markers of angiogenesis. In turn, this re-
sulted in decreased fibrosis as measured by Sirius red staining and chemical markers.
ª 2011 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by
Elsevier Ltd. All rights reserved.

According to the American Burn Association, there are
approximately half a million burns requiring medical
attention in the United States each year.1 Early burn
progression and inadequate systems of measurement
complicate assessment of burn depth.2 Many deep partial-
thickness burns are therefore treated without surgical
intervention. Left to heal without excision and skin graft-
ing, deep burns often result in fibrotic scars characterised
by abnormal colour, texture, thickness and pliability.3
When untreated burns are located in cosmetically sensi-
tive areas, significant deformity can result. A number of
topical and minimally invasive techniques have been used
in an attempt to improve the quality and appearance of
burn scars. These treatment options include topical silicone
gels, pressure dressings, corticosteroids and, most recently,
autologous fat grafting.4e7
Over the last decade, the tissue engineering community
has come to recognise the regenerative potential of
adipose tissue.8 In turn, plastic surgeons have translated
this revelation into clinical applications. Autologous fat
grafts have been used in a number of settings to improve
the quality of overlying tissues.9e11 In one study, clinical
improvement of hypertrophic burn scars was noted
following autologous fat grafting beneath the burn site.7 To
date, no study has examined the effect of fat grafting on
burns in a controlled experiment. Employing our model of
murine fat grafting in conjunction with a previously
described murine model of thermal injury, we aimed to
determine the mechanism by which fat grafting may effect
change within a burn scar.12,13 To this end, markers of neo-
vascularisation and fibrosis were compared in fat- and
saline-treated mice at two time points following thermal
injury.
Materials and methods
a depilatory agent to remove all remaining hair. The
animals were then divided evenly into two groups: the first
group consisted of animals that underwent subcutaneous
fat grafting (n Z 10) 2 weeks following thermal injury,
while the second group consisted of animals that under-
went subcutaneous saline grafting (n Z 10) 2 weeks
following thermal injury.
Laser Doppler scanning
All animals were subjected to laser Doppler scanning at
three separate points in the study: immediately prior to
thermal injury, 2 weeks following thermal injury (immedi-
ately prior to fat or saline grafting) and immediately prior
to wound bed harvest (at 4 or 8 weeks following grafting).
Once anaesthetised and shaved, the animals were oriented
vertically within the field of the laser Doppler scanner
(MoorLDI2-IR; Moor Instruments, Devon, UK) and scanned. A
0.25-cm2 area at the centre of the burn wound was isolated
and the flux (mV), a measure of blood flow, was calculated
within this region of interest (MoorLDI Measurement
Software).
Thermal injury
Anaesthetised and shaved animals were subjected to
a single burn wound on their dorsum. A 10-mm brass hex
cap screw (Grainger Industrial Supply, Lake Forest, IL, USA)
was heated to 100
C in a hot water bath before being
applied to the dorsal skin of the anaesthetised animals for
10 s. This application was found in preliminary studies to
produce a consistent full-thickness burn. The animals were
allowed to recover under a heat lamp and were kept
thereafter in a supervised animal facility with murine food
pellets and water ad libitum.

Mice

This study was approved by the NYU Medical Center Insti-

tutional Animal Care and Use Committee (IACUC #070911-
02). The study was designed as follows (Figure 1): Ten-
week-old wild type FVB mice (n Z 20) (Jackson Laborato-
ries, Bar Harbor, ME, USA) were anesthetised using a murine
anaesthetic cocktail consisting of ketamine, xylazine and
acepromazine (0.1 ml/10 g intra-peritoneal (IP)). Their
dorsal skin was shaved using an electric clipper followed by Figure 1 Study timeline.
