Human Molecular Genetics, 2014, Vol. 23, No.

9 2391–2399
doi:10.1093/hmg/ddt630
Advance Access published on December 13, 2013

Cohen syndrome is associated with major

glycosylation defects
Laurence Duplomb1,2,{, ∗ , Sandrine Duvet3,{, Damien Picot1, Gaëtan Jego4,
Salima El Chehadeh-Djebbar1,2, Nathalie Marle1,2, Nadège Gigot1,2, Bernard Aral1,2,
Virginie Carmignac1, Julien Thevenon1,2, Estelle Lopez1, Jean-Baptiste Rivière1,2, André Klein5,
Christophe Philippe6, Nathalie Droin7, Edward Blair8, François Girodon9, Jean Donadieu10,

Downloaded from https://academic.oup.com/hmg/article-abstract/23/9/2391/633098 by guest on 27 January 2019

Christine Bellanné-Chantelot11, Laurent Delva4, Jean-Claude Michalski3, Eric Solary7,
Laurence Faivre1,2, François Foulquier3,{ and Christel Thauvin-Robinet1,2,{
1
Génétique et Anomalies du Développement, EA4271, Université de Bourgogne, Dijon, France, 2FHU TRANSLAD,
Département de Génétique, CHU Dijon, Dijon, France, 3Université des Sciences et Technologies de Lille, UMR/CNRS
8576, IFR147, Villeneuve d’Ascq, France, 4Université de Bourgogne, Inserm UMR 866, Dijon, France, 5Laboratoire de
Biochimie et de Biologie Moléculaire, UAM de glycopathologies, Centre de Biologie et Pathologie, CHRU Lille, Université
de Lille 2, Lille, France, 6Département de Génétique, CHU Nancy, Nancy, France, 7Institut Gustave Roussy, Inserm
UMR1009, Villejuif, France, 8Department of Clinical Genetics, Churchill Hospital, Headington, Oxford, UK, 9Laboratoire
d’Hématologie, Plateau Technique de Biologie, CHU Dijon, Dijon, France, 10French Severe Chronic Neutropenia
Registry, Hôpital Trousseau, Paris, France and 11Département de Génétique, Hôpital de la Pitié-Salpétrière, Université
Paris VI Pierre et Marie Curie, Paris, France

Received July 26, 2013; Revised and Accepted December 9, 2013

Cohen syndrome (CS) is a rare autosomal recessive disorder with multisytemic clinical features due to muta-
tions in the VPS13B gene, which has recently been described encoding a mandatory membrane protein involved
in Golgi integrity. As the Golgi complex is the place where glycosylation of newly synthesized proteins occurs,
we hypothesized that VPS13B deficiency, responsible of Golgi apparatus disturbance, could lead to glycosyla-
tion defects and/or mysfunction of this organelle, and thus be a cause of the main clinical manifestations of CS.
The glycosylation status of CS serum proteins showed a very unusual pattern of glycosylation characterized by a
significant accumulation of agalactosylated fucosylated structures as well as asialylated fucosylated structures
demonstrating a major defect of glycan maturation in CS. However, CS transferrin and a1-AT profiles, two liver-
derived proteins, were normal. We also showed that intercellular cell adhesion molecule 1 and LAMP-2, two
highly glycosylated cellular proteins, presented an altered migration profile on SDS – PAGE in peripheral
blood mononuclear cells from CS patients. RNA interference against VPS13B confirmed these glycosylation
defects. Experiments with Brefeldin A demonstrated that intracellular retrograde cell trafficking was normal in
CS fibroblasts. Furthermore, early endosomes were almost absent in these cells and lysosomes were abnormal-
ly enlarged, suggesting a crucial role of VPS13B in endosomal – lysosomal trafficking. Our work provides evi-
dence that CS is associated to a tissue-specific major defect of glycosylation and endosomal – lysosomal
trafficking defect, suggesting that this could be a new key element to decipher the mechanisms of CS
physiopathology.

∗
To whom correspondence should be addressed at: EA 4271, Génétique des Anomalies du Développement, 7, bd Jeanne d’Arc, BP87900, 21079 Dijon
Cedex, France. Tel: +33-380393238; Fax: +33-380393447; Email: laurence.duplomb@chu-dijon.fr
†
These authors contributed equally to this work.
‡
These authors contributed equally to this work.

