Bioresource Technology 149 (2013) 439–445

Contents lists available at ScienceDirect

Bioresource Technology
journal homepage: www.elsevier.com/locate/biortech

Engineering bacteria for bioremediation of persistent organochlorine

pesticide lindane (gamma-hexachlorocyclohexane)
Akhilesh Kumar Chaurasia a,b, Tapan Kumar Adhya c,d, Shree Kumar Apte a,⇑
a
Molecular Biology Division, Bhabha Atomic Research Centre, Trombay, Mumbai 400 085, India
b
Samsung Biomedical Research Institute, School of Medicine, SKKU, Suwon 440 746, South Korea
c
Central Rice Research Institute, Cuttack, India
d
School of Biotechnology, KIIT University, Bhubaneswar 751 024, India

h i g h l i g h t s

 GroEL expression identified as a major target for lindane toxicity in Anabaena.

 Recombinant Anabaena strain developed to bioremediate lindane in paddy fields.
 LinA2 overexpression facilitated degradation of all isomers of lindane by GM Escherichia coli.
 Fluorescence quenching-based method designed for visual lindane detection on plates.
 Degradation of high lindane levels (2 mg/ml) by dead bioengineered E. coli demonstrated.

a r t i c l e i n f o a b s t r a c t

Article history: Strategies were designed for bioremediation of the highly persistent toxic pesticide c-hexachlorocyclo-
Received 17 June 2013 hexane (c-HCH) or lindane from the environment. Lindane caused the loss of stress-protective chaperone
Received in revised form 17 September 2013 GroEL, and inhibited photosynthesis, respiration and nitrogen-fixation in Anabaena, resulting in growth
Accepted 20 September 2013
arrest. To alleviate lindane toxicity, the linA2 gene, encoding HCH dehydrochlorinase from Sphingomonas
Available online 29 September 2013
paucimobilis B90, was knocked-in at an innocuous locus in Anabaena genome and over-expressed from an
eco-friendly light-inducible PpsbA1 promoter. The recombinant Anabaena degraded >98% of 10 ppm lin-
Keywords:
dane within 6–10 days. A LinA2 overexpressing Escherichia coli strain could degrade 10 ppm of all the iso-
Lindane toxicity and detection
LinA2 overexpression
mers of lindane within 1 h and displayed a visual degradation zone on a newly designed histochemical
Recombinant E. coli/Anabaena strains plate containing 50 mg lindane within 12 h. The study demonstrates (a) bioremediation of traces of lin-
Lindane bioremediation dane prevalent in paddy fields, using bioengineered photoautotrophic Anabaena, and, (b) biodegradation
of huge stockpiles of lindane, by employing recombinant live/dead E. coli.
Ó 2013 Elsevier Ltd. All rights reserved.

1. Introduction
Application of pesticides, in particular insecticides, is a very
common agricultural stress, especially in tropical rice cultivation.
The c-hexachlorocyclohexane (c-HCH), also known as lindane,
has been used earlier as a major organochlorine insecticide world-
wide (Nawab et al., 2003). Lindane accounted for 43% of the total
pesticides produced in India during 1989–1990 (David, 1992).
Commercial formulations of hexachlorocyclohexane (HCH) gener-
ally contain a, b, c and d isomers, which are persistent organic pol-
lutants (Vijgen et al., 2011) with relative toxicity in the order
c > a > d > b (Woodard and Hagan, 1947). Lindane is extremely
toxic to humans and deleterious for environment (Singal and
Thami, 2006). It is rapidly absorbed from the gastrointestinal tract
⇑ Corresponding author. Tel.: +91 22 25595342; fax: +91 22 25505189.
E-mail addresses: aptesk@barc.gov.in, sksmbd@barc.gov.in (S.K. Apte).
of mice or rats and gets extensively distributed in fat, liver, ovarian
tissues and brain. Acute administration by oral, dermal, intraperi-
toneal or intramuscular routes or by inhalation of lindane produces
severe adverse effects and toxicity to the central nervous system.
Adverse effects of lindane on useful soil microflora (Trudgill and
Widdus, 1970) and nitrogen-fixing cyanobacteria, such as Ana-
baena (Bueno et al., 2004; Singh, 1973) substantially reduce their
biofertilizer potential. Lindane concentration >5 ppm has been
shown to be lethal for Anabaena sp. PCC7119 (Bueno et al.,
2004). In view of its serious health hazard, the existing stocks were
ordered to be stored in selected locations by FAO (http://
www.fao.org). Notwithstanding, such regulation lindane continues
to be produced and used in many countries (Lal et al., 2010).
Few bacterial strains isolated from lindane contaminated sites
have been found to degrade lindane under aerobic or anaerobic
conditions (Heritage and MacRae, 1977). For example strains of
Sphingomonas sp. can grow on c-HCH as a sole source of carbon

