Hindawi Publishing Corporation

International Journal of Genomics

Volume 2015, Article ID 563482, 10 pages
http://dx.doi.org/10.1155/2015/563482

Research Article
RECORD: Reference-Assisted Genome Assembly for
Closely Related Genomes

Krisztian Buza, Bartek Wilczynski, and Norbert Dojer

Faculty of Mathematics, Informatics and Mechanics (MIM), University of Warsaw, Banacha 2, 02-097 Warsaw, Poland

Correspondence should be addressed to Krisztian Buza; buza@biointelligence.hu

Received 18 March 2015; Revised 27 May 2015; Accepted 31 May 2015

Academic Editor: Chun-Yuan Lin

Copyright © 2015 Krisztian Buza et al. This is an open access article distributed under the Creative Commons Attribution License,
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Background. Next-generation sequencing technologies are now producing multiple times the genome size in total reads from a single
experiment. This is enough information to reconstruct at least some of the differences between the individual genome studied in
the experiment and the reference genome of the species. However, in most typical protocols, this information is disregarded and
the reference genome is used. Results. We provide a new approach that allows researchers to reconstruct genomes very closely
related to the reference genome (e.g., mutants of the same species) directly from the reads used in the experiment. Our approach
applies de novo assembly software to experimental reads and so-called pseudoreads and uses the resulting contigs to generate a
modified reference sequence. In this way, it can very quickly, and at no additional sequencing cost, generate new, modified reference
sequence that is closer to the actual sequenced genome and has a full coverage. In this paper, we describe our approach and test its
implementation called RECORD. We evaluate RECORD on both simulated and real data. We made our software publicly available
on sourceforge. Conclusion. Our tests show that on closely related sequences RECORD outperforms more general assisted-assembly
software.

1. Background sequencing techniques may be applied to metagenomic sam-

The emergence of population genomic projects leads to an
ever growing need for software and methods that facili-
tate studying closely related organism with next-generation
sequencing technologies. This includes determination of the
genomic sequences of individuals in the presence of the more
generic reference genome of the species. This task is known
as reference-assisted genome assembly and many ongoing
research projects depend on the accurate solution for this
problem.
In recent years, next-generation sequencing technologies
have brought us the possibility to simultanously sequence
millions of short DNA fragments in a DNA library prepared
from almost any biochemical experiment [1]. Great improve-
ment in the quality and amount of short reads obtained
from a single experiment allowed for development of many
more biochemical assays [2] such as MNase-seq [3], DNAse-
seq [4], or Chia-Pet [5] in addition to the more standard
ChIP-Seq [6] or RNA-seq [7]. Similarly, the next-generation
ples returning short reads originating from multiple genomes
including some potentially unknown species.
Importantly, many of these techniques require the prior
knowledge of the reference genome of the species for which
the experiment was performed. This genome sequence is
used to map the reads and obtain the final readout of the
experiment as the read counts per base pair. Such procedures
are guaranteed to work very well only under the assumption
that we know the exact sequence of the genome under study.
There are, however, many biologically relevant cases when
this assumption cannot be satisfied. For example, in quickly
growing cell populations such as cancer cell-lines or micro-
bial colonies, even rare mutations can get fixed in the pop-
ulation very quickly. This leads to situations where sampled
sequences can significantly differ from the original reference
genome. Similarly, many lab experiments involve genetically
modified cells or organisms. While these modifications are
usually controlled as much as possible, the researchers fre-
quently do not know the exact landing site of the introduced
2 International Journal of Genomics
sequence or the number of copies in which it was integrated
into the host genome. This has naturally serious implications
for the accuracy of the results because any difference between
the reference genome and the sampled one will lead to
differences in the expected number of reads mappable to the
reference genome at the differing position. This in turn can
interfere with the measurement of the real abundance of this
DNA region in the sample.
This problem can be, at least theoretically, alleviated by
introducing an additional step into the process: instead of
directly mapping the reads to the reference genome, we can
create a “modified” assembly of the genome based on the
reads from the sample and the reference genome. Then, we
can use this assembly to map the reads and measure their
abundance. This approach can be broken down into two
major steps:
(I) Assembling a genome of the sampled population
based on the obtained reads and the reference
genome.
(II) Assessing the abundance of reads in genomic regions
using such an improved reference sequence.
In the early years of next-generation sequencing, the first
step of such an approach was impractical, as the number of
reads used for an experiment like ChIP-seq was far too low
and their quality was not high enough to attempt assembly
of a better reference genome than the one deposited in
the databases by the relevant genome consortium. However,
now it is commonplace that the total of sequencing reads
generated for a single experiment such as ChIA-PET might be
covering the genome multiple times and, at least in case of the
model organisms such as D. melanogaster or C. elegans, the
read lengths might be large enough to attempt an assembly.
This approach also has another limitation. If the reference
sequence is very different from the one used in the experi-
ment, it contributes more to a problem than to a solution. Any
attempt to use a completely unrelated sequence as a reference
in such an approach is bound to introduce errors. Therefore,
in order to ensure that the output of the assembly is useful,
when we provide a method of generating reference-assisted
assemblies, it is crucial to validate that the reference is actually
close enough to the target genome.
In this paper, we focus on developing an approach for
reference-assisted genome assembly. We assume that the
actual genome of the organism and the reference genome
are close to each other; for example, the reference genome of
the species under consideration is given, but not the genome
of the particular mutant. We point out that currently used
straightforward solutions produce suboptimal or, in some
cases, even misleading results. For example, when simply
assembling the genome from the given reads, due to the low
coverage of those reads, we may obtain too short contigs lead-
ing to an assembly useless in practical applications. Conse-
quently, we need an assembly technique which fulfills the fol-
lowing criteria. First of all, it should output sequences that are
long enough even in cases when the coverage of the genome
sequence by the experimental reads is relatively low. Second,
not only should the output sequences be large enough
individually, but, together, they should cover as much as pos-
sible of the genome in order to allow detection of the abun-
dance of reads in any region of the genome. Third, the result
of the assembly should be accurate; that is, the assembled
genome should be as close as possible to the actual genome of
the studied organism. Last, but not least, we aim to provide a
simple assembly approach. With simplicity, we mean compu-
tational time (in order to keep the entire process computa-
tionally tractable) and the method clarity needed for ease of
reproducibility and reuse of presented ideas in the context of
different specific protocols. We believe the adaptation of the
ideas presented in this paper may be straightforward in some
applications, including RNA-Seq and ChIP-Seq. In other
cases, it would be possible after substantial effort. For exam-
ple, metagenomic sequencing might potentially benefit from
some ideas presented in this paper. However, the currently
presented approach would need to accommodate multiple
genomes and reads originating from different, related species
that may be present in the sample at the same time.
The growing interest in genome assembly is also reflected
by recent publications. For example, Peng and Smith [8]
studied genome assembly from the theoretical point of view
and showed that various combinatorial problems related to
genome assembly are NP-hard. On the other hand, various
methods have been proposed for reference-assisted genome
assembly, such as Amos [9], RACA [10], ARACHNE [11, 12],
IMR/DENOM [13], RAGOUT [14], AlignGraph [15], and the
pipeline developed by Gnerre et al. [16] which was developed
inside the framework provided by ARACHNE. Similarly to
our approach, Gnerre et al. used a de novo assembler as a
component. They mapped reads to several reference genomes
and used the resulting mapping information to improve the
output of the de novo assembly in subsequent steps. In
contrast to Gnerre et al., we only use one reference genome,
and, more importantly, we use the reference genome to
provide enriched input for the de novo assembler. Further-
more, we assume that the reference is closely related to the
target genome, and therefore the reference is directly used to
determine order and orientation of the assembly contigs. In
contrast, RACA focused on reliable order and orientation of
the contigs. Amos, one of the most popular assisted assembly
softwares, aligns reads to the reference genome and uses
alignment and layout information to generate a new con-
sensus sequence [9]. We note that the techniques presented
in this paper are orthogonal to the ones used in the afore-
mentioned works; that is, as future work, RECORD may be
combined with other assisted assembly tools. In this paper, we
focus on experimentally evaluating the power of the relatively
simple techniques of our pipeline. We will show that, despite
their simplicity, they may achieve surprisingly good results.
In the next section we describe our approach, a simple but
surprisingly effective reference-assisted assembly technique,
and the software that implements it. By design, this approach
is most useful in cases when the reference and target genomes
are closely related, and the coverage of the target genome by
the experimental reads is relatively low such as multiplexing
scenarios where multiple experimental DNA libraries are
barcoded and pooled in a single sequencing lane. Subse-
quently we present the results of the experimental evaluation
International Journal of Genomics 3

