The FASEB Journal • Research Communication
Epigenetics: intrauterine growth retardation (IUGR)
modifies the histone code along the rat hepatic
IGF-1 gene
Qi Fu, Xing Yu, Christopher W. Callaway, Robert H. Lane,1,2 and Robert A. McKnight1
University of Utah School of Medicine, Department of Pediatrics, Division of Neonatology, Salt Lake
City, Utah, USA
ABSTRACT Intrauterine growth restriction (IUGR)
decreases serum insulin growth factor-1 (IGF-1) levels.
IGF-1 is an epigenetically regulated gene that has two
promoters, alternative exon 5 splicing, and multiple
termination sites. The regulation of gene expression
involves the whole gene, as evidenced by the aforemen-
tioned IGF-1 paradigm. We hypothesized that IUGR in
the rat would affect hepatic IGF-1 expression and alter
the epigenetic characteristics of the IGF-1 gene along
its length. IUGR was induced through a bilateral uter-
ine artery ligation of the pregnant rat, a well-character-
ized model of IUGR. Pups from anesthesia and sham-
operated dams were used as controls. Real-time RT-
PCR and ELISA was used to measure expression at day
of life (DOL) 0 and 21. Bisulfite sequencing and
chromatin immunoprecipitation (ChIP) quantified
IGF-1 epigenetic characteristics. A nontranscribed
intergenic control was used for ChIP studies. IUGR
decreased hepatic and serum IGF-1. Concurrently,
IUGR modified epigenetic characteristics, particularly
the histone code, along the length of the hepatic IGF-1
gene. Many changes persisted postnatally, and the
postnatal effect of IUGR on the histone code was
gender-specific. We conclude that IUGR modifies epi-
genetic characteristics of the rat hepatic IGF-1 gene
along the length of the whole gene.—Fu, Q., Yu, X.,
Callaway, C. W., Lane, R. H., McKnight, R. A. Epige-
netics: intrauterine growth retardation (IUGR) modi-
fies the histone code along the rat hepatic IGF-1 gene.
FASEB J. 23, 2438 –2449 (2009)
Key Words: chromatin 䡠 DNA methylation 䡠 Barker hypothesis
䡠 chromatin immunoprecipitation 䡠 insulin resistance
The early nutritional milieu of the fetus influences
the adult phenotype. A relevant marker for this phe-
nomenon is intrauterine growth restriction (IUGR)
(1). IUGR is a significant cause of human morbidity
and mortality that is associated with many of the most
common complications of pregnancy, such as pre-
eclampsia and other hypertensive disorders of preg-
nancy (2– 4). Multiple studies demonstrate that IUGR
predisposes human infants toward several postnatal
morbidities, including poor postnatal growth and insu-
2438
lin resistance (5–12). Though moderately controver-
sial, the positive relationship between growth retarda-
tion and adult morbidities, including insulin resistance,
appears to be stronger in men than in women (5, 6,
12). Growth and insulin sensitivity are modulated by
hepatic IGF-1.
In humans and rodents, absence of IGF-1 leads to
poor prenatal growth (13). Moreover, multiple investi-
gators find that human IUGR infants have lower fetal or
cord IGF-1 concentrations when compared with appro-
priately sized infants (13–15). Postnatally, IUGR de-
creases serum IGF-1 levels in human infants during the
first 9 mo of life (16). Furthermore, IUGR also de-
creases serum IGF-1 levels in preadolescent children
who do not exhibit significant “catch-up” growth (17).
Finally, adults that lack IGF-1 suffer from decreased
insulin sensitivity (18).
Fetal and newborn rats with induced IUGR also
suffer from decreased serum levels of IGF-1, and the
organization of the rat IGF-1 gene is remarkably similar
to the human IGF-1 gene (19, 20). Both human and rat
IGF-1 genes are large and contain 6 exons separated by
5 introns (21, 22). Extensive nucleotide and amino acid
conservation exist between the IGF-1 genes of both spe-
cies, as well as comparable expression of multiple mRNA
variants (22). These mRNA variants are useful markers of
altered transcriptional regulation and may function to
modulate translational efficiency and cell growth.
In the rat (Fig. 1A), exon 1 and exon 2 encode two
different leader sequences and involve multiple tran-
scription start sites with multiple inframe ATGs. Either
exon 1 or exon 2 is spliced to the exon 3, which
encodes the N terminus of the mature peptide (23–25).
Exon 1-derived [promoter 1 (P1)] transcripts predom-
inate in every tissue expressing the IGF-1 gene, with the
exception of the liver, in which relatively high levels of
Exon 2-derived [promoter 2 (P2)] transcripts are pro-
duced (26, 27).
Another variable that occurs with hepatic IGF-1
1
These authors contributed equally to this work.
2
Correspondence: Division of Neonatology, P.O. Box 581289,
Salt Lake City, UT 84158, USA. E-mail: robert.lane@hsc.utah.
edu
doi: 10.1096/fj.08-124768
0892-6638/09/0023-2438 © FASEB
Figure 1. A) Rat IGF-1 gene structure and alternative splicing. Exons and introns are shown as boxes and horizontal lines,
respectively. Transcription start sites are indicated by arrows. The 5 sets of ChIP primers/probes for P1, P2, exon 5, proximal,
and distal 3⬘ UTR are shown as black bars. B) Rat serum IGF-1 levels at DOL0 and DOL21. C, D) DOL0 (C) and DOL21 rat
hepatic IGF-1 mRNA variant levels (D). Graphs represent IGF-1 mRNA expressed as mean ⫾ se percentage of control for male
and female rats. P1, transcripts starting from exon 1; P2, transcripts starting from exon 2; IGF-1A, transcripts without exon 5;
IGF-1B, transcripts with exon 5. White bars indicate control values; gray bars indicate IUGR. *P ⬍ 0.05; **P ⬍ 0.01; ***P ⬍ 0.001;
****P ⬍ 0.0001.