0960-8524/$ - see front matter Ó 2013 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.biortech.2013.09.084
440 A.K. Chaurasia et al. / Bioresource Technology 149 (2013) 439–445
and energy and are able to completely mineralize lindane under
aerobic culture conditions (Adhya et al., 1996; Nagata et al.,
1997) through the activity of a c-hexachlorocyclohexane dehydro-
chlorinase. The dehydrochlorinase encoding gene linA was cloned
from Pseudomonas paucimobilis UT26 into Escherichia coli and
shown to facilitate biodegradation of c-HCH to 1, 3, 5, or 1, 2, 4-tri-
chlorobenzene via c-pentachlorocyclohexane (c-PCCH) and tetrac-
horohexadiene (TCDN) (Imai et al., 1991). Another strain of
Sphingomonas paucimobilis, strain B90, possesses two variants of
hexachlorocyclohexane dehydrochlorinase LinA1 and LinA2, which
catalyze the initial steps of dehydrochlorination in lindane biodeg-
radation (Kumari et al., 2002; Suar et al., 2005). The linA1 and linA2
genes are 88% identical and linA2 (shorter by 3 nucleotides) is
98% identical to linA of P. paucimobilis (Imai et al., 1991). Both
the HCH dehydrochlorinases LinA1 and LinA2 are equally active
(Kumari et al., 2002; Suar et al., 2005).
Bioremediation of trace amounts of lindane in the field requires
autotrophic, self-sustainable microbes with minimal nutritional
requirement. Filamentous nitrogen-fixing cyanobacterial strains
Anabaena/Nostoc, native to Indian paddy fields, seem to be attrac-
tive candidate organisms for this purpose. The nitrogen-fixing Ana-
baena strains from tropical paddy fields can degrade aromatic
hydrocarbons and xenobiotics to a limited extent (Bender and Phil-
lips, 2004) and have been genetically modified in the past to en-
hance their lindane biodegradation ability by multicopy
expression of linA gene using shuttle vectors (Kuritz and Wolk,
1995; Zhang et al., 2009). However, the environmental application
of such a strain is not feasible because of the possibility of lateral
gene transfer to other non-target microbes in the environment.
Alternatively, dead cells can also be used for a one-time lindane
clean-up.
The present study utilized the linA2 gene and a previously con-
structed integrative expression vector for Anabaena (pFPN) (Chaur-
asia et al., 2008), to genetically engineer E. coli and Anabaena sp.
PCC7120 (hereafter referred to as Anabaena 7120) to address the
lindane toxicity. The lindane toxicity in the environment is of
two kinds: (a) large amount of obsolete lindane dumped unsafely,
and (b) traces present in agricultural fields and water. Strategies
are required, for sensitive detection of lindane and to biodegrade
and mineralize lindane both from the fields and in storage. We
report here (a) development of a sensitive fluorimetric and histo-
chemical method for detection of lindane, (b) construction of an
efficient E. coli strain which can rapidly degrade very high concen-
tration of lindane, and (c) construction of an eco-friendly and sta-
ble recombinant Anabaena strain for lindane bioremediation in
paddy fields.
2. Methods
2.1. Strains and growth conditions
A list of bacterial strains used in this study is given in Table 1.
Anabaena 7120 was photoautotrophically grown in the standard
minimal growth medium BG11 at pH 7.2 (Castenholz, 1988), either
free of combined nitrogen (BG11) or supplemented with 17 mM
NaNO3 (BG11+), under continuous illumination (30 lE m2 s1)
and aeration (2 L min1) at 25 ± 2 °C. Recombinant Anabaena
clones were selected on BG11+ agar plates supplemented with
25 lg mL1 neomycin (Neo25) or in BG11 liquid media supple-
mented with 12.5 lg mL1 neomycin (Chaurasia et al., 2008). Heat
and other stresses were applied by exposing cells to stress under
the usual growth conditions. The growth of Anabaena 7120 was
measured as chlorophyll content in methanolic extract (Mackin-
ney, 1941) or as turbidity (OD750nm). The commercial formulation
of lindane (Sigma–Aldrich), which contains all the isomers of
HCH as minor contaminants, was generally used at the specified
concentrations. In one experiment, the medium was doped with
pure a, b, c and d isomers of HCH (Hooker Chemical Corporation,
New York, USA) at 10 ppm concentration.
E. coli strain DH5a (hereafter referred to as E. coli) cultures were
grown in Luria–Bertani medium (LB) at 37 °C and 150 rpm. The
antibiotics, kanamycin, carbenicillin and chloramphenicol were
used at the final concentration of 50, 100 and 33 lg mL1, respec-
tively for E. coli. S. paucimobilis strain B90 (Bhuyan et al., 1993) was
grown in mineral salt glucose peptone (MSGP) medium (pH 7.0) at
28 ± 2 °C at 120 rpm (Adhya et al., 1996).
2.2. Assessment of photosynthesis, respiration and nitrogen-fixation
Photosynthesis was measured as light-dependent oxygen evo-
lution while rate of respiration was measured as oxygen consump-
tion in dark in Anabaena 7120 at 28 °C by a Clark type electrode
(Oxy-lab 2/2, Hansatech instrument, England) and expressed as
lmol O2 min1 mg1 Chla, calculated as described earlier (Chaur-
asia and Apte, 2009). Anabaena 7120 cultures maintained in
BG11+ medium were washed three times, with 10 volumes of
BG11 medium each, and inoculated in BG11 media for induction
of heterocyst differentiation and nitrogen fixation. Nitrogenase
activity was estimated in 2 mL culture aliquots in 5 mL glass tubes,
by acetylene reduction assay, as described earlier (David et al.,
1980).
2.3. Cloning and overexpression of linA2 in E. coli and Anabaena 7120
A list of primers and plasmids used in this study is given in
Table 1. The linA2 gene was PCR amplified using specific primers
linA2fwd and linA2rev primers (Table 1) from genomic DNA of S.
paucimobilis strain B90, by gradient PCR performed at 62–70 °C
with a gradient of 2 °C. The desired PCR product (471 bp) was
cloned and sequenced to affirm its accuracy and the nucleotide se-
quence was submitted to GenBank (Accession No. FJ608814). The
PCR product was restriction digested with NdeI and BamHI and
cloned at the same sites in pET16b (to obtain pET16blinA2)
(Table 1) or in pFPN vectors (to obtain pFPNlinA2) for expression
in E. coli and Anabaena 7120, respectively (Table 1). The pET16bli-
nA2 and pFPNlinA2 constructs were, respectively transformed into
E. coli BL21 (DE3) containing pLysS and E. coli DH5a to obtain
strains EcLB (Prathap et al., 2012) and EcFPNlinA2, respectively
(Table 1). The plasmid pFPNlinA2 was introduced in Anabaena
7120 by electrotransformation (Chaurasia et al., 2008) and trans-
formed clones were selected on BG11+, supplemented with Nm
(25 lg mL1) plate. The recombinant strain, AnFPNlinA2 (Table 1)
was subcultured repeatedly in liquid BG11+ medium containing
12.5 lg mL1 neomycin to segregate the recombination event.
Strain EcLB was grown in Luria Bertani (LB) medium with car-
benicillin and chloramphenicol to an optical density at 600 nm of
1.0 and induced with 1 mM isopropylthiogalactopyranoside
(IPTG) for 3 h to induce LinA2 expression. The cells were sonicated
on ice bath in lysis buffer (100 mM Tris Cl, 300 mM NaCl, pH 8.0)
and the protein extracts were electrophoretically resolved by 14%
SDS–PAGE. LinA2 overexpression was detected by staining with
Coomassie Brilliant Blue G-250. To purify recombinant LinA2
protein, the protein extract in lysis buffer was bound to Ni2+-
nitrilotriacetic acid (NTA)-agarose with gentle shaking on ice bath
for 2 h. Binding to the Ni2+-NTA resin slurry, washing, and subse-
quent elution steps were performed as specified (QIAGEN protein
purification kit, Germany). To raise an antibody against Sphingo-
monas LinA2, the recombinant LinA2 purified from E. coli was
employed for immunization. The primary and booster immuniza-
tions and collection of the antiserum were performed with the help
of a commercial facility at Bangalore Genei Pvt. Ltd., Bangalore.
 A.K. Chaurasia et al. / Bioresource Technology 149 (2013) 439–445 441