# The Author 2013. Published by Oxford University Press. All rights reserved.
For Permissions, please email: journals.permissions@oup.com
2392 Human Molecular Genetics, 2014, Vol. 23, No. 9
INTRODUCTION
Cohen syndrome (CS) (OMIM 216550) is a rare autosomal dis-
order, first described in 1973 (1), and characterized by many clin-
ical features including facial dysmorphism, microcephaly,
truncal obesity, intellectual deficiency, progressive retinopathy
and intermittent congenital neutropenia (2,3). Both of the latter
symptoms have recently been described as the best indicators
for the diagnosis of CS (2). CS is due to mutations in the
VPS13B gene also called COH1. More than 100 distinct
VPS13B mutations, predominantly truncating mutations and
genomic deletions/duplications, have already been described in
CS (2). The VPS13B gene is located on chromosome 8q22–q23
and composed of 62 exons encoding a putative transmembrane
protein of 4022 amino acids (4). VPS13B shows strong homology
to Saccharomyces cerevisiae vacuolar protein sorting-associated
protein 13 (Vps13p), suggesting that VPS13B plays a role in
cellular trafficking (5). Recently, Seifert et al. identified
VPS13B as a peripheral membrane protein localized to the
Golgi complex (6). Thanks to its C-terminus amino acids,
VPS13B colocalizes with a specific marker of the cis-Golgi
apparatus, GM130. Furthermore, VPS13B depletion using
RNAi technology leads to disruption of the Golgi structure
which corresponds to the disrupted Golgi morphology observed
in fibroblasts from CS patients (6).
The main cellular functions of the Golgi apparatus include
protein sorting and packaging and the posttranslational modifi-
cation, such as glycosylation, of newly synthesized proteins
and lipids. The fundamental involvement of glycosylation in
the intricate design of life is dramatically illustrated by a group
of inherited human disorders named congenital disorders of gly-
cosylation (CDG) (7). To date, 50 different types of CDG have
been defined genetically and most of the time, the defects impair
the biosynthesis (CDG-I) and remodeling of N-glycans
(CDG-II). Given the number of biochemical pathways in
which glycans are intricately involved, these diseases have a
wide range of clinical phenotypes in which nearly every organ
could be affected. The initial screening test for CDG is the
study of the highly glycosylated iron-binding transferrin glyco-
protein and its isoforms, although this screening test has shown
its limits (8,9). Recently, the intercellular cell adhesion molecule
1 (ICAM-1) has been described as a new marker for hypoglyco-
sylation in CDG with reduced level in CDG-I patient fibroblasts
(10). A few years ago, the identification of CDG subtypes caused
by altered vesicular Golgi trafficking and Golgi pH homeostasis
has marked a new era in CDG pathogenesis (11,12). It is now
widely accepted that the incorrect oligosaccharide structures
observed on secreted and/or membrane glycoproteins can
result from vesicular trafficking deficiencies, mislocalization
of Golgi enzymes, nucleotide sugar transporters and/or an inad-
equate Golgi environment in terms of pH and ion homeostasis
(13,14). Conserved oligomeric Golgi (COG) subunit deficien-
cies have also been classified in CDG because of defective
protein glycosylation linked to disorders in regulating Golgi
retrograde trafficking.
Given that VPS13B has been reported as a Golgi membrane
protein potentially involved in vesicular trafficking, we explored
the consequences of VPS13B mutations on protein Golgi
N-glycosylation.
RESULTS
Cohort of patients with CS
Ten of the 11 patients fulfilled the CS diagnosis criteria (15) but
patient P100 – F88 had an atypical clinical presentation with
neither obesity nor mental retardation (16). Clinical features
included chorioretinal dystrophy with myopia (11/11 cases),
congenital neutropenia (11/11 cases), slender extremities (11/
11 cases), microcephaly (10/11 cases), intellectual deficiency
(10/11 cases), joint hyperlaxity (10/11 cases) and truncal
obesity (9/11 cases). The 18 different mutations include six
frameshift four nonsense, four splice and one missense muta-
Downloaded from https://academic.oup.com/hmg/article-abstract/23/9/2391/633098 by guest on 27 January 2019
tions, as well as one truncating large duplication and two in
frame deletions.
Structural analysis of N-linked glycans and cell
glycosylation defects
In all CS patients, mass spectrometry of serum N-glycans
showed a significant accumulation of agalactosylated fucosy-
lated structures Hex3HexNAc4dHex1 (m/z 1836) and asialy-
lated fucosylated structures Hex4HexNAc4dHex1 (m/z 2040).
Monosialylated structures (NeuAc1Hex5HexNAc4, m/z 2431)
and monogalactosylated structures (Hex4HexNAc4, m/z 1855)
with the corresponding fucosylated ones (NeuAc1Hex5Hex-
NAc4dHex1, m/z 2606; Hex4HexNAc4dHex1, m/z 2040) have
also been found increased (Fig. 1). Interestingly, all the afore-
mentioned structures are present in all CS patients but in rather
different proportions (see Supplementary Material, Table S1
and Fig. 1 for the relative distribution of the glycoforms). This
result then points to a strong disturbance of the Golgi
N-glycosylation process in CS patients.
We analysed the pattern of molecular weights of serum trans-
ferrin, and interestingly, transferrin glycosylation appeared
normal in all of the patients compared with CDG-I and CDG-II
serum (Fig. 2A). Furthermore, we also studied the a1-antitrypsin
(a1-AT) glycosylation pattern, another liver-derived protein and
showed that the migration profile of this protein was normal in CS
patients (Fig. 2B).
We thus turned to the analysis of ICAM-1, which has been
described as new marker of hypoglycosylation for CDG (10).
Peripheral blood mononuclear cells (PBMCs) of four CS
patients and healthy donors were then tested for the expression
of ICAM-1, as well as the highly glycosylated lysosomal
protein LAMP-2. Both proteins were normally expressed in
PBMCs but with lower molecular weights in CS patients (differ-
ences of 9 kDa for ICAM-1 and 8 kDa for LAMP-2), likely
resulting from Golgi glycosylation defects (Fig. 3A).
In order to determine whether the VPS13B deficiency was
involved in the observed glycosylation defects in CS patients,
we knocked down VPS13B mRNA expression in retinal
pigment epithelium (RPE) cell lines using RNAi delivery and
obtained an 80% decrease in mRNA levels (Fig. 3B). After
48 h, we observed a shift in LAMP-2 migration indicating a
lower molecular weight of this protein due to abnormal glycosyla-
tion (Fig. 3C). Furthermore, we observed a dramatic decrease in
ICAM-1 protein expression (Fig. 3C). This was also visualized
by flow cytometry and confirmed at the mRNA level (data not
shown).
 Human Molecular Genetics, 2014, Vol. 23, No. 9 2393

