Professional Documents
Culture Documents
126
126
Abstract
Background: Staphylococcus aureus (S. aureus) is a major
nosocomial pathogen and the infection with this organism in
human is increasing due to the spread of antibiotic resistant
strains. One of the resistance mechanisms of S. aureus compris-es
modification in binding proteins to penicillin. Vaccine strategy may
prevalent 4,5. MRSA is resistant to all ß- quences are highly conserved, the central hy-
lactam antibiotics, due to the presence of an per variable region is not equally conserved 23.
extra penicillin-binding protein (PBP2a) with These previous works suggest mecA as an
low affinity to ß-lactam antibiotics 6. antigen candidate for designing an anti-MRSA
PBP2a is encoded by mecA gene, which is vaccine; furthermore, prokaryotic ex-pression
located in a chromosomal cassette of a foreign system provides a facile method for producing
DNA region integrated into the bacterial recombinant proteins and may also be useful
chromosome 6-8. PBP2a is classified by for the production of PBP2a and other
Goffin and Ghuysen as a multimodular class bacterial outer membrane proteins for vaccine
B peni-cillin-binding protein harboring studies. The main purpose of the pre-sent
transpepti-dase domains 9. While in the study was to construct a prokaryotic high
presence of ß-lactam antibiotics, normal PBPs level expression system for producing recom-
are blocked, PBP2a precedes the binant PBP2a which can be used for vaccine
transpeptidation reac-tions, thereby results in development in future.
normal cell wall syn-thesis 8,10.
Given the inherent and acquired antibiotic Materials and Methods
resistance of S. aureus, antibiotic therapy for Bacterial strains and vector
MRSA infections has a limited effectiveness.
While vancomycin is the only remaining ef- S. aureus COL strain (methicillin-resistant
S. aureus) was kindly obtained from Dr. Mo-
fective antibiotic 11 against S. aureus, instanc-es
hammad Emaneini (Tehran University of
for HindIII (5-’ GGTAAGCTTTTATGTAT membrane was washed with TBS-T and then
GCATGAGTAACGTAAG -3’) and reverse incubated with Rabbit anti -mouse immuno-
primer with XhoI restriction site (5’- GC CT globulin G (heavy and light chain) Horserad-
CGAGACCATTTACCACTTCA TAT CT TG ish Peroxidase (HRP) conjugate antibody (di-
-3’). Pfu DNA polymerase (Fermentase) was luted 1:5000 in TBS-T) for 2 hr at room tem-
used in the reaction. The PCR conditions con- perature. After three times of washing, the
sisted of 1 cycle of 5 min at 94°C, followed membrane was treated using DAB solution
by 35 cycles of 1 min at 94°C, 40 s at 57°C, 1 (Sigma, Saint Louis, MO, USA) and placed in
min at 72°C, and a final cycle of 10 min at darkness until the appearance of the protein
72°C. The PCR products were recovered from band 26.
the gel and purified by using PCR purification Purification of recombinant protein
kit (Roche, Germany). The purified mecA E. coli BL21 (DE3) containing pET24a-mecA
fragment was digested with restriction en- plasmid was grown in large scale and the pellets
zymes HindIII and XhoI and ligated into the of bacterial cells expressing protein were
digested pET -24a vector, which provides six harvested and resuspended in lysis buff-er (8 M
His residues at the C-terminus of the ex- urea, 0.1 M NaH2PO4, and 0.01 M Tris, pH=8.0)
pressed protein. Recombinant vector pET24a-
containing protease inhibitors. Cell suspension
mecA was transformed into the competent E. was sonicated and centri-fuged for 20 min at
coli DH5α cells. The integrity of the recov- 10000 rpm. After centrif-ugation, the
ered plasmid was confirmed by colony PCR, recombinant protein (approxi-mately 13 kDa)
6-8 .