Experimental reads Pseudoreads (step 1) Reference genome

ACGCATG
CATGCGT GCATGCG
TAGGCAC CGTAGGC
TACGTAG AAATTCG
TTAAATT
ACTCACG TCACGCG ACGCGAT ACTCACGCGATACGAGCTACTACG
AGCTACT GCGATAC GATACGA CGCGAAATATCTTACCTAGGCACG
TACGAGC CGAGCTA AATTAAATTTTGACGACGATATAAC

GCATGCGTAT
TACGATCTTACG
CGGAGAACGTA
Assembly contigs (step 2)

ACGCATGCGTATCGAGCTACTACG
CGCGTACGATCTTACGTAGGCACG
AATTAAATTCGGAGAACGTAATAAC
Edited reference (step 3)

Figure 1: RECORD: Reference-Assisted Genome Assembly for Closely Related Genomes. The inputs of the pipeline, that is, the experimental
reads and the reference genome, are illustrated in the top left and top right of the figure, respectively. Intermediate results produced in various
steps of the analysis process are depicted. The dependency between these intermediate results is shown by arrows. In the illustration of the
3rd step, we underlined those segments of the edited reference which were replaced by one of the assembly contigs.

of RECORD and compare it to Amos [9], one of the most Chr1: ACTCACGCGATACGAGCTACTACGGAGGATC... Reference
genome
popular assisted assembly tools. We show that, under realistic
conditions of approximately 1 percent divergence between ACTCACG AGCTACT
reference genome and the studied sequence, our approach CACGCGA TACTACG Pseudoreads
outperforms naive approaches and Amos (which excels in
GCGATAC TACGGAG
situations where the divergence is much higher). To ensure
reproducibility and extensibility of our work, we evaluate our
n m n m
approach on several collections of publicly available next-
generation sequencing data sets originating from various d
model organisms such as yeast (S. pombe), fruit fly (D.
Figure 2: Generation of pseudoreads from the reference genome.
melanogaster), and plant (A. thaliana).