Table 1
List of strains, plasmids and primers.

Strains, plasmids, and primers Features Source/reference

Strains
E. coli DH5a FmcrAD(mrr-hsdRMS-mcrBC) u80lacZDM15 Lab collection
DlacX74 nupG recA1 araD139 D(ara-leu)7697
galE15 galK16 rpsL(Spr) endA1 k
E. coli BL21(DE3) Host for T7 based expression possess as (DE3) lysogen and pLysS expressing Lab collection
low level T7 lysozyme, Cmr
Sphingomonas paucimobilis strain B90 Wild type lindane degrading strain of Sphingomonas Lab collection
Anabaena sp. strain PCC7120 Wild type Anabaena strain Prof. Robert Haselkorn Chicago, USA
AnFPN FPN cassette at F region Chaurasia et al. (2008)
AnFPNlinA2 LinA2 expressing Anabaena 7120 This study
EcFPNlinA2 LinA2 expressing E. coli DH5a This study
EcpET16blinA2 E. coli BL21 overexpressing LinA2 This study
EcpFPN E. coli DH5a with pFPN This study
EcLB E. coli BL21 with pET16b Prathap et al. (2012)
Primers
linA2fwd 50 AGGAGATACCATATGAGTGATCTAC 30 This study
linA2rev 50 AATGGATCCTTATGCGCCGGACGGTGC 30 This study
PpsbA1fwd 50 GAGCTGCAGGGATTCCCA AAGATAGGG 30 Chaurasia et al. (2008)
PpsbA1rev 50 CTCGGATCCCCATATGTTTTTATGATTGCTTTG 30 Chaurasia et al. (2008)
Plasmids
pFPN An integrative expression vector for Anabaena Chaurasia et al. (2008)
pFPNlinA2 linA2 cloned at NdeI and BamH1 sites of pFPN This study
pET16b E. coli overexpression vector Novagen, USA
pET16blinA2 linA2 cloned at NdeI and BamH1 sites of pET16b Prathap et al. (2012)

Sites for restriction endonucleases, NdeI and BamHI, in the primers are underlined.

2.4. Western blotting and immunodetection of LinA2 and GroEL the histochemical plate to visualize dark non-fluorescing degrada-
proteins tion zone because fluorescence quenching.