Downloaded from https://academic.oup.com/hmg/article-abstract/23/9/2391/633098 by guest on 27 January 2019

Figure 1. Abnormal N-glycan structures in CS patients sera. Mass spectrometry results of serum samples of seven known patients and controls show a deficiency in
Golgi N-glycosylation. All patients showed a clear decrease in sialylation and galactosylation of their N-glycan chains (m/z 2431, 2040 and 1836). Symbols identifying
sugar residues are as follows:filled square, N-acetylglucosamine;filled circle, mannose;open square, galactose;filled diamond, sialic acid; open triangle, fucose.
For easiness, linkages between sugar residues have been removed.

Link between VPS13B and the Golgi – lysosomal – endosomal
pathway
As previously reported with the cis-Golgi matrix protein GM130
(6), staining with the Golgi markers TGN46 confirmed slight
alterations in Golgi morphology in all of our investigated CS
fibroblasts, with marked dilation and fragmentation for P68–
F58 and P72 – F62 (white arrows, Fig. 4A and B). Fragmented
and dilated Golgi were quantified, and CS fibroblasts showed
44– 48% of abnormal Golgi. Because the aberrant glycosyla-
tion and the defects in Golgi morphology may result from abnor-
mal retrograde trafficking, its integrity was investigated using
Brefeldin A (BFA). The loss of Golgi mannosidase-II distribu-
tion was rapid and similar in both control and patient cells
(data not shown). This underlies that VPS13B deficiency had
no impact on retrograde trafficking.
2394 Human Molecular Genetics, 2014, Vol. 23, No. 9
Figure 2. Tissue-specific defect of glycosylation. (A) Normal glycosylation
pattern of serum transferrin in CS patients compared with CDG-II and CDG-I
patients as positive control. The number of negative charges is indicated on the
left. (B) Normal glycosylation pattern of serum a1-AT analysed by western blot-
ting in CS patients compared to healthy donors.
The ortholog of VPS13B in S. cerevisiae (Vps13p) is known to
be involved in vacuolar protein sorting. In order to get insights
into this pathway, the lysosomal and endosomal compartments
were investigated by confocal microscopy using the intracellular
markers LAMP-2 (lysosome-associated membrane protein 2)
and EEA1 (early endosome antigen). As shown in Figure 4A
and B, LAMP-2 staining was mainly perinuclear while EEA1
appeared as punctuate staining throughout the cells. Compared
with control cells, EEA1 staining was much less marked and
almost absent in CS fibroblasts. Furthermore, LAMP-2 staining
showed enlarged lysosomes. These results strongly suggest that
VPS13B is involved in the endosomal – lysosomal pathway.
DISCUSSION
Our results showed that VPS13B mutations, responsible for
Cohen syndrome, are associated with strong protein glycosyla-
tion defects highlighting an important role for VPS13B in
Golgi glycosylation and morphology as well as in lysosomal –
endosomal pathway maintenance.
As we confirmed that the Golgi apparatus morphology was
altered in CS fibroblasts (previously described by Seifert et al.
(6)), and as part of the glycosylation process takes place in this
organelle and strong Golgi glycosylation deficiencies have
been linked to Golgi alterations, we hypothesized that CS
could be linked to a glycosylation disorder, i.e. CDG syndrome.
Indeed, some of the CS characteristics belong to the CDG multi-
systemic clinical features spectrum. Considering the two hall-
marks of the syndrome, pigmentary retinopathy has been
described in CDG-Ia and CDG-If and neutropenia in CDG-IIf,
as well as microcephaly in CDG-Ij, -Ik, -Il, -Im, -IIc and -IIh
(7). Furthermore, intellectual deficiency is present in most
CDG syndromes (7). While many clinical characteristics of
CDG-II patients are observed in CS patients, the usual CDG diag-
nosis test based on serum transferrin isoforms analysis appeared
normal in CS patients. Moreover, normal western blotting pattern
of a1-AT suggests that the defect of glycosylation observed in CS
is tissue specific and absent in the liver. This could be similar to
the glycosylation abnormality also observed in the G6PC3 syn-
drome. Indeed, in G6PC3 syndrome, a congenital neutropenia
disorder, glycosylation defects were detected in neutrophils,
even though serum transferrin isoforms remained normal, sug-
gesting that this disorder could be classified as a CDG syndrome
(17). In CS, routine transferrin glycosylation test cannot be used
as a diagnosis tool, but our study indicates that western blotting
experiments of ICAM-1 associated with LAMP-2 could
become an easy and cheap pre-screening test of CS diagnosis,
Downloaded from https://academic.oup.com/hmg/article-abstract/23/9/2391/633098 by guest on 27 January 2019
before VPS13B sequencing which remains an expensive analysis,
in particular in atypical CS, when all phenotypic criteria are not
fully met. A mass spectrometry approach could also be consid-
ered as a pre-screening test for CS diagnosis. Indeed, the appear-
ance of the abnormal glycan structures at m/z 1836 is quite
specific from this defect. Although present in ATP6V0A2 defi-
cient CDG patients’ sera, these structures are rarely seen in
other CDG-II patients (18). However, the rapid advent of next
generation sequencing in the diagnostic work-up of polymalfor-
mative syndrome may considerably decrease the cost of VPS13B
sequencing. Moreover, these results strongly confirm that the use
of transferrin isoforms analysis as a routine test for CDG and gly-
cosylation deficiency can present some limits, i.e. normal results
do not exclude glycosylation defects.
The glycosylation deficiency was mainly identified in serum
proteins by mass spectrometry, but also in primary cells of CS
patients such as PBMCs, which exhibited glycosylation
defects in two highly glycosylated proteins, ICAM-1 and
LAMP-2. ICAM-1 has recently been considered as a new bio-
marker in CDG because of its reduced expression at the cell
surface in CDG-I and -II (10). In CS patients, ICAM-1 was
well expressed at the PBMCs cell surface but showed a lower
molecular weight, suggesting a lower glycosylation status,
while RPE cells displayed reduced ICAM-1 expression after
siRNA delivery against VPS13B. This discrepancy could be
explained by the alteration of glycosylation level or the Golgi
disorganization resulting from various VPS13B mutations, and
thus different impacts on VPS13B protein and its function.
Nevertheless, these results strongly suggested that the glycosy-
lation deficiency observed in CS patients could be linked to dra-
matically decreased VPS13B function.
Despite its location in the Golgi apparatus, the precise role of
VPS13B is unknown and needs to be determined more clearly.
So far, no studies have explored the potential link between
VPS13B and Golgi glycosylation, but VPS13B has been identi-
fied as a potential transmembrane protein that may function in
vesicle-mediated transport and sorting of proteins within the
cell (11). The link between VPS13B defect in CS patients, the al-
teration of Golgi glycosylation and all the clinical spectrum of
CS is however not yet elucidated. Indeed, the disturbance of
the Golgi apparatus is probably the main impact of VPS13B
deficiency; the key question now is to understand while abnor-
mal protein glycosylation or disturbance of the Golgi function
are responsible for neutropenia, truncal obesity, retinopathy, in-
tellectual deficiency, etc. Indeed, two hypotheses could emerge
from this new CS element: (i) the defect of glycosylation could
affect any protein playing a major role in the cellular mechan-
isms of neutrophils, adipogenesis, etc., and thus disturb cell
 Human Molecular Genetics, 2014, Vol. 23, No. 9 2395