mRNA transcripts involves the inclusion or exclusion of
exon 5, which changes the translational reading frame
of the peptide coding region of exon 6. The IGF-1A
transcript lacks exon 5, while IGF-1B contains exon 5
(23, 28, 29). Unfortunately, little evidence ties specific
promoter usage to a specific IGF-1A or IGF-1B tran-
script, respectively. Finally, multiple polyadenylation
sites in the 3⬘ untranslated region (UTR) of the IGF-1
gene generates different lengths of mRNAs, ranging
from 0.8 to 7.5 kb. The high-molecular-weight species
represents ⬍50% of total IGF-1 mRNA in liver, in
contrast to most other tissues.
The above IGF-1 variants are likely examples of
epigenetic regulation, which denotes an inherited state
of gene regulation that is independent of the genetic
information encoded within the DNA itself (30 –32).
Epigenetic regulation involves covalent modification of
DNA and histones (33–35). DNA methylation within a
promoter and 5⬘ transcribed region usually represses
gene transcription, whereas DNA methylation toward
the 3⬘ end often signifies gene activation (36). A
dynamic relationship exists between DNA methylation
and the associated histone code (histone covalent
modifications that determine how DNA and histones
interact). These histone covalent modifications affect
transcriptional regulation and include histone acetyla-
tion and methylation. For example, histone H3 acety-
lation (ac) at lysine (K) 9 and 14 and trimethylation
(me3) at K4 are often associated with gene activation,
while me3K36 is associated with actively transcribed
regions.
The location of a modification is tightly regulated
and is crucial for its effect on transcriptional regula-
tion, and these marks affect transcription within the
context of the neighboring histone codes (37– 40).
Furthermore, histone modifications at one site have
been known to influence modifications at additional
sites (41).
Because IUGR affects IGF-1 serum levels in humans
and rats, we hypothesized that IUGR in rats would
decrease serum levels of postnatal IGF-1, alter hepatic
IGF-1 mRNA species levels, affect postnatal DNA meth-
ylation in the hepatic IGF-1 5⬘ flanking region, and
modify multiple markers of the postnatal histone code.
To understand the effect of IUGR on the hepatic IGF-1
epigenetic characteristics, we would also need to deter-
mine the histone code along the entire gene.
To test this hypothesis, we used a model of uteropla-
cental insufficiency and subsequent IUGR that has
been well characterized by multiple groups (42– 44). In
this model, bilateral uterine artery ligation is per-
formed on d 19 of gestation in the pregnant Sprague-
Dawley rat. IUGR pups in this model are ⬃25% smaller
than control pups, and IUGR pups are predisposed to
develop both growth failure and insulin resistance early
in life, as well as overt diabetes relatively late in life (44,
45). Interestingly, gender-specific responses to IUGR
become evident for multiple processes by day of life 21