Protein extracts from Anabaena strains were resolved by 14%
SDS–PAGE and proteins were transferred to nitrocellulose mem-
branes. Immunodetection of LinA2 protein in EcFPNlinA2 and
AnFPNlinA2 was carried out with primary polyclonal antibody
generated in rabbits against recombinant LinA2 protein (anti-
SphLinA2). After treatment with secondary antibody (anti-mouse
IgG-Alkaline Phosphatase conjugate), the color reaction was
carried out using nitrobluetetrazolium chloride 5-bromo-4-
Chloro-3-indolyl phosphate (NBT/BCIP) toluidine salt (Roche
Applied Sciences, Germany) in dark. GroEL protein was immunode-
tected using a polyclonal anti-AnGroEL antibody, as described
earlier (Chaurasia and Apte, 2009; Rajaram and Apte, 2008).
2.5. Histochemical assays for lindane biodegradation
Cells were washed twice with dehydrochlorinase buffer con-
taining 0.5 mM HEPES [4-(2-Hydroxyethyl) piperazine-1-ethane-
sulfonic acid sodium salt], 10 mM Na2SO4 and 0.5 mM EDTA (pH
8.2) (Phillips et al., 2001) and re-suspended into fresh buffer. The
phenol-red based colorimetric assay was performed as described
earlier (Phillips et al., 2001). The a, b, c and d isomers stock solu-
tions contained 25 mg mL1 in acetone. The detection of lindane
was based on fluorescence quenching (kexcitation 490 nm, kemission
520 nm) of fluorescein due to lindane biodegradation and concom-
itant generation of hydrochloric acid (HCl). The fluorimetric assay
for lindane was carried out as described by Phillips et al. (2001),
except for adding 1 ppb fluorescein in place of phenol red as
indicator. The histochemical plate contained 1.5% LB agar supple-
mented with 10 ppm fluorescein and 2 mg mL1 lindane. The plate
was fluorescent and opaque because of fluorescein and immiscibil-
ity of lindane in water, respectively. The fluorescence of the plate
could be intensified by UV exposure using a UV transilluminator
(k300nm). The uninduced and induced EcLB cells were patched on
2.6. Lyophilization of E. coli BL 21 strain and live and dead cell staining
Cell mass from 1 L of induced EcLB cultures (OD600 = 1.5) was
harvested and washed with 0.85% saline. A thick suspension of
cells was frozen in liquid nitrogen and lyophilized without any
cryoprotectant (Lyospeed, Genevec, UK) at 0.07 mbar for 5 h and
stored further at room temperature in desiccators until use. Viabil-
ity of the cells was determined by their resuspension in LB broth or
on LB-agar plate and determination of colony forming units (CFU),
after appropriate dilutions as described earlier (Seetharam et al.,
2009). Staining was performed using fluorescein diacetate (FDA)
or propidium iodide (PI) to assess the viability of lyophilized cells
with the heat killed (100 °C for 10 min) or with EcLB cells induced
with IPTG for 3 h (Auty et al., 2001). The stock solutions of FDA
(10 mg mL1) and PI (5 mg mL1) were prepared in formamide
and ethyl alcohol, respectively.
2.7. Lindane biodegradation by recombinant E. coli or Anabaena cells
overexpressing LinA2
The IPTG-induced E. coli BL21 cells carrying plasmids over-
expressing LinA2 protein were inoculated in mineral salt glucose
peptone (MSGP) medium at the initial OD600 0.1 OD in 50 mL
Erlenmeyer flask. Recombinant AnFPNlinA2 strain was grown as
described. The cultures were supplemented with lindane at a final
concentration of 10 ppm. Appropriate controls were also main-
tained. Aliquots were taken out at different time intervals and cen-
trifuged (4000g  5 min) to pellet the cells. The supernatant was
extracted with hexane and analyzed for HCH degradation in a
microprocessor controlled gas chromatograph (Perkin Elmer,
USA) equipped with a 63Ni EC-detector and a glass column
(2.45 m length  6 mm O.D.) packed with DC-200 (10%) and QF-1
(15%) on Chromosorb W. Column, injector and detector tempera-
tures were maintained at 190, 210 and 280 °C, respectively and
442 A.K. Chaurasia et al. / Bioresource Technology 149 (2013) 439–445

carrier gas (nitrogen) at a flow rate of 30 mL min1. Under these
conditions the retention times for various components were:
1.8 min (a-HCH), 2.52 min (c-HCH), 2.28 min (b-HCH), 4.19 min
(d-HCH), 0.66 min (a-PCCH) and 1.63 min (c-PCCH). Each compo-
nent was quantified by integrating the area under the respective
peaks, using Spectra Physics Integrator (Adhya et al., 1996).
tion of PSII activity by lindane, has been reported in another strain,
Anabaena sp. PCC7119 (Bueno et al., 2004). Growth of Anabaena
7120 was correspondingly inhibited at and above 25 ppm lindane
under nitrogen-fixing conditions, though the nitrate-supple-
mented cultures showed some tolerance to lindane (Fig. 1B). Such
adverse effects on several vital cellular activities indicated the
likely involvement of a common molecular target.

3. Results and discussion 3.2. Effect of xenobiotics on GroEL levels

3.1. Effect of lindane on Anabaena
For bioremediation of traces of lindane in environment (soil,
water, crop residues etc.) use of native microbes inhabiting such
environments is desirable. Photoautotrophic, nitrogen-fixing
strains of the cyanobacterium Anabaena are naturally abundant
in tropical paddy field, which makes them an ideal choice for such
purpose. However, lindane at 12.5 ppm inhibited nitrogenase
activity in Anabaena 7120 by 87% in 3 days and increasing con-
centrations of lindane (25 and 50 ppm) showed further decrease
in nitrogenase activity, resulting in complete loss of nitrogenase
activity at 100 ppm lindane (data not included). The real-time
analysis of oxygen evolution from lindane treated cells also
showed 90% inhibition of photosynthesis after 7 days (Fig. 1A).
The inhibition of photosynthesis, due to non-competitive inhibi-
A GroEL protein (Fig. 2B and C). Lindane appeared to strongly inter-
In Anabaena strains GroEL expression is induced under several
abiotic stresses (Bhagwat and Apte, 1989; Apte, 2001). This molec-
ular chaperone plays an important role in protein folding, confor-
mation and homeostasis, both under normal and particularly
under stressful conditions (Apte, 2001; Rajaram and Apte, 2003).
Hsp60 family chaperones (GroEL and Cpn60) have been known
to be important for general stress tolerance and are crucial for pho-
tosynthesis (Rajaram and Apte, 2008; Chaurasia and Apte, 2009) in
Anabaena, and for nitrogenase enzyme assembly (Fischer et al.,
1999) and nitrogen-fixation in various microbes including Ana-
baena species. The GroEL levels were enhanced by many stresses
(Fig. 2A) in Anabaena 7120, including heat stress, both in nitrogen
depleted or nitrogen-replete conditions (Fig. 2A–C). When the Ana-
baena culture was supplemented with 10 ppm of lindane in the
beginning of the experiment and exposed to heat stress for 4 h,
the control culture devoid of lindane displayed significant induc-
tion GroEL but the lindane supplemented culture did not show
fere with GroEL expression in response to lindane exposure irre-
spective of nitrogen status (Fig. 2B and C). This raised the
possibility that lindane may contribute to the degradation GroEL
protein or repress expression at transcriptional/translational level.
Furthermore, the GroEL protein was not detectable even on simul-
taneous exposure of Anabaena culture to lindane and heat stress,
presumably due to repression at transcriptional/translational level
(Fig. 2D), which needs further evaluation. Lack of expression/deg-
radation of molecular chaperon GroEL, thus appears to be a major
target of lindane toxicity in Anabaena. Loss of such stress-protec-
tive molecular chaperone may explain the inability of Anabaena
strains to grow during lindane toxicity and has opened new re-
search possibilities.

