BABS1201- Molecules, Cells and Genes

Mendel’s laws of heredity

Reading:
Campbell et al, Chapters 13 and 14
Knox et al, Chapters 8 and 9

Dr Paul Waters
School of Biotechnology and
Biomolecular Sciences
 Outline
•  Idea of genetic information; variation and heredity
•  Reproduction and life cycles
•  Sex vs asex, prokaryotes vs eukaryotes
•  Meiosis and the transmission of genetic information in
sexual diploid eukaryotes
•  Basic concepts: loci and alleles, genotype and phenotype,
homozygotes and heterozygotes, dominant and recessive
•  Mendel's laws:
•  1. Segregation of alleles
•  2. Independent assortment of alleles
 What is genetics?
•  The study of heredity (or inheritance):
•  how biological information is passed from
organisms to their offspring
•  biological information = sequence of bases in
DNA.
•  What else is passed on from parents to
offspring?
•  How information is stored?
 Genetic information

CATGCTACGCGCAAATCGAT Phenotype

CATGCTACGCACAAATCGAT Phenotype
(genetic state) (physical
trait of
organism)

•  Genome: the complete genetic composition

of an organism or a cell or an organelle
 What do genomes look like?
Prokaryotes vs Eukaryotes
•  Eukaryotes:
•  have linear chromosomes. Usually
multiple chromosomes per
genome.
•  Prokaryotes:
•  usually have circular
chromosomes.
•  Prokaryotes also sometimes
contain plasmids which are small
circular DNA molecules.
•  Plasmids are self-replicating.
•  Plasmids often carry genes.
 Important concepts in genetics:
Locus
Allele
(plural: loci)
A form or variant
A place on a chromosome
of a gene (at a locus)
where a gene is located

Genotype e.g. bacteria ...GTG...

Allele(s) in an individual, ...GAG...
e.g. pqr+
-
+
pqr
pqr
Phenotype
The physical traits
of an organism,
e.g. paraquat synthesises
Can Can't
 Example from bacteria
•  Variation in metabolic gene, e.g.
•  leu+ can synthesise leucine
•  leu- cannot synthesise leucine; needs leucine in
medium to grow
•  Neutral variation, e.g.
•  Single Nucleotide Polymorphism (SNP) in a region of
DNA between genes.

•  Note: earlier lecture about how variation is produced

through mutation.
 Asexual vs Sexual Reproduction
•  To understand genetics, we need to understand
reproduction.
•  Asexual
•  under asexual reproduction,
offspring are genetic copies
of parents.
•  Prokaryotes: binary fission
•  Some eukaryotes, e.g. some
plants, aphids sometimes,
hydra
Asexual vs Sexual Reproduction

•  Sexual
•  under sexual reproduction,
offspring are genetic
combinations of parents.
•  e.g. most plants and animals,
yeast sometimes.
Human chromosomes

•  22 pairs of autosomes +
1 pair of sex
chromosomes XX or
XY
How does this genetic
material get combined in
the offspring?
 Sexual reproduction: humans
•  22 autosomes + X Key Haploid gametes (n = 23)

chromosome from mother Haploid (n)

Diploid (2n)
Egg (n)

and 22 autosomes + X or Y
chromosome from father.
•  How does a cell with 46 Sperm (n)
chromosomes produce one MEIOSIS FERTILISATION

with 23?
Meiosis Ovary Testis
•  Fertilisation occurs when Diploid
two gametes fuse to form a zygote
(2n = 46)
zygote with 2n (=46 in
Mitosis and
humans) chromosomes. development

Multicellular diploid
adults (2n = 46)
 Meiosis and chromosomes
•  Earlier in the course, you heard about the cellular
details of meiosis.
•  Here, we consider the genetic consequences of
meiosis.
•  Chromosomes are paired: homologous
chromosomes
•  Each gene has a homologous copy on the other
chromosome
 Review of meiosis
MITOSIS MEIOSIS

Parent cell MEIOSIS I

Chiasma

Prophase Prophase I
Chromosome Chromosome
Duplicated duplication duplication Homologous
chromosome 2n = 6 chromosome pair

Metaphase Metaphase I

Anaphase Anaphase I
Telophase Daughter Telophase I
cells of
Haploid
meiosis I n=3

2n 2n MEIOSIS II
Daughter cells n n n n
of mitosis
Daughter cells of meiosis II
Independent assortment
(of chromosomes)
 Crossing over of chromosomes
during meiosis

•  Crossing over of
homologous chromosomes
during meiosis leads to
recombination of genetic
information.
 Important concepts in genetics: diploids
Locus Allele
A place on a chromosome A form or variant
where a gene is located of a gene or locus

...GAG... ...GTG...