IUGR AFFECTS HEPATIC IGF-1 HISTONE CODE 2439

(DOL21) in this model. We therefore tested our hy-
pothesis at DOL0 and DOL21 in both genders to
determine the consequences of IUGR on IGF-1 chro-
matin structure during the perinatal and postnatal
period. We chose DOL21 purposefully to avoid the
confounding effects of adolescence and senescent mat-
uration.
MATERIALS AND METHODS
Animals
All procedures were approved by the University of Utah
Animal Care committee and are in accordance with the APS
Guiding Principles (46). Bilateral uterine artery ligation was
performed on d 19 of gestation in pregnant Sprague-Dawley
rats. Surgical procedures have been described previously (42,
43, 47– 49). The DOL0 pups were delivered by cesarean
section at term. DOL21 animals were separated from their
dams for 4 h, anesthetized, and sacrificed at the two ages;
livers were quickly removed, flash-frozen in liquid nitrogen,
and stored at ⫺80°C.
Enzyme immunoassay (EIA)
Serum IGF-1 levels at DOL0 and DOL21 were measured by
using mouse/rat enzyme immunoassay (EIA) kit (DSL, Web-
ster, TX, USA) following the manufacturer’s protocol.
RNA isolation
Total RNA isolation was performed as described earlier (42,
43). Total RNA was extracted from DOL0 and DOL21 liver
using the Nucleospin RNAII kit (Macherey-Nagel, Bethle-
hem, PA, USA), including DNase I treatment. RNA was then
quantified spectrophotometrically and checked by gel elec-
trophoresis for integrity.
Real-time reverse transcription polymerase chain reaction
(RT-PCR)
Real-time RT-PCR was performed as described earlier (42,
43). Target primers and probes were designed using Primer
Express software (Applied Biosystems, Foster City, CA, USA)
(Table 1). Briefly, to test the transcripts starting from P1,
primers spanned the junction of exon 1 and exon 3. For
transcripts initiated from P2, primers spanned the junction of
exon 2 and exon 3. For IGF-1A transcripts, the primers
spanned the junction of exon 4 and exon 6, while for IGF-1B,
the primers spanned the junction of exon 5 and exon 6.
Real-time RT-PCR quantification was then performed using
glyceraldehyde-3 phosphate dehydrogenase (GAPDH) as an
internal control. Relative quantification of PCR products was
based on value differences between the target and GAPDH
control using the comparative Ct method (TaqMan Gold
RT-PCR manual; PE Biosystems, Foster City, CA, USA).
Bisulfite modification
Bisulfite modification was performed as described earlier
(42). IGF-1 P1 and P2 have multiple transcription start sites.
We elected to analyze CpG sites that were upstream of the
longest known 5⬘ UTR of transcripts from each promoter.
Relative to the cDNA clone accession M15647, the 12 CpG
sites in P1 were at ⫺528, ⫺523, ⫺470, ⫺302, ⫺260, ⫺231,
⫺143, ⫺86, ⫺31, ⫺29, ⫹13, and ⫹ 22. Bisulfite-treated
genomic DNA was amplified with the following primers: CpG
sites between ⫺528 and ⫺470: set 1 forward 5⬘-ACCTTCTT-
TCATAATTCACTTTCC, reverse 5⬘-GGGTAAGTGGTTGG-
TAGT ATGG; CpG sites between ⫺302 and ⫺143: set 2
forward 5⬘-TAGTTGTGGTTATGGGGT AGTATTAA, reverse
5⬘-AATTACAAAAACCCAAATCAAATACT; CpG sites be-
tween ⫺86 and ⫹ 22: set 3 forward 5⬘-AAAAATATCTC
TCTTCCTACCTATTAC, reverse 5⬘-TTAGATAGGAATATTA-
GAAATTTGGGG. Relative to the cDNA clone accession no.
NM_178866, the 6 CpG sites in P2 were at ⫺231, ⫺142, ⫺133,
⫺112, ⫺70, and ⫺41 on the genomic DNA. The primer
sequences for CpG sites ⫺231 to ⫺112: set 4 forward 5⬘-
GGAGGGTTTAATTTATAAAAGATTTTAG, reverse 5⬘-CCC-
AAACCACTTCCTTACCTAA; CpG sites between ⫺70 and ⫺41:
set 5 forward 5⬘-GTTGTTGTTGTTATTGTTYGTGGTA, reverse
5⬘-CTAAAATCTTTTATAAATTAAACCCTCC. PCR conditions
for the primers were 95°C for 10 min, followed by 94°C for 30 s,
annealing at 53°C (sets 1, 4, and 5) or 54°C (sets 2 and 3) for
30 s, 72°C for 30 s, 35 cycles. For each group, 4 animals were
analyzed by bisulfite sequencing. The PCR products from bisul-
fite-treated genomic DNA were cloned into the vector pSC-A
(Stratagene, Cedar Creek, TX, USA). Six colonies from each
PCR cloning were inoculated into SeqPrepTM 96 plates (Edge
BioSystems, Gaithersburg, MD, USA). The plasmid DNA was