Downloaded from https://academic.oup.com/hmg/article-abstract/23/9/2391/633098 by guest on 27 January 2019

Figure 3. Major glycosylation defects were also observed in CS cells. (A) Representative western blot of ICAM-1 and LAMP-2 in PBMCs isolated from controls and
four CS patients, and histograms resulting from molecular weight analysis using ImageLab software (Bio-Rad) showing lower molecular weight of ICAM-1 and
LAMP-2 in CS PBMCs (n ¼ 3). Same results were obtained with three more patients. Vinculin was used as a control of linearity of proteins migration. (B) The ef-
ficiency of siRNA delivery against VPS13B in RPE cells was confirmed by RT– qPCR. VPS13B mRNA expression was decreased by 80% (P ¼ 0.00047) (n ¼ 3).
(C) Effects of a VPS13B siRNA on LAMP-2 and ICAM-1 protein expression in RPE cells (n ¼ 4). Tubulin was used as loading control. Whereas ICAM-1 expression
dramatically decreased in VPS13B siRNA transfected cells, a molecular weight shift was observed for LAMP-2 in cells transfected with VPS13B siRNA compared
with cells transfected with control siRNA. Horizontal bars on the right of the panel showed the migration baseline of both control siRNA and VPS13B siRNA.

function, leading to neutropenia, truncal obesity, etc. and (ii) it
could also be suggested that the observed hypoglycosylation in
CS patients is secondary to the disruption of the Golgi apparatus,
like for TMEM165 defects (19), being just another CS symp-
toms, and resides outside the glycosylation machinery. Further-
more, Golgi apparatus is the place where N- but also O-glycans,
GAG and glycolipids synthesis occur. This is highly possible
that other types of glycosylation can also be altered, inducing
some clinical features.
The disturbance of Golgi trafficking could also been implicated
in the appearance of some symptoms in CS patients. One can expect
that VPS13B like the COG complex machinery would regulate the
vesicle-mediated transport of various Golgi glycosyltransferases
and/or substrates. Interestingly, the impacts of VPS13B deficiency
on lysosomes and early endosome compartments highly suggest
that VPS13B plays a role in the maintenance of these organelles.
The lack of VPS13B clearly gives rise to enlarged lysosomes and
a lack of early endosomal structures. As lysosome size is regulated
by a balance of vesicle fusion and fission, any dysfunction in this
process would increase its size. According to our results, we may
hypothesize that VPS13B regulates endosome fission. The
enlarged lysosomes observed correspond also to a hallmark of
both Chediak-Higashi syndrome (CHS) (20), a rare autosomal re-
cessive disorder characterized by deficiencies in CHS (LYST), and
lysosomal storage diseases. The link between the endo-lysosomal
and biosynthetic pathways becomes obvious as endo-lysosomal de-
ficiencies affect the Golgi glycoprotein biosynthesis. The intricate
design of the catabolic pathway in the biosynthetic process needs to
be further investigated.
Golgi apparatus disruptions have also been reported in diseases
with clinical features shared with CS. In retinitis pigmentosa (RP)
resulting from mutations in the RP2, Alr3 or Kif3a genes, the pro-
gressive photoreceptor cell degeneration was linked to the frag-
mentation of the Golgi network, which leads to the dispersal of
cargo vesicles from the Golgi apparatus to the cilium, thus affect-
ing the location and trafficking of cilia proteins (21).
In summary, our results provide evidence that VPS13B plays a
major role in the function of the Golgi apparatus associated with
major alterations in protein glycosylation in CS patients with
VPS13B mutations. Further studies in a larger cohort of CS
patients would be necessary to determine whether the glycosyla-
tion status, measured by western blotting experiments of
2396 Human Molecular Genetics, 2014, Vol. 23, No. 9

Downloaded from https://academic.oup.com/hmg/article-abstract/23/9/2391/633098 by guest on 27 January 2019

Figure 4. Effect of VPS13B deficiency on the organization of lysosomes and endosomes. Immunofluorescence staining of the Golgi apparatus with the TGN46 marker
(red) and the early endosomes with EEA1 in three CS fibroblasts compared with control fibroblasts (A) or lysosomes with the LAMP-2 (B). The merged images are on
the right. The images were collected with the same laser power and settings and processed with adobe photoshop 7.0. Golgi fragmentation is highlighted by the white
arrows.

ICAM-1 associated to LAMP-2, associated or not to a mass spec-
trometry analysis could be used as a pre-screening test before
VPS13B sequencing analysis.
MATERIALS AND METHODS
Patient cohort
In a cohort of 30 patients with two VPS13B mutations, blood
samples and/or skin biopsies, from which serum, PBMCs and
fibroblasts were isolated, could be ascertained in 11 patients
(five females and six males) from nine sibships (Table 1). The
patients have previously been described (2,3). Written informed
consents were obtained according to the French regulatory re-
quirement. The study has been approved by the ethical commit-
tee of Dijon University Hospital.
Mass spectrometry: release of the N-glycans and PNGase
treatment
Aliquots of 20 ml of sera from healthy individuals or CS patients
were dried in a vacuum centrifuge. The dried samples were

Figure 4. (Continued).
dissolved in 200 ml of 50 mM ammonium bicarbonate containing
0.25% SDS (w/v) and 0.25% b-mercaptoethanol (v/v) and sub-
sequently heated for 20 min at 1008C. After adding 175 ml of
50 mM ammonium bicarbonate and 25 ml Nonidet P40, 1.5 U
of PNGase were added and the deglycosylation was incubated
at 378C for 18 h. Released N-glycans were desalted on a
column of 150 mg of non-porous graphitized carbon (Alltech,
Deerfield, IL, USA). The column was subsequently washed
with 5 ml of methanol and 2 × 5 ml of 0.1% (v/v) TFA. Free
N-glycans were dissolved in 1 ml of 0.1% (v/v) TFA, applied
to the column and washed with 3 × 5 ml of 0.1% (v/v) TFA.
The elution of N-glycans was conducted with the application
of 4 ml of 25% (v/v) ACN in water containing 0.1% (v/v)
TFA. The fractions were freeze-dried.
Permethylation and MALDI TOF-MS analysis
Permethylation of the freeze-dried N-glycans and sample
clean-up were performed as previously described (22).
Human Molecular Genetics, 2014, Vol. 23, No. 9 2397
Downloaded from https://academic.oup.com/hmg/article-abstract/23/9/2391/633098 by guest on 27 January 2019
Samples were cocrystallized with 2,5-dihydroxybenzoic acid
as matrix (10 mg/ml) in methanol/water solution (50/50) and
freeze-dried. MALDI-MS experiments were carried out on
Voyager Elite DE-STR Pro instrument (PerSeptive Biosystem,
Framingham, MA, USA) equipped with a pulsed nitrogen laser
(337 nm) and a gridless delayed extraction ion source. The spec-
trometer was operated in positive reflectron mode by delayed ex-
traction with an accelerating voltage of 20 kV and a pulse delay
time of 250 ns and a grid voltage of 72%. All the spectra repre-
sent accumulated spectra obtained by 500 laser shots.
Cell culture
Fibroblasts were cultured in DMEM supplemented with 10%
fetal calf serum (FCS) (both from Thermofisher Scientific, Ill-
kritch, France) and 1% penicillin/streptomycin (P/S) (Sigma,
Saint-Quentin-Fallavier, France). RPE cells (kind gift from
Sophie Thomas, Inserm UMR781, Paris, France) were cultured
in DMEM:Ham’s F12 (1:1) medium supplemented with 10%
2398 Human Molecular Genetics, 2014, Vol. 23, No. 9