2. Implementation
We propose RECORD, Reference-Assisted Genome Assem-
bly for Closely Related Genomes. Our approach consists of
the following steps (see Figure 1):
(1) We generate pseudoreads from the reference genome.
We generate pseudoreads in order to ensure that the
coverage of the genome is large enough.
edited reference, the segments of which are replaced
according to the mapping. This step ensures that the
edited reference is close to the true genome of the
organism, while it covers as much regions of the
genome as possible.
Below we give a detailed description of the above steps.

(2) We obtain the contigs of the actual genome of the

organism using a genome assembler, such as Velvet
[17]. As input of the assembler, we propose to use the
pseudoreads generated in the previous step together
with the experimental reads.
(3) We create an edited reference genome. The contigs
obtained in the previous step may not cover the actual
genome of the organism entirely, and, more impor-
tantly, the genome obtained in the previous steps
may be fragmented into a relatively large amount
of contigs. Therefore, the contigs obtained in the
previous step will be mapped to the reference genome
with MUMmer [18]. Using the reference genome and
the mapped contigs, we produce a new genome, called
2.1. Generation of Pseudoreads from the Reference. While
generating pseudoreads from the reference, we make sure that
these pseudoreads have uniform coverage and large enough
overlaps so that they can “assist” the genome assembler, while
it joins reads to contigs. In particular, we generate reads
of length 𝑚 from each chromosome beginning at positions
0, 𝑛, 2⋅𝑛, . . . , 𝑘⋅𝑛, . . ., where 𝑚 and 𝑛 are parameters that can be
set by the user. We generate paired-end reads; the first mate of
the paired-end reads is generated directly from the reference,
while the second mate is generated from its reverse comple-
ment, so that the resulting data has similar character as the
paired-end reads in NGS experiments. The distance between
the ends of the mates of the paired-end reads is 𝑑. This is
illustrated in Figure 2.
4 International Journal of Genomics

Additionally, we associate each position of these pseu- CATGCGCTACGAGC

doreads with a relatively low quality score 𝑞 in order to ACTCACGCGATACGAGCTACTACGGAGGATC... Reference
ensure that real reads have higher priority during the genome GAGCTACCAAGGA
assembly process.
Contigs mapped to the reference
By default, whenever the opposite is not stated explicitly,
we set 𝑚 = 100, 𝑛 = 30, 𝑑 = 1000, and 𝑞 = 10. The quality
score is on the Phred scale from 0 to 93. We store the pseu-
doreads together with the quality scores as FastQ files [19] so
that they can be used as input for the genome assembler ACTCACGCGATACGAGCTACTACGGAGGATC... Edited reference
Velvet.
Figure 3: Resolution of ambiguity. First, for each contig, its best
2.2. Assisted Assembly. The second step of our approach mapping is determined, and then the remaining ambiguity is
leads to generation of assisted assembly contigs. To this resolved in greedy fashion by giving priority to the beginning of the
aim, we combine pseudoreads generated in the previous step contigs as shown in the figure.
and experimental reads in one data set. Next, this data set
is used as an input for a genome assembler. In principle,
any assembler can be applied, but we use Velvet with its
overlapping contigs as illustrated in Figure 3. According to
default parameters. However, the user may set values of the
our observations, selecting the best mapping for each contig
parameters according to his or her needs.
greatly reduces the number of those genomic positions that
are covered by multiple contigs. In particular, in both cases of
2.3. Editing the Reference. While editing the reference based
A. thaliana and D. melanogaster, the selection of the best map-
on the alignment of the contigs produced by MUMmer,
ping of each contig reduced the number of multiply covered
we have to take into account that contigs may be mapped
genomic positions by ≈90%. Furthermore, the overlapping
ambiguously to the reference; that is, the same contig may
segments of two contigs typically contain exactly the same
be mapped to several segments of the reference. Moreover,
or very similar genomic sequences. Therefore, the selection
the regions covered by different contigs may overlap and
of the best mapping for each contig is able to eliminate vast
therefore some segments of the genome may be covered by
majority of the ambiguity. In the light of these observations,
several contigs. We resolve this ambiguity in two steps.
Figure 3 shows an exceptional situation, in which two contigs
First, for each contig, we search for its best mapping to
overlap and the overlapping segments correspond to notably
the reference. Conceptually, we can measure the quality of
different genomic sequences. Despite the fact that such situ-
a mapping by the number of identical bases between the
ations are exceptionally rare, in order to produce the edited
contig and the corresponding segment of the reference. This
reference, such ambiguity must be resolved. One possibility
is estimated as
to resolve such ambiguity is to use the aforementioned quality
𝑄map = 𝐿 × idy(ref) , (1) scores and to prioritize the contig with higher 𝑄map score. In
our prototypical implementation of the pipeline, we used an
where 𝐿 denotes the length of the mapped segment of the even simpler method: we resolved the ambiguity remaining
after the selection of the best mapping in a greedy fashion
contig and idy(ref) is the percentile identity between the contig
by preferring the beginning of the contigs to the ends of the
and the corresponding reference segment as outputted by
contigs as illustrated in Figure 3.
MUMmer. For each contig, out of its several mappings, we
After resolving the ambiguity, the edited reference is
select the one that has the highest 𝑄map score.
produced by replacing the segments of the reference by the
Even though there is no theoretical guarantee that a
mapped contigs (or their segments).
particular contig corresponds to that segment of the genome
to which it was mapped with highest 𝑄map score, we argue
that, on one hand, the higher the identity is, the higher the 2.4. Software. We implemented RECORD using Perl and Java
likelihood that the mapping is correct is (i.e., the contig really programming languages. The main program is implemented
originates from that segment of the genome to which it is in Perl programming language. The main program calls Vel-
mapped); on the other hand, the longer the mapped subse- vet and the modules, for generation of pseudoreads and ref-
quence of the contig is, the higher the likelihood that the map- erence editing.
ping is correct is. Therefore, the higher the above quality score
is, the higher the likelihood of correct mapping is. Thus, we 3. Results and Discussion
select for each contig the segment of the genome that has the
highest 𝑄map score. Our approach does not aim to reproduce the reference
As one can see in Figures 5 and 7, the ratio of ambiguously genome (which is used as input anyway), but we aim to
mapped contigs varies between 5% and 12% in most of our recover the true genome of the organism which is unknown
experiments. An exception is the case of A. thaliana, for in case of real experiments. Consequently, the evaluation of
which the proportion of ambiguously mapped contigs is any assembly software is inherently difficult. Therefore, in the
between 30% and 40%. After selecting the best mapping for following sections, we present evaluation on both simulated
each contig, the remaining ambiguity may only arise from and real data. In case of simulated data, a gold standard is
International Journal of Genomics 5