Genotype Homozygote
The combination of alleles Genotype with two
in an individual Y y same alleles at a locus.
E.g. YY

Phenotype Heterozygote
The physical traits Genotype with two
of an organism, e.g. Yellow peas different alleles at a locus
Yy
E.g. Yy

Dominant allele Recessive allele

Allele that determines Allele that does not affect
phenotype in heterozygote, e.g. Y phenotype in heterozygote, e.g. y
Example
Homozygotes

GENOTYPES

PP Pp pp

PHENOTYPES
Example
Heterozygote

GENOTYPES

PP Pp pp

Dominance:
Purple is dominant, white is recessive
P is dominant, p is recessive
How do we know... 1865

Mendel made these inferences

before anyone knew what genes
...that there are discrete genes? were or what they're made of!

...that there are two homologous

copies that segregate as a step in
sexual reproduction?

...that alleles at two loci

sometimes segregate
independently?

Gregor Mendel
Father of modern genetics
Mendel’s peas
Mendel’s peas

R r

R RR Rr

r rR rr
 Mendel: segregation of alleles
•  Consider a single
character: flower
colour.
•  Ratio of purple to
white phenotypes
in the F2
generation is 3:1

Measured ratio was 3.15 : 1

F1 means first generation

•  Only explanation is a
“factor” (gene) that is
inherited discretely
•  That is, particulate
inheritance instead of
blending inheritance,
which cannot explain
this result.
•  What would happen
under blending
inheritance?

Heterozygotes
Blended inheritance

Wrong!
 Test cross

Phenotype = purple

What is the
GENOTYPE?
Mendel: independent assortment
•  Now consider two characters, each
determined by one gene (or locus)

•  Suppose the two genes are on different

chromosome pairs.

F1 Dihybrid cross
Mendel: independent assortment

•  Ratio of phenotypes:
•  9 : 3 : 3 : 1
 It gets more complicated…
•  AaBbCc × AaBbCc
•  8 distinct phenotypes, and 68 genotypes in a ratio of
•  27:9:9:9:3:3:3:1

•  AaBbCcDd × AaBbCcDd
•  16 distinct phenotypes, and 256 genotypes in a ratio of
•  81:27:27:27:27:9:9:9:9:9:9:3:3:3:3:1
Consider this….

•  IF each of our 22 chromosomes are the units that assort

independently into gametes

•  Number of gametes any one individual can produce:

2^22 = 4,194,304

•  Probability of two people having genetically identical children

from differnet pregnacies:
1 in (4194304 x 4194304) 17.59 trillion
 Crossing over of chromosomes
during meiosis

•  Crossing over of
homologous chromosomes
during meiosis leads to
recombination of genetic
information.
Consider this….

•  IF each of our 22 chromosomes are the units that assort

independently into gametes

•  Number of gametes any one individual can produce:

2^22 = 4,194,304

•  Probability of two people having genetically identical children

from differnet pregnacies:
1 in (4194304 x 4194304) 17.59 trillion
 Mendel's laws – summary
•  Mendel's first law: diploid individuals carry two
copies (alleles) of a gene. The two copies
segregate (separate) during formation of gametes.
Individuals inherit one copy from each parent.
•  In Mendel's experiment, two phenotypes in F2 generation are in
ratio 3:1.

•  Mendel's second law: for two genes, the pairs of

alleles assort independently into gametes (when
the genes are on separate chromosomes).
•  In Mendel's experiment, the phenotypes in F2 generation are in
ratio 9:3:3:1.
See you next time – Mechanisms of Inheritance