Fat grafting in burn injury
Fat grafting
Fat or sham grafting was carried out 2 weeks following
thermal injury using our previously described murine model
of fat grafting.12 This time point was chosen because a firm
eschar formed at the burn site within 2 weeks following
injury. The mice were anaesthetised before the posterior
part of their dorsal skin was shaved and prepared in an
aseptic fashion. A small incision was made in the posterior
midline of the dorsum. Discarded human fat (IRB #H12756-
01b) was processed using the Coleman technique.14 The
highest density fat was partitioned into 1-cc syringes using
a luer lock to luer lock transfer system (Part No. LL-LL12;
Mentor, Santa Barbara, CA, USA). The fat was then infil-
trated beneath the dorsal skin of the mouse using a Style-1
Coleman Infiltration Cannula (Part No. COL-17; Mentor,
Santa Barbara, CA, USA). Each animal was diffusely infil-
trated with 1.5 cc of fat. The incision was then closed using
4/0 nylon sutures. Sham-grafted animals were treated in an
identical fashion, but 1.5 cc of sterile saline were injected
in place of fat. The animals were allowed to recover under
a heat lamp before being returned to the supervised animal
facility.
Serial photography
Mice were photographed serially to evaluate progression of
thermal injury or other apparent changes following fat/
sham grafting.
Tissue harvest
Dorsal skin was harvested for analysis at 4 weeks and 8
weeks following grafting (n Z 5 from each treatment group
at each time point). The mice were sacrificed by CO2
narcosis and cervical dislocation. A central 1.5-cm2 portion
dorsal skin was then excised from the burn scar site.
Remaining portions of the fat graft or other subcutaneous
tissue adherent to the skin were removed. Each sample was
then divided evenly into three pieces designated for poly-
merase chain reaction (PCR) arrays, enzyme-linked immu-
nosorbent assay (ELISA) assays and histologic analysis,
respectively. Following homogenisation of tissue samples
(Polytron tissue homogeniser; Kinematica, Bohemia, NY,
USA) nucleic acid and protein extraction were performed
(AllPrep DNA/RNA/Protein Mini Kitl; Qiagen, Valencia, CA,
USA). Following extractions, RNA and DNA were quantified
with a Nanodrop-1000 Spectrophotometer (Thermo Fisher
Scientific Inc., Waltham, MA, USA). Protein was quantified
using a Pierce 660 nm Protein Assay (Thermo Fisher Scien-
tific, Rockford, IL, USA) and spectrophotometer. Skin
samples intended for histology were fixed in formalin for
24 h before being transferred to 70% ethanol. These
samples were then embedded in paraffin, sectioned and
mounted.
ELISA protein quantification
ELISAs (R&D Systems, Minneapolis, MN, USA) for vascular
endothelial growth factor (VEGF), stromal cell-derived
factor-1 (SDF-1), transforming growth factor-b1 (TGF-b1)
221
and matrix metallopeptidase 9 (MMP9) were carried out on
samples from both groups at both time points (n Z 5 in each
group at each time point). Briefly, samples and controls
were loaded into antibody-coated microplates along with
50 ml of assay diluent. The plate was then incubated for 2 h
before 100 ml of conjugate was added to each well. The
plates were incubated for a further 2 h before 100 ml of
substrate solution was added. The plate was then incu-
bated in the dark for 30 min after which 100 ml of stop
solution was added. The absorbance was then read using
a SpectraMax 340 (Molecular Devices, Sunnyvale, CA, USA).
Finally, the measured absorbance was converted to protein
concentration using SoftMax Pro Data Analysis Software
(Molecular Devices, Sunnyvale, CA, USA).
PCR arrays
Reverse transcription was performed using the QuantiTect
Reverse Transcription kit (Qiagen). Expression of mouse
Bax, Bcl-2, HIF-1, VEGF, SDF-1, Col1a1, MMP9, Smad3, TGF-
b1 and tissue inhibitor of metalloproteinases (TIMP-1)
messenger RNAs (mRNAs) was measured in samples from
both groups at both time points (n Z 5 in each group at each
time point) by the real-time quantitative RT-PCR method
using SYBR green master mix (Qiagen) and the ABI Prism
7900HT Sequence Detection System (Applied Biosystems,
Foster City, CA, USA) (Table 1 e primer sequences). Rela-
tive mRNA levels were determined by the comparative
threshold cycle (2DDCT) method. The expression of all
mRNAs was normalised to that of 18s mRNA.