Statistical analysis
Data were summarized using descriptive
statistical methods. Student’s independent t-
test (Statview) and one-way analysis of vari-
ance (ANOVA) were used to compare the
mean values. A p-value less than 0.05 repre-
sented a significant difference. All data were
analyzed using SPSS Software Version 20.0
1,6-8 .
Figure 2. Confirmation of recombinant vector by restriction
enzyme digestion. The plasmids were extracted and digested
Results with appropriate restriction enzymes. Lane 1, undigested
Amplification of mecA and construction of recombinant vector, pET24a-mecA; lanes 2, 3, recombinant
pET24a-mecA vector, pET24a- mecA, digested with XhoI and HindIII; lane
4, PCR product of mecA gene (approximately 242 bp); lane
Specific primers were designed to amplify M, 1 kB DNA size marker. Products were electrophoresed on
mecA from the S. aureus COL strain. The ex- 1% w/v agarose gel
pected size of mecA PCR product, approxi-
mately 242 bp, is shown in figure 1. The in- mers. Identity and orientation of mecA in the
tegrity of the recombinant vector pET24a- construct were confirmed by sequencing the
mecA was confirmed by double digestion us- recombinant vector. Cloned mecA gene se-
ing HindIII and XhoI restriction enzymes quence showed 99.9% homology with ref-
(Figure 2) and colony-PCR with specific pri- erence sequences.
208
Avicenna Journal of Medical Biotechnology, Vol. 5, No. 4, October-December 2013
20
Haghighat S, et al
as S. aureus 28. In the presence of this factor, 6. Ohwada A, Sekiya M, Hanaki H, Arai KK, Naga-
oka I, Hori S, et al . DNA vaccination by mecA se-
antibody could bind to the surface antigen of
quence evokes an antibacterial immune response
the pathogen, activating complement system, against methicillin resistant Staphylococcus aureus.
and increasing the phagocytosis of the patho- J Antimicrob Chemother 1999;44(6):767-774.
gen through opsonization process. PBP2a is 7. Roth DM, Senna JP, Machado DC. Evaluation of
able to induce humoral immune response and the humoral immune response in BALB/c mice
could eliminate the pathogen with comple- immunized with a naked DNA vaccine anti- methi-
ment activation and induction of opsonization cillin-resistant Staphylococcus aureus. Genet Mol
29. Res 2006;5(3):503-512.
8. Senna JP, Roth DM, Oliveira JS, Machado DC,
Conclusion Santos DS. Protective immune response against
methicillin resistant Staphylococcus aureus in a
In conclusion, our results show that PBP2a
murine model using a DNA vaccine approach. Vac-
can be expressed in E. coli BL21 (DE3) at a cine 2003;21(19-20):2661- 2666.
high level and stimulate humoral immune re- 9. Goffin C, Ghuysen JM. Multimodular penicillin-
sponse in a murine model. Investigating other binding proteins: an enigmatic family of orthologs
aspects of PBP2a as a potential vaccine and paralogs. Microbiol Mol Biol Rev 1998;62(4):
against MRSA infection, including protectiv- 1079-1093.
ity effect against bacterial challenge and sur- 10. Katayama Y, Ito T, Hiramatsu K. A new class of
vival rate is a ground for future studies. genetic element, Staphylococcus cassette chromo-
some mec, encodes methicillin resistance in Staph-
ajmb.org
References 13. Stranger-Jones YK, Bae T, Schneewind O. Vaccine
1. Kuklin NA, Clark DJ, Secore S, Cook J, Cope LD, assembly from surface proteins of Staphylococcus
McNeely T, et al. A novel Staphylococcus aureus aureus. Proc Natl Acad Sci USA 2006;103(45):
vaccine: iron surface determinant B induces rapid 16942-16947.
antibody responses in rhesus macaques and specific 14. Cohen ML. Staphylococcus aureus: biology, mech-
increased survival in a murine S. aureus sepsis anism of virulence, epidemiology. J Pediatr 1986;
model. Infect Immun 2006;74(4):2215-2223. 108(5 Pt 2):796-799.