TABLE 1. Real-time RT-PCR primer/probe sets

Transcript Sequence

IGF-1A For 5⬘ GTGTCCGCTGCAAGCCTAC

Rev 5⬘ CAAGTGTACTTCCTTCTGAGTCTTGG
Probe 5⬘ 6FAM-AAGTCAGCTCGTTCCATCCGGGC
IGF-1B For 5⬘ CACTGACATGCCCAAGACTCA
Rev 5⬘ CCTTCTCCTTTGCAGCTTCCT
Probe 5⬘ 6FAM-AAGTCCCAGCCCCTATCGACACACAA
IGF-1 P1 For 5⬘ TTTGTACTTCAGAAGCGATGGG
Rev 5⬘ CGACATGATGTGTATCTTTATCTTCAAG
Probe 5⬘ 6FAM-TTCCAACTCAATTATTTAAGATCTGCCTCTGTGA
IGF-1 P2 For 5⬘ ACCCACTCTGACCTGCTGTGT
Rev 5⬘ ATGTGTATCTTTATTGGAGGTGCG
Probe 5⬘ 6FAM-AACGACCCGGGACGTACCAAAATGA
GAPDH For 5⬘ CAAGATGGTGAAGGTCGGTGT
Rev 5⬘ CAAGAGAAGGCAGCCCTGGT
Probe 5⬘ 6FAM-GCGTCCGATACGGCCAAATCCG