CD31 staining
CD31 staining was carried out as a measure of vascularity
using a previously described protocol.15 Five previously
embedded and sectioned slides from each group at each
time point were deparaffinised before being incubated in
3% H2O2 for 10 min. They were then washed in wash buffer
for 5 min. The slides were then blocked with 150 ml of
blocking solution for 1 h at room temperature before 150 ml
of CD-31 antibody (Abcam, Cambridge, MA, USA) was added
in a 1:50 dilution and allowed to incubate on the slides
overnight at 4
C. The primary antibody was then removed
and the slides were washed in wash buffer before 150 ml of
secondary antibody (Vector Labs, Burlingame, CA, USA) was
added to each of the sections. They were then incubated
for 30 min at room temperature. Following a 30-min incu-
bation in 150 ml of ABC Reagent at room temperature, the
sections were washed in wash buffer before 150 ml of DAB
reagent was added to each. The DAB reagent was allowed
to incubate until there was a visible colour change
(approximately 2 min). The slides were then dehydrated in
three changes of 100% ethanol before being mounted.
Following staining, slides were examined under the
microscope at high power using red light excitation to
demonstrate 40 ,6-diamino-2-phenylindole (DAPI) staining of
cell nuclei. Slides were then viewed under green light
excitation to demonstrate CD31-positive cells. DAPI and
CD31 images were acquired of multiple unique fields before
composite images were created by superimposing them.
222 S.M. Sultan et al.

Table 1 PCR primer sequences.

Protein Forward Reverse
VEGF GTAACGATGAAGCCCTGGAGTG TGAGAGGTCTGGTTCCCGAAAC
SDF-1 GTCTAAGCAGCGATGGGTTC GAATAAGAAAGCACACGCTGC
HIF-1 GATGAGTTCTGAACGTCGAAAAGAAAAGT GAAGTTTTCTCACACACAAATAACTGATGGTC
Bcl-2 CATCTTCTCCTTCCAGCCT ATCTCCCTGTTGACGCTCT
Bax ATGCGTCCACCAAGAAGCTGAG CCCCAGTTGAAGTTGCCATCAG
TGF-ß TATTTGGAGCCTGGACACAC CTTGCGACCCACGTAGTAGA
MMP9 GGGAAGGCTCTGCTGTTCAGC TCTAGAGACTTGCACTGCACG
Col1A1 TGTCCCAACCCCCAAAGAC CCCTCGACTCCTACATCTTC
Smad3 GCAGCAAATTCCTGGTTGTT TTTCGTCCAGTCTCCCAACT
TIMP-1 CGCAGATATCCGGTACGCCTA CACAAGCCTGGATTCCGTGG
18s GAGAAACGGCTACCACATCC GGACACTCAGCTAAGAGCATCG

Finally, the number of CD31 positive vessels was quantified
in each composite high-powered field.
Picrosirius red staining
Picrosirius red staining was carried out as a measure of
collagen organisation. Five previously embedded and
sectioned blank slides from each group at each time point
were deparaffinised and hydrated. They were then stained
in Weigert’s haematoxylin for 8 min before being rinsed in
tap water for 10 min. This was followed by staining in pic-
rosirius red (Sigma Aldrich, St. Louis, MO, USA) for 1 h
before being washed in two changes of acidified water. The
slides were then dehydrated in three changes of 100%
ethanol before being mounted in a resinous medium.16
Following staining, slides were viewed under the
microscope using a polarising filter (Olympus USA, Center
Valley, PA, USA). Representative images were chosen at
random from each slide and captured. Colours within the
yellow-green spectrum and the red-orange spectrum were
selected and quantified (Nikon NIS-Elements BR software;
Nikon Instruments Inc., Melville, NY, USA). When viewed
under polarised light, organised collagen stained with Sirius
red appears yellow-green. Fibrotic, disorganised collagen
appears red-orange. As previously described, the ratio of
the area that falls within the red-orange spectrum to the
area within the yellow-green spectrum is the Scar Index, an
effective measure of collagen disorganisation.17 A Scar
Index was obtained from each of the images by the above
method.