FSC and 1% P/S. Cells were grown at 378C in a 5% CO2 atmos-

CNV, copy number variations; CRD, chorioretinal dystrophy; CS, Cohen syndrome; EX, exon; ID, intellectual deficiency; IN, intron; JH, joint hyperlaxity; M, myopia; MC, microcephaly; NTP, neutropenia;
CRD, NTP∗ , ID, MC, TO, SE, JH, M
CRD, NTP∗ , ID, MC, TO, SE, JH, M
CRD, NTP, ID, MC, TO, SE, JH, M
CRD, NTP, ID, MC, TO, SE, JH, M

CRD, NTP, ID, MC, TO, SE, JH, M

CRD, NTP, ID, MC, TO, SE, JH, M

CRD, NTP, ID, MC, TO, SE, JH, M

CRD, NTP, ID, MC, TO, SE, JH, M∗

phere. Human PBMCs were isolated through Ficoll gradient

CRD, NTP, ID, TO, SE, JH, M

(Sigma) and washed in PBS.

CRD, NTP, ID, MC, SE, JH

CRD, NTP, MC, SE, M
Immunofluorescence
Clinical features

For human cells immunofluorescence experiments, cells were

grown on glass coverslips for 12–24 h, washed once with PBS
and fixed by incubation for 25 min at RT in 4% formaldehyde
in 0.1 M sodium phosphate buffer, pH 7.2. The coverslips were
then rinsed twice with 0.1 M glycine in PBS for 15 min at RT,

Downloaded from https://academic.oup.com/hmg/article-abstract/23/9/2391/633098 by guest on 27 January 2019

then incubated for 1 h at RT with primary antibodies diluted in
dysmorphism

blocking solution [0.1% Triton X-100 (Sigma), 1% BSA

Compatible

(Roche, Meylan, France) and 5% normal goat serum (Invitrogen,

Typical
Typical

Typical

Typical
Typical

Typical

Typical

Typical
Typical
Typical
Facial

Courtaboeuf, France)]. After washing with PBS, Alexa Fluor 488-

or Alexa Fluor 568-conjugated anti-rabbit IgG antibodies (Invi-
trogen) diluted in blocking solution were applied for 1 h at RT.
p.A3380fsX3396Truncating large duplication

p.A3380fsX3396Truncating large duplication

Immunostaining was detected using an inverted Leica TCS-SP5

p.R1143Xp.T3627I + p.A3628_H3633del

confocal microscope. Data were collected and processed in

Adobe Photoshop 7.0 (Adobe Systems, San Jose, CA, USA).
In frame large deletionp.F2548X
p.Q407fsX418p.V2429fsX2430
Splice mutationSplice mutation

Splice mutationSplice mutation

p.V578fsX1p.S3899fsX41

p.R692Xp.Q1810fsX1830
p.R692Xp.Q1810fsX1830

Golgi to ER trafficking assay

Fibroblasts were grown overnight on glass cover slips to 70%
p.R2839Xp.R2839X

confluence. For the experiment, the medium was changed for

Protein mutation

pre-warmed medium containing 5 mg/ml of BFA (St. Louis,

MO, USA). The assay was stopped at different time points by
fixing the cells with 4% paraformaldehyde. After fixation and
permeabilization, the coverslips were stained for GM130 and
Golgi-mannosidase-II, as described above.
INT 43–44EX 42
EX 56EX 9– 12

EX 56EX 9– 12
INT 30INT 51

INT 34INT 57
EX 13EX 61
EX 23EX 56

EX 46EX 46
EX 15EX 34
EX 15EX 34
Intron/exon

EX 9EX 40

RNA interference
Small interference RNAs (siRNA) against VPS13B and negative
control siRNA (both siGENOME SMARTpool, sequences avail-
able on request) were purchased from ABgene Ltd (Thermo scien-
tific). Transfection of siRNA was obtained using LipofectamineTM
c.3427C . Tc.10880insTTdelCTGCGAGG

100828887)x1c.7643_7644delTCinsAA
Table 1. Clinical and molecular data of the 11 patients with Cohen syndrome

IVS34 + 2T_+3AinsTIVS57 + 2T . C

RNAiMAX reagent (Invitrogen) according to the manufacturer’s

c.10139_10143dupCGCCAarr 8q22.2

c.10139_10143dupCGCCAarr 8q22.2

protocol. Briefly, 0.1 × 106 RPE were seeded in 2 ml of DMEM

c.1733delTc.11695_11698delAGTG

c.2074C . Tc.5426_5427dupAG
c.2074C . Tc.5426_5427dupAG

containing 1% P/S and 10% FCS. After 24 h, siRNA (100

IVS30 + 2T . CIVS51-1G . T
Nucleotide change and/or CNVs

(100133678 –100155175)x3

(100133678 –100155175)x3

pmol)/lipofectamineTM RNAiMAX (5 ml) complexes (in 500 ml

Opti-MEMw Medium) were added to the cells. After 48 h, the
c.8515C . Tc.8515C . T

cells were prepared for subsequent analysis.