3.3. Lindane biodegradation using EcLB strain

- - The LinA2 HCH dehydrochlorinase was overexpressed as N-ter-

B 24
( μ g Chlorophyll a. ml-1)
BG11 ,
-
BG11 + 25 ppm Lindane
+ minal 10His-tagged 17 kDa protein in the recombinant E. coli
BG11 + 50 ppm Lindane, BG11
+ (EcLB) cells. The induction by IPTG was maximum at 3 h (Fig. 3A)

20 BG11 + 25 ppm Lindane

+
and stagnated beyond 3 h (data not included). Electrophoretic reso-
BG11 + 50 ppm Lindane
lution by SDS–PAGE, Western blotting and immunodetection, using
16
AntiHis or r-LinA2 antibody from EcFPNlinA2 clone showed two
Growth

additional bands (34 and 68 kDa) suggesting possible di- and
12
tetra-merization of the protein (Fig. 3B) The lindane biodegradation
by the wild type S. paucimobilis strain B90 was 1.7 times faster
8
than EcpFPNlinA2 (Fig. 3C). The EcLB strain was far superior and de-
graded 10 ppm lindane within 1 h, as assessed by the GC-ECD anal-
4
ysis (Fig. 3C). Interestingly, the LinA2 overexpressing EcLB as well as
the parent S. paucimobilis B90 strain degraded alpha, beta gamma
0
0 1 2 3 4 5 6 7 8 and delta isomers (Fig. 3D). The EcLB strain degraded 95% of
Time (days) 10 ppm of all isomers of lindane in 1 h, while the parent S. paucim-
obilis B90 strain showed <50% degradation only after 24 h (Fig. 3D).
Fig. 1. Adverse effects of lindane on Anabaena 7120. Assessment of diazotrophic
growth and major metabolic activities in the presence of 10 ppm of lindane for 3.4. Detection and biodegradation of high concentration of lindane
7 days. (A) Respiration and photosynthesis in Anabaena, measured as oxygen uptake using EcLB strain
in dark and light-dependent oxygen evolution, respectively. (B) Effect of lindane on
the growth of Anabaena. Growth was assessed as increase in the chlorophyll a
content with time in combined nitrogen free (BG11) or combined nitrogen- Detection and estimation of traces of lindane in the
supplemented (BG11+) media. environmental samples requires very sensitive and yet easy to
 A.K. Chaurasia et al. / Bioresource Technology 149 (2013) 439–445 443

Fig. 2. Immunodetection of GroEL l in Anabaena 7120 exposed to various stresses (A) Log phase Anabaena 7120 cells were grown either without stress (lane 1) or exposed to
42 °C for 4 h (lane 2), or 150 mM NaCl for 12 h (lane 3), or pH 5 for 12 h (lane 4), or 5 lM methyl viologen induced oxidative stress for 4 h (lane 5), or 5 mM cadmium for 12 h
(lane 6), or dark (24 h) (lane 7), or osmotic stress, applied as 200 mM sucrose, for 12 h (lane 8). Post-stress, proteins were extracted, electrophoretically resolved (20 lg/lane)
by 10% SDS–PAGE and electroblotted. GroEL levels were immunodetected using an anti-AnGroEL antibody. (B and C) Inhibition of GroEL expression during exposure to
lindane in cells grown either in (B) combined nitrogen-free, or (C) combined nitrogen-supplemented conditions. Various lanes in panel BI depict unstressed control cells (C),
cells exposed to 42 °C for 4 h (H), or cells incubated with 10 ppm lindane for 1d (L). Panel BII shows protein loading controls (200 lg protein per lane). (D) Interference in
GroEL expression by lindane. Cell-free extracts of cultures grown in nitrogen depleted (BG11) or nitrogen-replete (BG11+) growth conditions and exposed (+) to heat and/or
lindane stress were resolved by 14% SDS–PAGE, electroblotted and GroEL protein was immunodetected on western blot with an anti-AnGroEL antibody. Unstressed controls
() were also included for comparison.