Statistics
Results were compared using paired t-tests to determine
significance between groups. P-values less than 0.05 were
considered significant.
Results
Serial photography
Serial photography (Figure 2) demonstrated improvements
in colouration and texture in the burn scars of fat-grafted
animals when compared to saline-grafted controls.
Laser Doppler scanning
Laser Doppler scanning (Figure 3) 2 weeks following
thermal injury demonstrated significantly decreased flux
through the zone of injury when compared with uninjured
control mouse skin (control flux Z 392  7.25 mV, burn
flux Z 189  10.26 mV; p < 0.001). Four weeks following
fat and saline grafting (6 weeks following thermal
injury), fat-grafted animals demonstrated significantly
greater flux through the burn wound than saline-treated
animals (fat grafted Z 305  15.77 mV, saline grafted Z
242  15.83 mV; p Z 0.026). Eight weeks following fat and
saline grafting (10 weeks following thermal injury), fat-
grafted animals continued to demonstrate greater flux in
the burn wound bed when compared with the saline-
grafted animals, though this difference was no longer
statistically significant (fat grafted Z 327  6.87 mV, saline
grafted Z 303  7.19 mV; p Z 0.054).
ELISA protein quantification
Concentrations of both VEGF and SDF-1 were significantly
elevated in fat-grafted animals 4 weeks following
grafting when compared with saline-grafted animals
at the same time point (VEGF: fat grafted Z 74.3  4.39
ng mle1, saline grafted Z 34.3  5.23 ng mle1; p Z 0.004)
(SDF-1: fat grafted Z 51.8  1.23 ng mle1, saline grafted
Z 10.2  3.22 ng mle1; p < 0.001) (Figure 4(A)). Eight
weeks following grafting both VEGF and SDF-1
remained significantly elevated in fat-grafted animals
when compared with saline-grafted animals (VEGF: fat
grafted Z 12.4  1.22 ng mle1, saline grafted Z 1.2  0.29
ng mle1; p < 0.001) (SDF-1: fat grafted Z 2.3  0.31
ng mle1, saline grafted Z 1.4  0.19 ng mle1; p Z 0.035).
There was no significant difference in the concentration
of TGF-b when comparing fat- and saline-grafted animals
4 weeks following grafting (fat grafted Z 1.29  0.95
ng mle1, saline grafted Z 2.31  0.06 ng mle1; p Z 0.34).
The same was true when comparing the concentration
of MMP9 in fat- and saline-grafted animals 4 weeks
following grafting (fat grafted Z 8.03  2.31 ng mle1, saline
grafted Z 6.61  2.03 ng mle1; p Z 0.66). Eight weeks
following grafting, the concentration of both TGF-ß and
MMP9 were significantly increased in saline-grafted animals
Fat grafting in burn injury
Figure 2 Serial photography: serial photography demonstrates improvements in colouration and texture in the burn scars of fat
grafted animals when compared to saline grafted controls.
Figure 3 Laser Doppler scanning: blood flow was assessed at
the burn site using a laser doppler scanner. A flow void was
present prior to fat and saline grafting (note: dashed line
indicates average flux measured immediately prior to grafting,
188  10.26 mV). This void gradually resolved in both groups
over the course of the experiment. Flow at the burn site was
significantly increased in fat grafted animals at four weeks
when compared to saline grafted controls (fat graf-
ted Z 305  15.77 mV, saline grafted Z 242  15.83;
p Z 0.026).
223
when compared with fat-grafted animals (TGF-b: saline
grafted Z 9.30  0.93 ng mle1, fat grafted Z 4.63  0.38;
p Z 0.002) (MMP9: saline grafted Z 13.05  1.21 ng mle1,
fat grafted Z 6.83  1.39 ng mle1; p Z 0.010) (Figure 4(B)).
