Scribd Logo
Upload

Welcome to Scribd!

  • Influenza

    Uploaded by

    sharon gomez solorio
    5 views1 page
    The document contains information on 5 primer pairs for influenza. Each primer pair lists the left and right primers with their length, melting temperature, GC percentage, and product size. The document also provides data on primer complementarity for each pair.

    Original Description:

    tryu56yufb gthtrf gh

    Copyright

    © © All Rights Reserved

    Available Formats

    DOCX, PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    Report this Document
    The document contains information on 5 primer pairs for influenza. Each primer pair lists the left and right primers with their length, melting temperature, GC percentage, and product size. The document also provides data on primer complementarity for each pair.

    Copyright:

    © All Rights Reserved
    Download as DOCX, PDF, TXT or read online from Scribd
    Flag for inappropriate content
    5 views1 page

    Influenza

    Uploaded by

    sharon gomez solorio
    The document contains information on 5 primer pairs for influenza. Each primer pair lists the left and right primers with their length, melting temperature, GC percentage, and product size. The document also provides data on primer complementarity for each pair.

    Copyright:

    © All Rights Reserved
    Download as DOCX, PDF, TXT or read online from Scribd
    Flag for inappropriate content
    of 1

    Influenza.

    1 LEFT PRIMER 87 20 60.09 45.00 4.00 0.00


    TCTTTGCAGGGAAAAACACC
    RIGHT PRIMER 265 20 59.95 40.00 6.00 2.00
    TGGATCCCCATTTCCATTTA
    PRODUCT SIZE: 179, PAIR ANY COMPL: 5.00, PAIR 3' COMPL: 0.00

    2 LEFT PRIMER 87 20 60.09 45.00 4.00 0.00


    TCTTTGCAGGGAAAAACACC
    RIGHT PRIMER 254 20 59.89 45.00 3.00 0.00
    TTCCATTTAGGGCATTCTGG
    PRODUCT SIZE: 168, PAIR ANY COMPL: 4.00, PAIR 3' COMPL: 2.00

    3 LEFT PRIMER 87 20 60.09 45.00 4.00 0.00


    TCTTTGCAGGGAAAAACACC
    RIGHT PRIMER 262 20 59.85 45.00 3.00 2.00
    ATCCCCATTTCCATTTAGGG
    PRODUCT SIZE: 176, PAIR ANY COMPL: 5.00, PAIR 3' COMPL: 2.00

    4 LEFT PRIMER 87 20 60.09 45.00 4.00 0.00


    TCTTTGCAGGGAAAAACACC
    RIGHT PRIMER 248 20 60.21 50.00 3.00 0.00
    TTAGGGCATTCTGGACGAAG
    PRODUCT SIZE: 162, PAIR ANY COMPL: 3.00, PAIR 3' COMPL: 1.00

    5 LEFT PRIMER 115 20 60.36 55.00 6.00 1.00


    GGCTCTCATGGAGTGGCTAA
    RIGHT PRIMER 265 20 59.95 40.00 6.00 2.00
    TGGATCCCCATTTCCATTTA
    PRODUCT SIZE: 151, PAIR ANY COMPL: 5.00, PAIR 3' COMPL: 3.00
    -o-o-o-o-o-o-o-o-o-o-o-oo-o-o-o-o-o-o-o-o-o-o-o-o-o-o-o-o-o-o-o-o-o-o-o-o-o-o-o-o-o-o

    You might also like