2440 Vol. 23 August 2009 The FASEB Journal FU ET AL.

prepared by using SeqPrep 96 Plasmid Prep Kit (Edge BioSystems) TABLE 3. ChIP analysis of intergenic region 5⬘ of IGF-1
and sequenced according to the manufacturer’s instructions confirms presence of histone covalent modifications with signals
for double-stranded plasmid DNA using the BigDye® Termi- proportional to the amount of input DNA
nator v3.1 Cycle Sequencing kit (Applied Biosystems) with
M13 forward or reverse primers. Using these primers, we DNA from ChIP Amount (ng) Ct of intergenic region
often encountered multiple sequence traces per reaction.
Therefore, the alternative sequencing primer 5⬘- acK9H3 1 35.9
TGCAGCCCAATGTGGAATTCG was used successfully to se- 4 34.1
quence the majority of the failed colonies. acK14H3 1 30.9
4 29.1
Chromatin immunoprecipitation (ChIP) assay and real-time me2K4H3 1 34.6
PCR 4 31.6
me3K4H3 1 35.3
4 32.7
ChIP with anti-acK9H3 (Cell Signaling Technologies, Beverly,
me3K9H3 1 34.7
MA, USA), anti-acK14H3, anti-me2K4H3, anti-me3K4H3, anti-
4 32.8
me3K9H3 (Millipore Upstate, Charlottesville, VA, USA), or
me3K36H3 1 32.7
anti-me3K36H3 (Abcam, Cambridge, MA, USA) was per-
2 31.1
formed as described earlier (42). The chromatin equivalent
of 100 ␮g DNA based on the absorption at A260 was used in
each immunoprecipitation (IP). For anti-acK14H3, 20 ␮g of
antibody was used. For all of the others, the volume of The distribution pattern of histone covalent modifica-
antibody was equal to the volume of formaldehyde cross- tions along the IGF-1 gene was determined by looking at
linked chromatin. After purification from IP chromatin, DNA the same six modifications at the five sites indicated above.
was determined against a standard curve with SYBR Safe DNA Values were expressed as percentage of the P1 site. To
gel stain (Molecular Probes, Eugene, OR, USA). The SYBR absolutely quantitate the five sites in each sample and
Safe fluorescence was measured with a Tecan plate reader establish that all primers and probes annealed equivalently,
(Genios Pro-Basic w/o FP; Tecan Austria GmbH, Grodig, a synthetic template was generated by cloning the five sites
Austria) and Magellan V 6.2 software (Tecan). DNA frag- into a single plasmid of pBSKII (Stratagene) (synthetic
ments containing IGF-1 site-specific sequences, including P1,
template cloning primers are shown in Table 4). The
P2, exon 5, and proximal and distal 3⬘ UTR of the IGF-1 gene
synthetic template was diluted serially, and each site was
and an intergenic region, were quantified by real-time PCR.
quantified by real-time PCR. Ct values for all five primer/
Primer and probe sequences listed in Table 2, and their
location on IGF-1, shown in Fig. 1A, were designed using probe sets were found to be equivalent (Table 5).
Primer Express software (Applied Biosystems). Intergenic
sequences have been used as internal controls in ChIP assays Statistics
(50). Therefore, we used a site 263.8 kb (accession no.
BH351084) upstream of the IGF-1 gene, which is not tran-
scribed, as an intergenic control. This region was found to
contain low levels of all 6 histone covalent modifications, with Data were expressed as mean ⫾ se percentage of control or of
the signal proportional to the amount of input DNA from P1. ANOVA (Fisher’s protected least-significant difference)
each ChIP analysis (Table 3). Relative quantification of PCR and Student’s unpaired t test were used for real-time RT-PCR.
products was based on value differences between the target Student’s 2-tailed t test was used for statistical significance for
and the intergenic control using the comparative Ct method DNA methylation. A value of P ⬍ 0.05 was considered
(TaqMan Gold RT-PCR manual; PE Biosystems). statistically significant.

TABLE 2. ChIP/real-time PCR primer/probe sets

Transcript Sequence

P1 For 5⬘ CAGGTCTGGCTCATTTCCATC
Rev 5⬘ GCGCTTTCCATGGCTGTC
Probe 5⬘ 6FAM-CCCCTGGGAAAGCACACCTGGA
P2 For 5⬘ GCCGGAGGGCTTAATTCATAA
Rev 5⬘ GGAAGCATTTGAAAGCAGCAC
Probe 5⬘ 6FAM-AGATCCCAGTCAAAGAGTGCAGCGTTTC
Exon 5 For 5⬘ GCCCCTATCGACACACAAGAA
Rev 5⬘ TCCTGGGTGTGCCTTTGAC
Probe 5⬘ 6FAM-CACCTTTCCTTCTCCTTTGCAGCTTCCT
Proximal 3⬘ UTR For 5⬘ GACCTACAGAATGTAGGAGGAGCC
Rev 5⬘ GATGTTTTGCAGGTTGCTCAAG
Probe 5⬘ 6FAM-ATGCCACGTCACCGCAAGATCCTTT
Distal 3⬘ UTR For 5⬘ ACAATAGAGGTGGCCTTCTCCA
Rev 5⬘ CACTGGGAATCATCGAAGCC
Probe 5⬘ 6FAM-ATCGGTGGGCTTCCTGCCATGG
Intergenic region For 5⬘ AAGTGGCAACTCCATGACTCAA
Rev 5⬘ GCCTGGTGTCACACCCAAA
Probe 5⬘ 6FAM-ATGCCTTCCAGAGAGGTTTGGTACTGCC