CAGCTTGTGCAC
c.1220delAc.7286delT

arr 8q23 (100817911 –

SE, slender extremities; TO, truncal obesity; ∗ transitory.

RNA extraction and real-time RT –qPCR

Total RNA was extracted using TRI reagentw (Sigma), accord-
ing to the manufacturer’s protocol. The first-strand cDNA was
synthesized from 0.5 mg total RNA using Maxima First Strand
cDNA Synthesis Kit for RT – qPCR from Fermentas (Thermo
Age (years)

Scientific). The real-time qPCR contained, in a final volume of

20 ml, 2 ng of reverse transcribed total RNA, 300 nM of the
15
44

47

14
11

21
37
10

27
23
19

forward and reverse primers, and SYBR green buffer (Fermen-

tas, Thermofisher). PCRs were performed in triplicate in
Sex

M
M

M
M
M

96-well plates, using the LightCycler 480 (Roche). Human gly-

F
F

F
F

ceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as

P100 –F88
P51–F43

P40–F33
P15–F11

P68–F58

P72–F62

an invariant control. Sequences of primers used for real-time

P10–F8
P11–F8
P2– F2

P3– F2

P7– F6
Patient

PCR were VPS13B-forward: TGGAACCATCAAACAAGG

CTGCA, VPS13B-reverse: TCCTGAGCACCACTGTAGCGA.