2. Selvey LA, Whitby M, Johnson B. Nosocomial
methicillin resistant Staphylococcus aureus bacte- 15. Foster TJ. Potential for vaccination against infec-
remia: is it any worse than nosocomical methicillin tion caused by Staphylococcus aureus. Vaccine
sensitive Staphylococcus aureus bacteremia. Infect 1991;9(4):221-227.
Control Hosp Epidemiol 2000;21(10):645-648. 16. Michie CA. Staphylococcal vaccines. Trends Im-
3. Cooper BS. Infection control in healthcare settings. munol 2002;23(9):461-464.
parliamentary office of science and technology 17. Pourmand MR, Foster SJ. A novel bioinformatics
2005;247:1-5. approach for Staphylococcal vaccine development.
4. Lowy FD. Staphylococcus aureus infection. N Engl Tehran Univ Med J 2006;19-27.
J Med 1998;339(8):520-532. 18. Weichhart T, Horky M, Söllner J, Gangl S, Henics
5. Deleo RF, Otto M, Kreiswirth BN, Chambers HF. T, Nagy E, et al. Functional selection of vaccine
Community-associated methicillin-resistant Staph- candidate peptides from Staphylococcus aureus
ylococcus aureus. Lancet 2010;375(9725):1557- whole-genome expression libraries in vitro. Infect
1568. Immun 2003;71(8):4633-4641.
19. Etz H, Minh DB, Henics T, Dryla A, Winkler B, 24. Lim D, Strynadka CJ. Structural basis for the ß-
Triska C, et al. Identification of in vivo expressed lactam resistance of PBP2a from methicillin-resis-
vaccine candidate antigens from Staphylococcus tant Staphylococcus aureus. Nat Struct Biol 2002;9
aureus. Proc Natl Acad Sci USA 2002;99(10):6573- (11):870-876.
6578. 25. Hong N, Yun-ying W, Wei-xian CH. Clone and
20. Jones C. Revised structures for the capsular poly- construction of prokaryotic expression plasmid of
saccharides from Staphylococcus aureus Types 5 MRSA-PBP2a. Chinese J Microbiol 2011;05:007.
and 8, components of novel glycoconjugate vac-
26. Goudarzi G, Sattari M, Roudkenar MH, Montajabi-
cines. Carbohydrate Res 2005;340(6):1097-1106. Niyat M, Zavaran-Hosseini A, Mosavi-Hosseini K.
21. Josefsson E, Hartford O, O'Brien L, Patti JM, Fos- Cloning, expression, purification, and characteriza-
ter T. Protection against experimental Staphylococ- tion of recombinant flagellin isolated from Pseu-
cus aureus arthritis by vaccination with clumping domonas aueroginosa. Biotechnol Lett 2009;31(9):
factor A, a novel virulence determinant. J Infect Dis 1353-1360.
2001;184(12):1572-1580. 27. Tsumoto K, Abe R, Ejima D, Arakawa T. Non de-
22. Ito T, Hiramatsu K, Tomasz A, de Lencastre H, naturing solubilization of inclusion bodies. Curr
Perreten V, Holden MT, et al. Guidelines for re- Pharm Biotechnol 2010;11(3):309-312.
porting novel mecA gene homologues. Antimicrob 28. Casadevall A. Antibody-mediated immunity against
Agents Chemother 2012;56(10):4997-4999. intracellular pathogens: two-dimensional thinking
23. Mamo W, Jonsson P, Flock JI, Lindberg M, Müller comes full circle. Infect Immun 2003;71(8):4225-
HP, Wadström T, et al. Vaccination against Staph- 4228.
ylococcus aureus mastitis: Immunological response 29. Abbas AK, Litchtman AH, Pillai SH. Cellular and
of mice vaccinated with fibronectin-binding protein molecular immunology. 6th ed. Philadelphia: Else-