available, while the experiments on real data will show that Table 1: Evaluation on simulated data.
our approach may be useful in real applications. TL Error Id. Bases
Next, we present the results of the experimental evalua- Assembly N50
(Mb) (in %) (Mb)
tion of our approach.
Contigs
3.1. Baselines. In the experiments presented in the subse- Velvet 18.20 213 b 0.85 18.05
quent sections, we used two genome assemblers, Velvet [17] Amos 28.82 1834 b 2.09 28.22
and Amos [9], as baselines. Velvet is a de novo genome RECORD 25.81 2055 b 0.41 25.70
assembler; that is, it assembles the genome directly from the Edited reference
experimental reads, whereas Amos is one of the most popular Velvet 30.00 10 Mb 1.39 29.58
assisted genome assembly software tools; that is, Amos uses
Amos 30.00 10 Mb 1.03 29.69
both the experimental reads and the reference genome of
a genetically related organism in order to reconstruct the RECORD 30.00 10 Mb 0.59 29.82
genome of the studied organism. Throughout the description
of the experiments, with Velvet we refer to the case of
using Velvet as standalone application, even though our these contigs the length of the shortest one is denoted
approach, referred to as RECORD, uses by default Velvet as as N50.
a component of the proposed pipeline. (3) Error = 100% − IDY, where IDY is the percentile
We also tried to use further assisted genome assemblers, identity between the target genome and the genome
such as ARACHNE [11, 12] and IMR/DENOM [13]. While reconstructed by the assembler. (Please note that IDY
these softwares may excel in various general settings (such
is different from idy(ref) . While idy(ref) denotes the
as using the reference genome of a species to reconstruct the
identity between an assembly contig and the corre-
genome of an other species), as far as we can judge, they
sponding segment of the reference genome, we use
do not seem to fit to our special setting of relatively low
IDY to denote the identity between the output of the
coverage (i.e., few experimental reads) and very closely related
assembly and the target genome.) In order to calculate
genomes. For example, in some cases, the outputted genome
IDY, we map the genome reconstructed by the assem-
was the reference genome, which, on one hand, may be con-
bler to the target genome using the MUMmer soft-
sidered as reasonable if the actual genome and the reference
ware tool [18], and we calculated the weighted average
genome are highly similar (i.e., they are almost the same); on
of the percentile identities between the mapped seg-
the other hand, this is a trivial solution for the assisted
ments and the target genome as outputted by MUM-
assembly problem as the reference is one of the inputs of ref-
erence-assisted assembly methods. mer. In the weighted average, we used the length of the
mapped segments as weights.
3.2. Evaluation on Simulated Data. We simulate the scenario (4) Number of identical bases, which we calculated as
that the reference genome is given and we aim to reconstruct IDY × TL.
the actual genome of the studied organism, which we call
target genome. In particular, we used the Evolver software Both in case of our approach and in case of the baselines,
tool [20] to generate the target genome. We used the genome we evaluated both the contigs and the edited reference
from the example that comes with Evolver. This is an resulting from using the contigs. In case of evaluating edited
artificial mammalian genome of size of 30 megabases (Mb). reference for the baselines, we simply used the contigs out-
The genome has three chromosomes. In order to allow for putted by the baselines in the third step of our approach and
an unbiased evaluation, we produced the evolved genome produced the edited reference.
following the example attached with Evolver. We used the Table 1 summarizes our results. The columns of the table
original genome, that is, ancestral genome, as the reference show the total length (TL) of the assembly, N50, error, and
genome, and we considered the evolved genome as the target the number of identical bases. As one can see, our approach,
genome. We generated one million paired-end short reads of RECORD, is competitive with the other assemblers: consid-
length of 70 with wgsim [21] from the target genome. Subse- ering the contigs produced by our pipeline, they have the
quently, we tried to reconstruct the target genome from the highest N50 and the lowest error rates, while the edited
generated paired-end reads and the reference genome both reference produced by RECORD has the overall highest
with our approach and two other state-of-the-art genome number of identical bases with the target genome.
assemblers. Throughout the experiments on simulated data, In a subsequent experiment, we varied the number of
we used Velvet with 𝑘-Mer size of 𝑘 = 21. Finally, we reads used for the assembly and evaluated the resulting
compared the outputs of the assemblers with the target contigs. These results are shown in Figure 4. The diagram
genome and quantitatively measured the quality of each of the (a) shows the number of bases in the target genome that are
assemblers according to the following criteria: covered by the assembly contigs as function of the number of
reads that were used. It is important to note that while Amos
(1) TL, the total length of the assembly in Mb. can provide overall better coverage of the sequence, it requires
(2) N50; that is, we consider the set of largest contigs that more reads (>500 k) for that. In the lower range of the number
together cover at least 50% of the assembly, and out of of reads available, it is outperformed by RECORD. It may be
6 International Journal of Genomics