PCR arrays
PCR for vasculogenic markers demonstrated up-regulation
in fat-grafted animals 4 weeks following grafting. This up-
regulation was statistically significant in both VEGF and
SDF-1 (VEGF saline:fat Z 1:3.78, p Z 0.02; SDF-1 saline:-
fat Z 1:2.34, p Z 0.04; hypoxia-inducible factor-1 (HIF-1)
saline:fat Z 1:1.89, p Z 0.06). PCR for the pro-apoptotic
factor BAX demonstrated decreased expression in fat-
grafted animals 4 weeks following grafting (BAX saline:-
fat Z 1:0.72, p Z 0.069). Moreover, PCR for Bcl-2, an anti-
apoptotic factor, demonstrated significant up-regulation in
fat-grafted animals at the same time point (Bcl-2 saline:-
fat Z 1:5.99, p Z 0.007) (Figure 5(A)). There was no
significant difference in these vascular and apoptotic
markers 8 weeks following fat and saline grafting (data not
shown).
PCR for fibrotic factors Col1a1, MMP9, Smad3, TGF-b and
TIMP-1 demonstrated no significant differences in mRNA
expression between fat- and saline-grafted animals 4 weeks
following grafting (data not shown). Eight weeks following
grafting there was, with the exception of Smad3, significant
down-regulation detected in all cases (Col1a1 saline:-
fat Z 1:0.38, p < 0.01; MMP9 saline:fat Z 1:0.58, p Z 0.03;
224
Figure 4 ELISA protein quantification: (A) Vasculogenic
markers VEGF and SDF were both significantly upregulated
in fat grafted animals four weeks following grafting
when compared to saline grafted controls (VEGF:
fat Z 74.3  4.39 ng/ml, saline Z 34.3  5.23; p Z 0.004)(SDF-
1: fat Z 51.8  1.23 ng/ml, saline Z 10.2  3.22; p < 0.001).
(B) Fibrotic markers MMP9 and TGF-ß were both significantly
downregulated in fat grafted animals eight weeks following
grafting when compare to saline grafted controls (MMP9: sali-
ne Z 13.05  1.21 ng/ml, fat Z 6.83  1.39; p Z 0.010)(TGF-ß:
saline Z 9.30  0.93 ng/ml, fat Z 4.63  0.38; p Z 0.002).
Smad3 saline:fat Z 1:0.81, p Z 0.27; TGF-b saline:-
fat Z 1:0.23, p < 0.01; TIMP-1 saline:fat Z 1:0.12,
p < 0.01) (Figure 5(B)).
Histology
CD31 staining at 4 weeks following grafting demonstrated
significantly greater vascular density surrounding the burn
wound in fat-grafted animals when compared with saline-
treated animals (fat grafted Z 30.8  3.39 vessels per hpf,
saline grafted Z 20.0  0.91 vessels per hpf; p Z 0.029)
(Figure 6(A)). Eight weeks following grafting, vascular
density in the tissue surrounding the burn wound was
again found to be significantly greater in fat-grafted
animals when compared with saline-grafted animals
(fat grafted Z 18.4  1.8 vessels per hpf, saline
grafted Z 12.3  1.4 vessels per hpf; p Z 0.038).
Picrosirius red staining at 4 weeks following grafting did
not demonstrate a significant difference in fibrosis between
fat-grafted animals and saline-grafted animals (a scar index
S.M. Sultan et al.