GAPDH-forward: TGCACCACCAACTGCTTAGC, GAPDH-
reverse: GGCATGGACTGTGGTCATGAG.
Western blot analysis
Cells were lysed for 20 min in RIPA buffer containing 50 mM
Tris, 150 mM NaCl, 1 mM NaF, 0.1% NP40, 0.25% DOC,
1 mM Na3VO4, 1 mM PMSF and protein inhibitor cocktail
(Sigma). Cell lysates were centrifuged at 13 000g at 48C for
20 min and protein concentrations were determined with the
BCA protein assay (Sigma). Twenty micrograms of proteins
from cell lysates or from sera were run on 8% SDS – PAGE
and transferred to Immobilon-P membrane (Millipore,
Bedford, MA, USA). The membrane was blotted with antibodies
to a1-AT (clone 1C2, Sigma), ICAM-1 (Ozyme, St Quentin,
France), LAMP-2, tubulin (both from Santa Cruz Biotechnol-
ogy, Inc) and vinculin (Sigma) in PBS, 0.05% Tween 20, 5%
non-fat dried milk, washed and probed with the appropriate sec-
ondary antibody coupled to horseradish peroxidase. The labeled
proteins were detected using ECL reagent (Pierce, Thermo sci-
entific) according to the manufacturer’s recommendations.
Bands on western blots were visualized using ChemiDocTM
Imaging System (Bio-Rad). Molecular weights were determined
using Image Lab software (Bio-Rad).
Analysis of serum transferrin
Isoelectric focusing was done as previously described (23).
SUPPLEMENTARY MATERIAL
Supplementary Material is available at HMG online.
ACKNOWLEDGEMENTS
We thank all of the patients and their family members for taking
part in this study.
Conflict of Interest statement. None declared.
FUNDING
This work was supported by the French Ministry of Health
(PHRC 2012, A00103-42) and the Regional Council of
Burgundy (STIC11) and the Agence Nationale Recherche
Jeune Chercheur grant and Grant ERARE11-135 from the
Equipe de Recherche Associée-Net for Research Programmes
(EURO-CDG) to F.F.
REFERENCES
1. Cohen, M.M. Jr, Hall, B.D., Smith, D.W., Graham, C.B. and Lampert, K.J.
(1973) A new syndrome with hypotonia, obesity, mental deficiency, and
facial, oral, ocular, and limb anomalies. J. Pediatr., 83, 280– 284.
2. El Chehadeh, S., Aral, B., Gigot, N., Thauvin-Robinet, C., Donzel, A.,
Delrue, M.A., Lacombe, D., David, A., Burglen, L., Philip, N. et al. (2010)
Search for the best indicators for the presence of a VPS13B gene mutation
and confirmation of diagnostic criteria in a series of 34 patients genotyped for
suspected Cohen syndrome. J. Med. Genet., 47, 549– 553.
3. El Chehadeh-Djebbar, S., Blair, E., Holder-Espinasse, M., Moncla, A.,
Frances, A.M., Rio, M., Debray, F.G., Rump, P., Masurel-Paulet, A., Gigot,
Human Molecular Genetics, 2014, Vol. 23, No. 9 2399
N. et al. (2012) Changing facial phenotype in Cohen syndrome: towards
clues for an earlier diagnosis. Eur. J. Hum. Genet. 21, 736 –742.
4. Kolehmainen, J., Black, G.C., Saarinen, A., Chandler, K., Clayton-Smith, J.,
Traskelin, A.L., Perveen, R., Kivitie-Kallio, S., Norio, R., Warburg, M. et al.
(2003) Cohen syndrome is caused by mutations in a novel gene, COH1,
encoding a transmembrane protein with a presumed role in vesicle-mediated
sorting and intracellular protein transport. Am. J. Hum. Genet., 72,
1359–1369.
5. Velayos-Baeza, A., Vettori, A., Copley, R.R., Dobson-Stone, C. and
Monaco, A.P. (2004) Analysis of the human VPS13 gene family. Genomics,
84, 536–549.
6. Seifert, W., Kuhnisch, J., Maritzen, T., Horn, D., Haucke, V. and Hennies,
H.C. (2011) Cohen syndrome-associated protein, COH1, is a novel, giant
Golgi matrix protein required for Golgi integrity. J. Biol. Chem., 286,
Downloaded from https://academic.oup.com/hmg/article-abstract/23/9/2391/633098 by guest on 27 January 2019