35 100 90000
99.5 80000
Number of covered bases

30 70000
99
25

Accuracy (%)
60000
98.5
(millions)

Cov50∗
20 50000
98
15 40000
97.5 30000
10 97 20000
5 96.5 10000
0 96 0

100
200
300
400
500
600
700
800
900
1000
100
200
300
400
500
600
700
800
900
1000

100
200
300
400
500
600
700
800
900
1000
Number of reads (thousands) Number of reads (thousands) Number of reads (thousands)
Velvet Velvet Velvet
Amos Amos Amos
RECORD RECORD RECORD
(a) (b) (c)

Figure 4: Comparison of the proposed approach (RECORD) with two state-of-the-art genome assemblers on data simulated with wgsim. In
this experiment, we consider the evolved genome produced by Evolver as the target genome; the reference genome is the ancestral genome.
The diagrams show the performance of the examined approaches according to various criteria as the function of the number of simulated
reads that were used for the assembly. The diagram (a) shows the number of covered bases of the target genome; the diagram (b) shows the
accuracy, that is, overall percentile identity between the assembly contigs and the corresponding segments of the target genome, while the
diagram (c) shows the number of those largest contigs that together cover at least 50% of the target genome.

0.09 In order to analyze our approach in more detail, we show

in Figure 5 the proportion of ambiguously mapped contigs
(before the selection of the best mapping for each contig). As
0.08 one can see, the proportion of ambiguously mapped contigs
varies between 7% and 8.5%.
Proportion

0.07
We note that, from the point of view of applications, there
is a substantial difference between the execution times of
RECORD and Amos. For example, when using 300 thousand
0.06 reads, producing the edited reference took approximately 1
hour for our approach, whereas it took 16 hours for Amos.
We emphasize that this observation refers to the practical
0.05 application of the software but not to the overall (theoretical)
100 200 300 400 500 600 700 800 900
computational costs: much of the observed difference may be
Number of reads (thousands) attributed to the fact that Velvet, which is used by default as
Figure 5: Proportion of ambiguously mapped contigs (before the assembler in the proposed pipeline, is able to run in parallel
selection of the best mapping for each contig) in case of various on multiple cores, whereas Amos can be used on one core at a
numbers of simulated reads. time. Due to the fact that RECORD uses a de novo assembler
as a component of the proposed pipeline, our approach is
limited to middle-sized genomes that are closely related to
the reference genome; therefore it is currently not applicable
relevant for practical applications as the cost of the exper- to the human and comparable genomes.
iment usually depends on the number of reads produced.
While in this simulated case the number of reads is relatively 3.3. Evaluation on Real Data. The primary goal of the evalua-
low for today NGS technology standards, it might be still rel- tion on real data was to show that our approach can be applied
evant in multiplexing scenarios where multiple experimental in real experiments.
DNA libraries are barcoded and pooled in a single sequencing
lane. 3.3.1. Assessment of the Accuracy in Comparison to the Base-
The second diagram (b) shows the overall percentile line. As mentioned previously, in real-world settings, there is
identity between the target genome and the contigs of the usually no gold standard available. Therefore, the assessment
assembly. The third diagram (c) shows the number of those of the accuracy of the genome produced by any assembler is
largest contigs that together cover at least 50% of the target inherently difficult. For this reason, in the subsequent exper-
genome. As one can see, if only relatively few reads are avail- iment, we evaluate the accuracy of the proposed method on
able, our approach, RECORD, systematically outperforms the real data indirectly. In particular, we assess the quality of the
baselines by producing larger contigs, the most accurate and contigs and, more importantly, we compare our approach to
most complete assembly. the baselines in the following setting: we examine how well
International Journal of Genomics 7

14 100 40000
Number of covered bases

35000
12 99.5
30000

Accuracy (%)
10 99 25000
(millions)

Cov50∗
8
98.5 20000
6 15000
98
4 10000
2 97.5 5000
0 97 0
1 2 3 4 1 2 3 4 1 2 3 4
Number of reads (millions) Number of reads (millions) Number of reads (millions)

Velvet Velvet Velvet

Amos Amos Amos
RECORD RECORD RECORD
(a) (b) (c)

Figure 6: Comparison of the proposed approach (RECORD) with two state-of-the-art genome assemblers on real data. In this experiment,
we compared assemblies resulting from various number of experimental reads to the assembly which is produced by Amos using all the
experimental reads; that is, the target genome is the assembly produced by Amos using all the reads. In this case, the reference genome
exhibits 99.7 percent identity with the result of Amos which is used as the gold standard. The diagrams follow the same structure as the one
in Figure 4.