Figure 5 PCR arrays: (A) PCR for vasculogenic markers
demonstrated upregulation in fat grafted animals four weeks
following grafting (VEGF saline:fat Z 1:3.78, p Z 0.02; SDF-1
saline:fat Z 1:2.34, p Z 0.04; HIF-1 saline:fat Z 1:1.89,
p Z 0.06). PCR for proapoptotic factor BAX demonstrated
decreased expression in fat grafted animals four weeks
following grafting (BAX saline:fat Z 1:0.72, p Z 0.069). PCR for
Bcl-2, an anti-apoptotic factor, demonstrated significant
upregulation in fat grafted animals at the same time point (Bcl-
2 saline:fat Z 1:5.99, p Z 0.007). (B) PCR for fibrotic factors
Col1a1, MMP9, Smad3, TGF-ß, and TIMP-1 eight weeks
following grafting demonstrated downregulation in fat grafted
animals when compared to saline grafted controls (Col1a1
saline:fat Z 1:0.38, p < 0.01; MMP9 saline:fat Z 1:0.58.
p Z 0.03; Smad3 saline:fat Z 1:0.81, p Z 0.27; TGF-ß saline:-
fat Z 1:0.23, p < 0.01; TIMP-1 saline:fat Z 1:0.12, p < 0.01).
was not obtained at this time point as collagen bundles
were not sufficiently formed within the scar to generate
a scar index by the above-described protocol). Eight weeks
following grafting, however, burn scars harvested from fat-
grafted animals demonstrated a significantly lower scar
index than burn scars harvested from saline-grafted animals
(fat grafted Z 0.69  0.10, saline grafted Z 2.03  0.53;
p Z 0.046) (Figure 6(B)).
Discussion
Applying our murine model of fat grafting in the setting
of thermal injury resulted in accelerated revascularisa-
tion of burn scar tissue and, ultimately, decreased
fibrosis. Serial photography demonstrated improvement in
the texture and extent of burn scars grafted with fat in
Fat grafting in burn injury 225

Figure 6 Histology: (A) CD31 staining four weeks following grafting demonstrated a significantly increased number of vessels per
high powered field at the periphery of the burn site in fat grafted animals when compared to saline grafted controls
(fat Z 30.8  3.39 vessels/hpf, saline Z 20.0  0.91; p Z 0.029). (Note: white arrows indicate examples of representative CD31þ
vessels). (B) Sirius red staining eight weeks following grafting demonstrated more organised collagen at the burn site fat grafted
animals when compared to saline grafted controls (note: yellow/green, organized collagen; red/orange, disorganized collagen).

place of saline (Figure 2). Revascularisation of the burn
scar, as measured using laser Doppler scanning (Figure 3)
and CD31 staining (Figure 6(A)), was significantly more
advanced in fat-grafted animals 4 weeks following
grafting. This finding was paralleled by pro-vasculogenic
changes in gene expression found on ELISA (Figure 4(A))
and pro-vasculogenic/anti-apoptotic trends in PCR arrays
(Figure 5(A)) (e.g., a 3.78-fold increase in expression of
VEGF mRNA and a 5.99-fold increase in expression of Bcl-2
mRNA).
Eight weeks following grafting, saline-grafted animals
were revascularised nearly to the same extent as the fat-
grafted animals, as demonstrated by laser Doppler scanning
(Figure 3). Early revascularisation in fat-grafted animals
proved important, however, in the prevention of fibrosis
at later time points. Eight weeks following grafting, fat-
grafted animals demonstrated significantly less fibrosis
than saline-grafted controls (Figure 6(B)). Significantly
decreased markers of fibrosis were found on both ELISA
(Figure 4(B)) and PCR arrays (Figure 5(B)) as well, corrob-
orating this histologic finding (e.g., a 77% reduction in
expression of TGF-ß mRNA).