use methods. Several such methods are currently in vogue (Phillips
et al., 2005) including gas chromatography which detects lindane
at 1–10 ppt level. Recently, we developed a very sensitive, specific
and relatively stable electrochemical biosensor involving geneti-
cally engineered EcLB cells for the detection of 1–10 ppt levels of
lindane in situ (Prathap et al., 2012). Estimation of lindane degrada-
tion from stockpiles, on the other hand, requires visual scoring
methods which would work at high concentration (mg/g or
mg mL1) of lindane. Discoloration of phenol red has been one such
method in use at ppm concentration of lindane (Phillips et al.,
2001).
Biodegradation of lindane generates hydrochloric acid which
causes proportional acidity in dehydochlorinase buffer and can
be detected using phenol red (Phillips et al., 2001). The design of
a histochemical plate based on phenol red was not optimal for vi-
sual assessment because of diffusion of yellow color. The fluores-
cence of fluorescein is quenched with decrease in pH in
dehydrochorinase buffer. This observation can be used to assess
lindane biodegradation based detection by fluorimetry and was
employed to design a histochemical plate to visualize lindane bio-
degradation at very high concentration by EcLB strain. The geneti-
cally engineered EcLB strain could grow on and degrade very high
concentration of lindane added (2 mg mL1, or 2000 ppm). Such
biodegradation of lindane could be easily visualized after overnight
(12 h) growth on histochemical plate containing fluorescein, as a
non-fluorescent dark halo zone around the LinA2 expressing patch
of recombinant EcLB cells. In comparison, the un-induced control
cells did not show a clearance zone around the cells (data not
shown). To the best of our knowledge, until now, no native or
genetically modified organism has been reported to degrade such
a high concentration of lindane (2 mg mL1). The EcLB strain shows
a promise to clean the unused unsafely dumped lindane stockpiles
and needs to be evaluated in a real life situation.
The positive control for dead (heat-killed) and live (exponential
phase growing) EcLB cells on FDA/PI staining showed intact red
fluorescent cells and green fluorescent cells (data not included),
respectively. The light microscopic examination of EcLB cells,
lyophilized without cryopreservative, revealed disintegration of
EcLB cell morphology. Such cells were unable to take PI stain and
showed green fluorescence (all over the slide) due to enzymatic
liberation of fluorescein from FDA, but no intact green fluorescent
cells (data not shown). The liberation of fluorescein suggested the
preservation of membrane bound esterase activity. No E. coli colo-
nies were observed upon resuspending lyophilized cells in LB med-
ia and plating on the LB agar plate (data not shown). Lindane
biodegradation experiment was also carried out using dead EcLB
cells, which preserved the LinA2 enzymatic activity. Equivalent
number of dead and live EcLB cells were tested for phenol red
based biodegradation assay at 100 ppm lindane concentration
and showed similar change in color of phenol red to yellow or com-
parable activity (data not shown). Thus, dead EcLB cells can also be
used for lindane biodegradation.
3.5. Expression of LinA2 and lindane biodegradation by recombinant
Anabaena strain
Anabaena 7120 was genetically engineered to degrade Lindane
(Fig. 4). Expression of LinA2 in strain AnFPNlinA2 was confirmed
by immunodetection using newly generated Anti-SphLinA2 anti-
body. Anabaena 7120 does not possess the linA2 gene or the
444 A.K. Chaurasia et al. / Bioresource Technology 149 (2013) 439–445

Time(h) Time(h) A
A M U 0.5 1 2 3 B 0 1
~68 kDa
~68 kDa
66
45 ~34 kDa
36 ~34 kDa B 10

29
24
Uninoculated
20

Lindane (ppm)
-
~17
17 kDa 1 AnFPN (N )
~17 kDa +
AnFPN (N )
r-LinA2 r-LinA2 -
AnFPNlinA2 (N )
14.2 +
AnFPNlinA2 (N )

C 0.1

0.01
0 2 4 6 8 10 12 14 16
Time (days)

Fig. 4. Lindane biodegradation by recombinant Anabaena strains. (A) Expression of

LinA2 in Anabaena. Strains AnFPN (lane 1) and AnFPNlinA2 were grown for 3 days
and protein extracts (20 lg/lane) were resolved by 14% SDS–PAGE and electro-
blotted. LinA2 levels were immunodetected using an Anti-SphLinA2 antiserum. (B)
Lindane biodegradation by AnFPNlinA2 strain grown in BG-11 medium either
without combined nitrogen (N) or supplemented with combined nitrogen (N+).
AnFPN control cells were also included for comparison. Lindane levels were
detected by gas chromatography.

α−HCH
D β HCH
β− substantial lindane biodegradation was observed in AnFPN control
10
γ−HCH (95% in 13d) (Fig. 4B). But the AnFPNlinA2 was far more efficient
8 δ−HCH and rapidly degraded 10 ppm lindane (95%) in 6d.
pm)

Nitrogen-replete cultures of Anabaena 7120 are known to de-

6
CH (pp

grade lindane at low efficiency, probably through expression and

activity of nir operon (Kuritz et al., 1997). Earlier, Anabaena 7120
4
HC

was genetically modified to express linA2 using multicopy replica-

2 tive vector. Such strain could degrade lindane at low efficiency and
displayed relatively reduced sensitivity to Lindane (Kuritz and
0 Wolk, 1995). The present work engineered Anabaena 7120 to con-
0h h ) I) B90
rol l 24 cLB (C EcLB (
. Cont C ontro E stitutively overexpress lindane biodegradation capability using an
n .
Uni Uni
n
integrative expression approach. Strain AnFPNlinA2 degraded lin-
Strains dane consistently both in fixed-nitrogen deficient or supplemented
growth conditions. It is a genetically stable strain that has been
Fig. 3. HCH dehyrochlorinase (r-LinA2) expression in E. coli BL21 and assessment of
lindane biodegradation by recombinant EcLB strain. (A) Overexpression of r-LinA2 maintained in our laboratory for more than 4 years without any
protein. Induction of LinA2 (17 kDa) protein level by IPTG at different time points antibiotic pressure. The employment of an integrative approach
was visualized by resolving proteins (20 lg) by 14% SDS–PAGE followed by CBB minimizes chances of lateral gene transfer to other non-target
staining. Various lanes show: SDS-7 marker (M); uninduced cells (U), and cells
organisms and makes it suitable for environmental application
induced by IPTG for different duration. (B) Western blotting and immunodetection
of r-LinA2 using an anti-His primary antibody. Various lanes show protein r-LinA2 for lindane bioremediation in rice fields, using an ecofriendly light
levels after IPTG-induction for 0 h and after 1 h. (C) Assessment of lindane inducible promoter for constitutive overexpression. The well-con-
biodegradation by Gas Chromatographic Analysis. Lindane biodegradation by wild trolled laboratory studies, reported in the present work, have dem-
type Sphingomonas paucimobilis strain B90, recombinant strains EcFPN and onstrated the bioremediation potential of this strain for lindane
EcpFPNlinA2 and IPTG-induced EcLB strains. Biodegradation of 10 ppm lindane
clean-up, which needs to be tested further in realistic matrices of
added initially was monitored by gas chromatography and uninoculated media
served as controls. (D) Quantitative analysis of biodegradation of added HCH soil and water in future.
isomers (10 ppm) by parent S. paucimobilis strain B90 in MSGP medium or by
recombinant EcLB strain induced (I) with IPTG or incubated without IPTG (C) for
24 h. Uninduced controls were included for comparison. 4. Conclusion