we can reconstruct the genome using relatively small subsets 0.5

of all the available reads. These subsets are uniform random
samples taken from the set of all the reads: each read has 0.4
the same probability of being included in the sample. Paired-
end reads are sampled together with their mates; that is,
Proportion

either both sequences corresponding to a particular paired-
end read are selected or none of the sequences of that paired-
end is selected.
In the aforementioned context, as gold standard, that is,
target genome, we consider the genome produced by Amos
when using all the reads for the assembly. We note that
this leads to an evaluation in which Amos has an inherent
advantage against our approach, as unfortunately we cannot
have an unbiased reference.
We used real-world experimental reads graciously pro-
vided by dr Andrzej Dziembowski’s group, coming from an
unpublished ChIP-seq experiment in a yeast species. The data
contained approximately 4.5 million paired-end short reads
of length of 100.
Figure 6 shows the results. The diagrams follow the same
structures as the ones presented at the end of Section 3.2; that
is, the diagram (a) shows the number of bases in the target
genome that are covered by the assembly contigs as function
of the number of reads that were used. The second diagram
(b) shows the accuracy, that is, the overall percentile identity
between the target genome and the contigs of the assembly.
The third diagram (c) shows the number of those largest con-
tigs that together cover at least 50% of the target genome. In
all the three diagrams, the horizontal axis shows the size of the
sample (i.e., the number of paired-end reads) used to assem-
ble the genome. As one can see, our approach, RECORD,
systematically outperforms the baselines in terms of accuracy
and coverage of the genome. Note that, in case of using very
few reads, Velvet achieves as good accuracy as our approach;
however, the contigs it produces have very low coverage.
0.3
0.2
0.1
0
A.1 A.2 A.3 D.1 D.2 D.3 P.1 P.2 P.3 P.4 P.5 P.6 P.7
Figure 7: Proportion of ambiguously mapped contigs (before the
selection of the best mapping for each contig) in case of experiments
on publicly available data sets.
3.3.2. Characteristics of the Assembly of Publicly Available Data
Sets. In order to assist reproducibility of our results, we used
publicly available real short read data from the NCBI Short
Read Archive. We used data originating from three different
species: plant (A. thaliana), fly (D. melanogaster), and yeast
(S. pombe). The identifiers of the short read collections are
shown in the third column of Tables 2 and 3.
We set the 𝑘-mer size for the assembly, that is, the second
step of our approach, in accordance with length of the short
reads in the archive and the (approximate) size of the target
genome. In particular, similarly to the previous experiments,
we set 𝑘 = 21 for yeast (short read length = 44), while we used
slightly larger settings for the other two species: we set 𝑘 = 45
in case of flower (short read length = 80) and 𝑘 = 25 for fly
(short read length = 36).
Tables 2 and 3 show the most important characteristics
of the resulting assembly contigs and the edited reference.
8 International Journal of Genomics

Table 2: Assembly of real experimental reads (contigs).

Species Number Experimental reads Length (Mb) # ctgs N50 Cov

A.1 [SRR402840, SRR402839] 113.2 250148 19464 39.6x
A. thaliana A.2 [SRR402842, SRR402841] 112.4 296438 18916 24.4x
A.3 [SRR402844, SRR402843] 113.1 243375 20494 30.5x
D.1 [SRR066834, SRR066831] 122.6 460842 58648 2.6x
D. melanogaster D.2 [SRR066835, SRR066832] 122.6 461044 58535 2.1x
D.3 [SRR066836, SRR066833] 122.6 460200 58415 2.4x
P.1 [SRR948260, SRR948250] 15.2 10384 8934 32.3x
P.2 [SRR948261, SRR948251] 12.2 8129 11132 18.3x
P.3 [SRR948262, SRR948252] 12.1 8571 6696 26.5x
S. pombe P.4 [SRR948266, SRR948272] 12.1 7589 10144 21.5x
P.5 [SRR948267, SRR948273] 12.0 9214 4927 31.6x
P.6 [SRR948268, SRR948274] 12.0 8964 5696 28.1x
P.7 [SRR948269, SRR948275] 12.1 8269 8918 27.4x