To understand the clinical significance of early revascu-
larisation in a burn wound, it is essential to first consider burn
pathophysiology. Following a burn, thrombosis in the
microvasculature causes ischaemia in an area known as the
zone of stasis.18 In response, endothelial progenitor cells
(EPCs) are mobilised from the bone marrow.19 EPCs are
known to home to areas of ischaemia and differentiate into
endothelial cells that are instrumental in blood vessel
formation.20 The concentration of EPCs in circulation peaks
around 24 h following a burn and drops off significantly
afterward, however, returning to basal levels within 72 h.19 It
has been shown as well that burns of increasing severity
result in delayed and diminished release of EPCs into circu-
lation.13 As a result, many burn wounds revascularise slowly
and, in turn, mature hypertrophic burn scars demonstrate
functional changes in their microcirculation.13,21,22
Microcirculatory anomalies play an important role in scar
architecture as low oxygen tension induces an up-
regulation of TGF-ß1. This factor is an important regu-
lator of collagen production and, when unchecked,
fibrosis.23,24 Moreover, hypoxia alters the way in which TGF-
ß1 interacts with the MMPs, a family of proteins that
regulate the remodelling of collagen.25,26 It has therefore
been suggested that any intervention that improves the
vascularity and, by extension, oxygenation of a burn scar
would similarly improve the scar’s quality and texture.13
Early revascularisation of a burn scar may therefore
protect the wound bed from up-regulation of TGF-b1 and
resultant derangements in collagen synthesis at the early
stage of scar formation.
226
This study has several limitations that should be noted:
first, further experiments will be required to pinpoint the
exact mechanism by which autologous fat grafting accel-
erates revascularisation in burn wounds. The potential for
adipose-derived stem cells to act as endothelial progenitor
cells and promote neo-vascularisation has been described
previously, however.27 Second, a larger animal model (e.g.,
Red Duroc porcine skin model or rabbit ear model) will be
required to more extensively explore the phenotypic effect
of fat grafting in thermal injury. Finally, it should be noted
as well that the use of wild type FVB mice (in place of
immunocompromised animals) does not lead to an immune
reaction against the human fat grafts. This phenomenon is
not well understood and further studies are being designed
to address it.
Despite the limitations of this study, however, the
murine model chosen was sufficient to demonstrate the
positive effect of fat grafting on markers of vascularity and
fibrosis following full-thickness thermal injury. This study
therefore speaks to the potential of fat grafting as an early
and minimally invasive intervention for severe burns left to
heal by secondary intention or, potentially, for partial
thickness burns that may not warrant excision and skin
grafting, but do appear to hold the potential for hypertro-
phic scarring. In these cases, early revascularisation may
yield significant improvement in the quality of the eventual
burn scar. Fat grafting may prove valuable as an adjunct to
skin grafting in cases of severe burns as well.
Conclusions
Infiltration of processed human lipoaspirate beneath
subacute burns in mice resulted in significant changes in the
healing wound, most notably accelerated revascularisation.
In turn, this led to down-regulation of fibrotic pathways
with resultant improvements in scar quality. Although these
findings must be re-examined in larger animal models, fat
grafting may in fact be applicable in the treatment of
thermal injuries in the future.
Funding
This project received funding from the National Endow-
ment for Plastic Surgery. Sydney Coleman receives royalties
and is a paid consultant for Mentor. He is a paid consultant
for the Armed Forces Institute of Regenerative Medicine.
No financial support or benefits have been received by any
other co-author, by any member of our immediate family or
any individual or entity with whom or with which we have
a significant relationship from any commercial source which
is related or indirectly related to the scientific work re-
ported on in this article.
References
1. American Burn Association, Burn incidence factsheet. Avail-
able from: http://www.ameriburn.org/resources_factsheet.
php [accessed 9/16/2010].
2. Grunwald TB, Garner WL. Acute burns. Plast Reconstr Surg
2008;121:311ee9e.
S.M. Sultan et al.
3. Sullivan T, Smith J, Kermode J, Courtemanche DJ. Rating the
burn scar. J Burn Care Rehabil 1990;11:250e60.
4. Shih R, Waltzman J, Evans GR. Review of over-the-counter
topical scar treatment products. Plast Reconstr Surg 2007;
119:1091e5.
5. Açikel C, Ülkür E, Güler MM. Treatment of burn scar depig-
mentation by carbon dioxide laser-assisted dermabrasion and
thin skin grafting. Plast Reconstr Surg 2000;105:1973e8.
6. Griffith BH, Monroe CW, McKinney P. A follow-up study on the
treatment of keloids with triamcinolone acetonide. Plast
Reconstr Surg 1970;46:145e50.