Inhibition of GroEL expression and/or degradation of this

corresponding protein. Recombinant strain AnFPNlinA2 constitu-
tively expressed the LinA2 protein under normal growth condi-
tions (Fig. 4A). In the combined nitrogen free medium, the
recombinant Anabaena strain AnFPNlinA2 degraded 95% of added
lindane (10 ppm) in 10 days while the empty vector control did not
show biodegradation (Fig. 4B). In nitrate-supplemented media,
molecular chaperone was identified as a major target of lindane
toxicity in Anabaena. Loss of GroEL was accompanied by the loss
of nitrogen fixation and photosynthesis and led to the cessation
of growth of Anabaena exposed to lindane. This study addressed
management of lindane toxicity to biota and its environmental
persistence through (a) development of methods for lindane
 A.K. Chaurasia et al. / Bioresource Technology 149 (2013) 439–445 445

estimation, and (b) bioengineering of Anabaena and E. coli for eliminates HCl molecules from gamma-hexachlorocyclohexane. J. Bacteriol.
173, 6811–6819.
bioremediation of traces of lindane found in agricultural fields
Kumari, R., Subudhi, S., Suar, M., Dhingra, G., Raina, V., Dogra, C., Lal, S., van der
and from high concentration of lindane in storage, respectively. Meer, J.R., Holliger, C., Lal, R., 2002. Cloning and characterization of lin genes
responsible for the degradation of Hexachlorocyclohexane isomers by
Acknowledgements Sphingomonas paucimobilis strain B90. Appl. Environ. Microbiol. 68, 6021–
6028.
The work reported here was funded by Department of Biotech- Kuritz, T., Wolk, C.P., 1995. Use of filamentous cyanobacteria for biodegradation of
organic pollutants. Appl. Environ. Microbiol. 61, 234–238.
nology (DBT) and Department of Atomic Energy (DAE) India. A.K.C. Kuritz, T., Bocanera, L.V., Rivera, N.S., 1997. Dechlorination of lindane by the
acknowledges receipt of a DBT-Postdoctoral Research Fellowship. cyanobacterium Anabaena sp. strain PCC7120 depends on the function of the nir
Authors wish to thank Dr. Arindam Dutta at CRRI Cuttack for his operon. J. Bacteriol. 179, 3368–3370.
Lal, R., Pandey, G., Sharma, P., Kumari, K., Malhotra, S., Pandey, R., Raina, V., Kohler,
help in setting up GC-ECD. H.P., Holliger, C., Jackson, C., Oakeshott, J.G.S., 2010. Biochemistry of microbial
degradation of hexachlorocyclohexane and prospects for bioremediation.
References Microbiol. Mol. Biol. Rev. 74, 58–80.
Mackinney, G., 1941. Absorption of light by chlorophyll solutions. J. Biol. Chem. 140,
315–322.
Adhya, T.K., Apte, S.K., Raghu, K., Sethunathan, N., Murthy, N.B., 1996. Novel
Nagata, Y., Miyauchi, K., Damborsky, J., Manova, K., Ansorgova, A., Takagi, M., 1997.
polypeptides induced by the insecticide lindane (gamma-
Purification and characterization of a haloalkanedehalogenase of a new
hexachlorocyclohexane) are required for its biodegradation by a
substrate class from a gamma-hexachlorocyclohexane-degrading bacterium,
Sphingomonas paucimobilis strain. Biochem. Biophys. Res. Commun. 221, 755–
Sphingomonas paucimobilis UT26. Appl. Environ. Microbiol. 63, 3707–3710.
761.
Nawab, A., Aleem, A., Malik, A., 2003. Determination of organochlorine pesticides in
Apte, S.K., 2001. Coping with salinity/water stress: cyanobacteria show the way.
agricultural soil with special reference to gamma-HCH degradation by
Proc. Indian Natl. Sci. Acad. (PINSA) 67, 285–310.
Pseudomonas strains. Bioresour. Technol. 88, 41–46.
Auty, M.A., Gardiner, G.E., McBrearty, S.J., O’Sullivan, E.O., Mulvihill, D.M., Collins,
Phillips, T.M., Seech, A.G., Lee, H., Trevors, J.T., 2001. Colorimetric assay for Lindane
J.K., Fitzgerald, G.F., Stanton, C., Ross, R.P., 2001. Direct in situ viability
dechlorination by bacteria. J. Microbiol. Methods 47, 181–188.
assessment of bacteria in probiotic dairy products using viability staining in
Phillips, T.M., Seech, A.G., Lee, H., Trevors, J.T., 2005. Biodegradation of
conjunction with confocal scanning laser microscopy. Appl. Environ. Microbiol.
hexachlorocyclohexane (HCH) by microorganisms. Biodegradation 16, 363–
67, 420–425.
392.
Bender, J., Phillips, P., 2004. Microbial mats for multiple applications in aquaculture
Prathap, M.U., Chaurasia, A.K., Sawant, S.N., Apte, S.K., 2012. Polyaniline based
and bioremediation. Bioresour. Technol. 94, 229–238.