Table 3: Assembly of real experimental reads (edited reference). contig) for each experiment shown in this section. As one
can see, the proportion of ambiguously mapped contigs varies
Species Number ed.len. % ref % asm # ctgs % IDY between 4% and 8% in case of S. pombe; it is around 10% in
(Mb)
case of D. melanogaster; and it is remarkably higher, around
A.1 109.9 91.8 97.3 51769 99.967 35%, for A. thaliana.
A. thaliana A.2 106.4 89.0 95.5 58052 99.918 The results in Table 3 show that the total length of the
A.3 109.8 91.8 97.3 54185 99.972 assembly is close to the genome size, indicating the complete-
D.1 117.4 82.1 95.8 50598 99.985 ness of the assembly. However, the relatively large number of
D. melanogaster D.2 117.0 81.8 95.4 50606 99.986 contigs in the raw assembly output can be seen as an indica-
tion that the assembler had difficulties with particular regions
D.3 117.2 82.0 95.6 50630 99.986
of the genome, and therefore a large number of short frag-
P.1 12.0 95.1 78.9 3548 99.995 ments may have been produced. This is especially visible in
P.2 12.0 95.2 98.4 2931 99.994 the case of D. melanogaster, where two factors influencing the
P.3 12.0 95.0 99.2 4249 99.996 quality of assembly are combined: low read coverage and low
S. pombe P.4 12.0 95.3 99.2 3054 99.994 read length.
P.5 94.6 99.2 5287 99.996
According to the proposed procedure of editing the
11.9
reference, a contig may be left out if it can not be mapped to
P.6 12.0 94.9 100.0 4762 99.996
the reference or if MUMmer considers it too short to produce
P.7 12.0 95.3 99.2 3465 99.994 a useful alignment. As we can see, the number of contigs
contributing to the edited reference is substantially less than
the total number of contigs. However, in terms of length,
In particular, the fourth column of Table 2 shows the total almost the entire assembly is used; for example, in each of the
length of the assembly contigs; the fifth column shows the D. melanogaster data sets the edited assembly utilizes ∼11% of
number of all the contigs, while in the sixth column the N50 all contigs, covering over 95% of the assisted assembly. This
of the contigs is shown. The last column shows the coverage shows that reference editing relies on a moderate amount of
of experimental reads calculated as follows: long contigs rather than on a bulk of short ones.
read length × number of reads The edited part of the genome in A. thaliana is slightly
Cov = . (2) smaller than in D. melanogaster, but the number of con-
genome size
tributing contigs is slightly larger. Therefore, contigs obtained
The third column of Table 3 shows the total length of the for the former organism are generally shorter than those
replaced segments, while the fourth and fifth columns show obtained for the latter (this is also in accordance with the
in percent the ratio of the length of the replaced segments rel- observation that N50 of A. thaliana is ∼3× lower than N50
ative to the length of the reference and the total length of the of D. melanogaster). Shorter contigs are more likely to be
assembly contigs, denoted as % ref and % asm, respectively. nonuniquely mapped, as we can observe on Figure 7; the
The sixth column of Table 3 shows the number of contigs proportion of ambiguously mapped contigs is similar to the
that were used while editing the reference. The last column proportion obtained in simulated data for S. pombe and
of Table 3 shows the overall percentile identity between the D. melanogaster, while it is remarkably higher for A. thaliana.
edited reference and the original reference. Percentages of replaced segments in genome editing (%
Figure 7 shows the proportion of ambiguously mapped ref and % asm) are also similar to those observed in simulated
contigs (before the selection of the best mapping for each data for two of our species (A. thaliana and S. pombe), while
International Journal of Genomics
they are slightly lower for D. melanogaster. This behavior
is explained by the difference in the coverage, which is in
D. melanogaster an order of magnitude lower than in the two
other species. The results indicate that the outputted genomes
are closely related to the reference. This is expected, since the
genomes of individuals are close to a reference genome of the
respective species.
Overall, the results on real-world data are similar to those
on simulated data (in some respects, e.g., N50, even better).
Visibly more variability is observed between results on real
data sets with different characteristics: read length, coverage,
and so forth.
4. Conclusions
In this paper, we proposed a new approach for reference-
assisted assembly of closely related genomes. Our approach
takes into account that the actual genome of the studied
organism may be slightly different from the reference genome
of that species leading to potentially fewer errors in down-
stream analyses of the sequenced read abundances.
We have assessed the performance of our method on an
artificially simulated mutated eukaryotic genome, showing
that RECORD produces contigs with very low error rate (less
than 0.5 percent) and after merging them with the original
assembly leading to error rates smaller than in simpler de
novo assembly technique (Velvet) as well as more general
assisted assembly approach (Amos).
Further examination of the results in comparison to
Amos and simple Velvet indicated that our approach is most
useful in the case where we have relatively few reads at our
disposal; both of the competing tools struggled with the data
sets where the number of reads was low.
The same seems to be true in case of a real data set that we
analyzed in Section 3.3.1. Even though the numbers of reads
are much higher, we can still see the difference between our
method and the more traditional approaches. Even though
the genome size is small, we can see that RECORD shows
clearly superior accuracy with up to 3 million reads and all
measures are clearly better at approximately 1 million reads.
Finally, we apply RECORD to more than 10 publicly
available data sets from Short NCBI Read Archive to show
its applicability in practical situations. We can see in all cases
that not only is RECORD able to produce results for much
larger genomes (up to 140 Mb) but the estimated divergence
between the examined genome and the reference is close to
one percent where we can expect RECORD to perform better
than its examined alternatives.
We provide a prototype implementation of this approach
as a set of scripts. It is available for download at our sup-
plementary website together with most of the data published
in the study allowing the readers to replicate our results and
adapt the method for specific applications.
Availability and Requirements
Project name: RECORD Genome Assembler
Project home page: http://sourceforge.net/projects/
record-genome-assembler/
9
Operating system(s): Linux
Programming language: Perl, Java
Other requirements: Velvet, MUMmer
License: Open Source
Any restrictions to use by nonacademics: no.
Conflict of Interests
The authors declare that there is no conflict of interests
regarding the publication of this paper.
Authors’ Contribution
The idea of using assisted assembly in the context presented
in the paper originates from Norbert Dojer. Krisztian Buza
implemented RECORD, performed the experiments, and
wrote the first draft of the paper. Bartek Wilczyński super-
vised the implementation of RECORD and the experiments.
All the three authors contributed to the discussions around
the paper, proofread the paper, and contributed to the final
text of the paper.
Acknowledgments
This work was partially supported by the research (Grant no.
ERA-NET-NEURON/10/2013) from the Polish National Cen-
tre for Research and Development and by the Polish Ministry
of Science and Education (Grant no. [N N519 6562 740]).
Krisztian Buza acknowledges the Warsaw Center of Math-
ematics and Computer Science (WCMCS) for funding his
position. The authors are thankful to Andrzej Dziembowski
and Aleksandra Siwaszek from Institute of Biochemistry and
Biophysics, Polish Academy of Sciences, for providing them
with some of their unpublished ChIP-Seq input data from S.
pombe which they used in their evaluation.
References
[1] M. L. Metzker, “Sequencing technologies the next generation,”
Nature Reviews Genetics, vol. 11, no. 1, pp. 31–46, 2010.
[2] O. Morozova and M. A. Marra, “Applications of next-generation
sequencing technologies in functional genomics,” Genomics,
vol. 92, no. 5, pp. 255–264, 2008.
[3] K. Cui and K. Zhao, “Genome-wide approaches to determining
nucleosome occupancy in metazoans using MNase-Seq,” in
Chromatin Remodeling, vol. 833 of Methods in Molecular Biol-
ogy, pp. 413–419, Springer, 2012.
[4] L. Song and G. E. Crawford, “Dnase-seq: a high-resolution tech-
nique for mapping active gene regulatory elements across the
genome from mammalian cells,” Cold Spring Harbor Protocols,
vol. 2010, no. 2, 2010.
[5] M. J. Fullwood, M. H. Liu, Y. F. Pan et al., “An oestrogen-recep-
tor-𝛼-bound human chromatin interactome,” Nature, vol. 462,
no. 7269, pp. 58–64, 2009.
[6] P. J. Park, “ChIP-seq: advantages and challenges of a maturing
technology,” Nature Reviews Genetics, vol. 10, no. 10, pp. 669–
680, 2009.
10 International Journal of Genomics