7. Klinger M, Marazzi M, Vigo D, Torre M. Fat injection for cases of
severe burn outcomes: a new perspective of scar remodeling
and reduction. Aesth Plast Surg 2008;32:465e9.
8. Zuk PA, Zhu M, Ashjian P, et al. Human adipose tissue is
a source of multipotent stem cells. Mol Bio Cell. 2002;13:
4279e95.
9. De Ugarte DA, Ashjian PH, Elbarbary A, Hedrick MH. Future of
fat as raw material for tissue regeneration. Ann Plast Surg
2003;50:215e9.
10. Rigotti G, Marchi A, Galie M, et al. Clinical treatment of
radiotherapy tissue damage by lipoaspirate transplant: a heal-
ing process mediated by adipose-derived adult stem cells.
Plast Reconstr Surg 2007;119:1409e22.
11. Serra-Renom JM, Munoz-Olmo JL, Serra-Mestre JM. Fat grafting
in postmastectomy breast reconstruction with expanders and
prostheses in patients who have received radiotherapy:
formation of new subcutaneous tissue. Plast Reconstr Surg
2010;125:12e8.
12. Thanik VD, Chang CC, Lerman OZ, et al. A murine model for
studying diffusely injected human fat. Plast Reconstr Surg
2009;124:74e81.
13. Zhang X, Wei X, Liu L, et al. Association of increasing burn
severity in mice with delayed mobilization of circulating
angiogenic cells. Arch Surg 2010;145:259e66.
14. Coleman SR. Facial recontouring with lipostructure. Clin Plast
Surg 1997;24:347e67.
15. Huss WJ, Hanrahan CF, Barrios RJ, Simons JW, Greenberg NM.
Angiogenesis and prostate cancer: identification of a molecular
progression switch. Cancer Res 2001;61:2736e43.
16. Junqueira LCU, Bignolas G, Brentani RR. Picrosirius staining
plus polarization microscopy, a specific method for collagen
detection in tissue sections. Histochem J 1979;11:447e55.
17. Flanders KC, Major CD, Arabshahi A, et al. Interference with
transforming growth factor-beta/Smad3 signaling results in
accelerated healing of wounds in previously irradiated skin.
Am J Pathol 2003;163:2246e57.
18. Hettiaratchy S, Dziewulski P. ABC of burns: pathopysiology and
types of burns. BMJ 2004;328:1427e9.
19. Fox A, Smythe J, Fisher N, et al. Mobilization of endothelial
progenitor cells into the circulation in burned patients. Br J
Surg 2008;95:244e51.
20. Crosby JR, Kaminski WE, Schatteman G, et al. Endothelial
cells of hematopoietic origin make a significant contribu-
tion to adult blood vessel formation. Circ Res. 2000;87:
728e30.
21. Sloan DF, Brown RD, Wells CH, Hilton JG. Tissue gases in
hypertrophic burn scars. Plast Reconstr Surg 1978;61:
431e6.
22. Clark JA, Leung KS, Cheng JC, Leung PC. The hypertrophic scar
and microcirculation properties. Burns 1996;22:447e50.
23. Falanga V, Zhou L, Yufit T. Low oxygen tension stimulates
collagen synthesis and COL1A1 transcription through the action
of TGF-ß1. J Cell Physiol 2002;191:42e50.
24. Border WA, Noble NA. Transforming growth factor ß in tissue
fibrosis. N Engl J Med 1994;10:1286e92.
25. Saed GM, Zhang W, Diamond MP. Effect of hypoxia on
stimulatory effect of TGF-ß1 on MMP-2 and MMP-9
Fat grafting in burn injury 227

activities in mouse fibroblasts. J Soc Gynecol Investig 2000; 27. Miranville A, Heeschen C, Sengenes C, Curat CA, Busse R,
7:348e54. Bouloumie A. Improvement of postnatal neovascularization by
26. Rananti L, Kahari VM. Matrix metalloproteinases in wound human adipose tissue-derived stem cells. Circulation 2004;
repair. Int J Mol Med 2000;6:391e407. 110:349e55.