highly sensitive microbial biosensor for selective and rapid detection of lindane.
Bhagwat, A.A., Apte, S.K., 1989. Comparative analysis of proteins induced by heat
Anal. Chem. 84, 6672–6678.
shock, salinity, and osmotic stress in the nitrogen-fixing cyanobacterium
Rajaram, H., Apte, S.K., 2008. Nitrogen status and heat-stress-dependent differential
Anabaena sp. strain L-31. J. Bacteriol. 171, 5187–5189.
expression of the cpn60 chaperonin gene influences thermotolerance in the
Bhuyan, S., Sreedharan, B., Adhya, T.K., Sethunathan, N., 1993. Enhanced
cyanobacterium Anabaena. Microbiology 154, 317–325.
biodegradation of c-hexachlorocyclohexane (c-HCH) in HCH (commercial)
Rajaram, H., Kumar Apte, S., 2003. Heat-shock response and its contribution to
acclimatized flooded soil: factors affecting its development and persistence.
thermotolerance of the nitrogen-fixing cyanobacterium Anabaena sp. strain L-
Pestic. Sci. 38, 49–55.
31. Arch. Microbiol. 179, 423–429.
Bueno, M., Fillat, M.F., Strasser, R.J., Maldonado-Rodriguez, R., Marina, N., Smienk,
Seetharam, C., Soundarajan, S., Udas, A.C., Rao, A.S., Apte, S.K., 2009. Lyophilized,
H., Gomez-Moreno, C., Barja, F., 2004. Effects of lindane on the photosynthetic
non-viable, recombinant E. coli cells for cadmium bioprecipitation and recovery.
apparatus of the cyanobacterium Anabaena: fluorescence induction studies and
Proc. Biochem. 44, 246–250.
immunolocalization of ferredoxin-NADP+ reductase. Environ. Sci. Pollut. Res.
Singal, A., Thami, G.P., 2006. Lindane neurotoxicity in childhood. Am. J .Ther. 13,
Int. 11, 98–106.
277–280.
Castenholz, R.W., 1988. Culturing methods for Cyanobacteria. In: Glazer, L.P.a.A.N.
Singh, P.K., 1973. Effect of pesticides on blue–green algae. Arch. Microbiol. 89, 317–
(Ed.), Methods of Enzymology. Academic Press, New York, pp. 68–93.
320.
Chaurasia, A.K., Apte, S.K., 2009. Overexpression of the groESL operon enhances the
Suar, M., Hauser, A., Poiger, T., Poiger, T., Buser, H.R., Muller, M.D., Dogra, C., Raina,
heat and salinity stress tolerance of the nitrogen-fixing cyanobacterium
V., Holliger, C., van der Meer, J.R., Lal, R., Kohler, H.P., 2005. Enantioselective
Anabaena sp. strain PCC7120. Appl. Environ. Microbiol. 75, 6008–6012.
transformation of alpha-hexachlorocyclohexane by the dehydrochlorinases
Chaurasia, A.K., Parasnis, A., Apte, S.K., 2008. An integrative expression vector for
LinA1 and LinA2 from the soil bacterium Sphingomonas paucimobilis B90A.
strain improvement and environmental applications of the nitrogen fixing
Appl. Environ. Microbiol. 71, 8514–8518.
cyanobacterium, Anabaena sp. strain PCC7120. J. Microbiol. Methods 73, 133–
Trudgill, P.W., Widdus, R., 1970. Effects of chlorinated insecticides on metabolic
141.
processes in bacteria. Biochem. J. 118, 48–49.
David, B.V., 1992. Pest Management and Pesticides: Indian Scenario. Namrutha Pub,
Vijgen, J., Abhilash, P.C., Li, Y.F., Li, Y.F., Lal, R., Forter, M., Torres, J., Singh, N.,
Madras.
Yunus, M., Tian, C., Schaffer, A., Weber, R., 2011. Hexachlorocyclohexane
David, K.A., Apte, S.K., Banerji, A., Thomas, J., 1980. Acetylene reduction assay for
(HCH) as new Stockholm convention POPs-a global perspective on the
nitrogenase activity: gas chromatographic determination of ethylene per
management of Lindane and its waste isomers. Environ. Sci. Pollut. Res. Int.
sample in less than 1 min. Appl. Environ. Microbiol. 39, 1078–1080.
18, 152–162.
Fischer, H.M., Schneider, K., Babst, M., Hennecke, H., 1999. GroELchaperonins are
Woodard, G., Hagan, E.C., 1947. Toxicological studies on the isomers and mixtures
required for the formation of a functional nitrogenase in Bradyrhizobium
of isomers of benzene hexachloride. Fed. Proc. 6, 386–388.
japonicum. Arch. Microbiol. 171, 279–289.
Zhang, H., Yang, C., Zhao, Q., Qiao, C., 2009. Development of an autofluorescent
Heritage, A.D., MacRae, I.C., 1977. Degradation of lindane by cell-free preparations
organophosphates-degrading Stenotrophomonas sp. with dehalogenase activity
of Clostridium sphenoides. Appl. Environ. Microbiol. 34, 222–224.
for the biodegradation of hexachlorocyclohexane (HCH). Bioresour. Technol.
Imai, R., Nagata, Y., Fukuda, M., Takagi, M., Yano, K., 1991. Molecular cloning of a
100, 3199–3204.
Pseudomonas paucimobilis gene encoding a 17-kilodalton polypeptide that