37665– 37675.
7. Woods, A.G., Woods, C.W. and Snow, T.M. (2012) Congenital disorders of
glycosylation. Adv. Neonatal. Care, 12, 90–95.
8. Stibler, H. and Jaeken, J. (1990) Carbohydrate deficient serum transferrin in a
new systemic hereditary syndrome. Arch. Dis. Child., 65, 107–111.
9. Jaeken, J. (2011) Congenital disorders of glycosylation (CDG): it’s (nearly)
all in it! J.Inherit. Metab. Dis., 34, 853 –858.
10. He, P., Ng, B.G., Losfeld, M.E., Zhu, W. and Freeze, H.H. (2012)
Identification of intercellular cell adhesion molecule 1 (ICAM-1) as a
hypoglycosylation marker in congenital disorders of glycosylation cells.
J. Biol. Chem., 287, 18210–18217.
11. Reynders, E., Foulquier, F., Annaert, W. and Matthijs, G. (2011) How Golgi
glycosylation meets and needs trafficking: the case of the COG complex.
Glycobiology, 21, 853–863.
12. Rosnoblet, C., Legrand, D., Demaegd, D., Hacine-Gherbi, H., de Bettignies,
G., Bammens, R., Borrego, C., Duvet, S., Morsomme, P., Matthijs, G. et al.
(2013) Impact of disease-causing mutations on TMEM165 subcellular
localization, a recently identified protein involved in CDG-II. Hum. Mol.
Genet., 22, 2914–2928.
13. Foulquier, F. (2009) COG defects, birth and rise! Biochim. Biophys. Acta,
1792, 896– 902.
14. Rosnoblet, C., Peanne, R., Legrand, D. and Foulquier, F. (2012)
Glycosylation disorders of membrane trafficking. Glycoconj. J., 30, 23–31.
15. Chandler, K.E., Kidd, A., Al-Gazali, L., Kolehmainen, J., Lehesjoki, A.E.,
Black, G.C. and Clayton-Smith, J. (2003) Diagnostic criteria, clinical
characteristics, and natural history of Cohen syndrome. J. Med. Genet., 40,
233– 241.
16. Gueneau, L., Duplomb, L., Sarda, P., Hamel, C., Aral, B., El Chehadeh, S.,
Gigot, N., St-Onge, J., Callier, P., Thevenon, J. et al. (2013) Congenital
neutropenia with retinopathy, a new phenotype without intellectual
deficiency or obesity seconadry to VPS13B mutations. Am. J. Med. Genet.
A., [Epub ahead of print].
17. Hayee, B., Antonopoulos, A., Murphy, E.J., Rahman, F.Z., Sewell, G.,
Smith, B.N., McCartney, S., Furman, M., Hall, G., Bloom, S.L. et al. (2011)
G6PC3 mutations are associated with a major defect of glycosylation: a
novel mechanism for neutrophil dysfunction. Glycobiology, 21, 914–924.
18. Guillard, M., Morava, E., van Delft, F.L., Hague, R., Korner, C.,
Adamowicz, M., Wevers, R.A. and Lefeber, D.J. (2011) Plasma N-glycan
profiling by mass spectrometry for congenital disorders of glycosylation
type II. Clin. Chem., 57, 593–602.
19. Foulquier, F., Amyere, M., Jaeken, J., Zeevaert, R., Schollen, E., Race, V.,
Bammens, R., Morelle, W., Rosnoblet, C., Legrand, D. et al. (2012)
TMEM165 deficiency causes a congenital disorder of glycosylation.
Am. J. Hum. Genet., 91, 15– 26.
20. Spicer, S.S., Sato, A., Vincent, R., Eguchi, M. and Poon, K.C. (1981)
Lysosome enlargement in the Chediak-Higashi syndrome. Fed. Proc., 40,
1451–1455.
21. Evans, R.J., Schwarz, N., Nagel-Wolfrum, K., Wolfrum, U., Hardcastle, A.J.
and Cheetham, M.E. (2010) The retinitis pigmentosa protein RP2 links
pericentriolar vesicle transport between the Golgi and the primary cilium.
Hum. Mol. Genet., 19, 1358–1367.
22. Faid, V., Chirat, F., Seta, N., Foulquier, F. and Morelle, W. (2007) A rapid
mass spectrometric strategy for the characterization of N- and O-glycan chains
in the diagnosis of defects in glycan biosynthesis. Proteomics, 7, 1800–1813.
23. de Jong, G. and van Eijk, H.G. (1988) Microheterogeneity of human serum
transferrin: a biological phenomenon studied by isoelectric focusing in
immobilized pH gradients. Electrophoresis, 9, 589–598.