[7] Z. Wang, M. Gerstein, and M. Snyder, “RNA-Seq: a revolution-

ary tool for transcriptomics,” Nature Reviews Genetics, vol. 10,
no. 1, pp. 57–63, 2009.
[8] Q. Peng and A. D. Smith, “Multiple sequence assembly from
reads alignable to a common reference genome,” IEEE/ACM
Transactions on Computational Biology and Bioinformatics, vol.
8, no. 5, pp. 1283–1295, 2011.
[9] M. Pop, A. Phillippy, A. L. Delcher, and S. L. Salzberg, “Compar-
ative genome assembly,” Briefings in Bioinformatics, vol. 5, no. 3,
pp. 237–248, 2004.
[10] J. Kim, D. M. Larkin, Q. Cai et al., “Reference-assisted chromo-
some assembly,” Proceedings of the National Academy of Sciences
of the United States of America, vol. 110, no. 5, pp. 1785–1790,
2013.
[11] S. Batzoglou, D. B. Jaffe, K. Stanley et al., “Arachne: a whole-
genome shotgun assembler,” Genome Research, vol. 12, no. 1, pp.
177–189, 2002.
[12] D. B. Jaffe, J. Butler, S. Gnerre et al., “Whole-genome sequence
assembly for mammalian genomes: Arachne 2,” Genome
research, vol. 13, no. 1, pp. 91–96, 2003.
[13] X. Gan, O. Stegle, J. Behr et al., “Multiple reference genomes and
transcriptomes for Arabidopsis thaliana,” Nature, vol. 477, no.
7365, pp. 419–423, 2011.
[14] M. Kolmogorov, B. Raney, B. Paten, and S. Pham, “Ragout—a
reference-assisted assembly tool for bacterial genomes,” Bioin-
formatics, vol. 30, no. 12, pp. i302–i309, 2014.
[15] E. Bao, T. Jiang, and T. Girke, “Aligngraph: algorithm for
secondary de novo genome assembly guided by closely related
references,” Bioinformatics, vol. 30, no. 12, pp. i319–i328, 2014.
[16] S. Gnerre, E. S. Lander, K. Lindblad-Toh, and D. B. Jaffe,
“Assisted assembly: how to improve a de novo genome assembly
by using related species,” Genome Biology, vol. 10, no. 8, article
R88, 2009.
[17] D. R. Zerbino and E. Birney, “Velvet: algorithms for de novo
short read assembly using de Bruijn graphs,” Genome Research,
vol. 18, no. 5, pp. 821–829, 2008.
[18] S. Kurtz, A. Phillippy, A. L. Delcher et al., “Versatile and open
software for comparing large genomes,” Genome Biology, vol. 5,
no. 2, article R12, 2004.
[19] P. J. A. Cock, C. J. Fields, N. Goto, M. L. Heuer, and P. M.
Rice, “The Sanger FASTQ file format for sequences with quality
scores, and the Solexa/Illumina FASTQ variants,” Nucleic Acids
Research, vol. 38, no. 6, pp. 1767–1771, 2010.
[20] R. C. Edgar, G. Asimenos, S. Batzoglou, and A. Sidow, “Evolver:
A whole-genome sequence evolution simulator,” http://www
.drive5.com/evolver.
[21] H. Li, “WgSim: a small tool for simulating sequence reads from
a reference genome,” https://github.com/lh3/wgsim.