IUGR AFFECTS HEPATIC IGF-1 HISTONE CODE 2441

 TABLE 4. Primers used to clone IGF-1 sequences to make synthetic template used in standard
curve for real-time PCR quantification

Transcript Sequence

P1 For 5⬘ gctctagaCAGGTCTGGCTCATTTCCATC
Rev 5⬘ cgggatccGCGCTTTCCATGGCTGTC
P2 For 5⬘ cgggatccGCCGGAGGGCTTAATTCATAA
Rev 5⬘ gtctgcagcGGAAGCATTTGAAAGCAGCAC
Exon 5 For 5⬘ gtctgcagcGCCCCTATCGACACACAAGAA
Rev 5⬘ ccaagcttTCCTGGGTGTGCCTTTGAC
Proximal 3⬘ UTR For 5⬘ ccaagcttGACCTACAGAATGTAGGAGGAGCC
Rev 5⬘ ccggtcgacGATGTTTTGCAGGTTGCTCAAG
Distal 3⬘ UTR For 5⬘ ccctcgagACAATAGAGGTGGCCTTCTCCA
Rev 5⬘ gtggtacctCACTGGGAATCATCGAAGCC

Lowercase indicates restriction sites added for cloning purposes.

RESULTS insufficiency significantly increased CpG methylation at

the ⫺470 CpG site with a trend toward hypermethyl-
DOL0 and DOL21 serum IGF-1 levels reduced in ation at ⫺523 and ⫺528 sites relative to controls
IUGR (Fig. 2A). In DOL0 females, the ⫺260 CpG site was
hypermethylated, while sites ⫺143 and ⫺29 were
IUGR significantly decreased serum IGF-1 levels in both hypomethylated (Fig. 2B). At DOL21, sites ⫹22,
male and female rats vs. controls at DOL 0 (67.4⫾2.8 ⫺470, and ⫺523 were significantly hypermethylated
vs. 88.2 ng/ml in males; P⬍0.001; 69.1⫾3.4 vs. in IUGR males relative to controls (Fig. 2C), with no
78.4⫾1.5 ng/ml in females; P⬍0.05). At DOL21, serum significant difference in IUGR females relative to
IGF-1 levels in both male and female rats continued to controls (Fig. 2D).
be significantly decreased (501⫾175 vs. 638⫾136
ng/ml in males; P⬍0.01; 591⫾38 vs. 913⫾103 ng/ml in IGF-1 P2 DNA methylation
females; P⬍0.001) (Fig. 1B).
Six CpG sites were analyzed for methylation status within
Hepatic IGF-1 mRNA levels
P2 of IGF-1. At DOL0 in males, uteroplacental insuffi-
ciency significantly increased CpG methylation at sites
At DOL0, IUGR significantly decreased P1-initiated tran-
⫺112, ⫺133, and ⫺142 relative to controls (Fig. 3A). In
scripts to 25 and 40% of controls in males and females,
females, only site ⫺112 was hypermethylated, whereas site
respectively (Fig. 1C). Similarly, P2-initiated transcripts
⫺133 was hypomethylated (Fig. 3B). At DOL21, site ⫺112
were reduced to 39 and 46% of male and female
remained significantly hypermethylated in IUGR males
controls. IGF-1A variant transcripts were reduced to
(Fig. 3C), while site ⫺133 remained hypomethylated in
approximately one-third of male and female control
females (Fig. 3D).
levels, and IGF-1B was 26 and 39% of control male and
female levels, respectively. At DOL21, in IUGR animals,
P2-initiated transcripts (75 and 79% of controls in Hepatic IGF-1 histone code
males and females, respectively) and IGF-1B transcripts
(70 and 85% of controls in males and females) were Five sites along the IGF-1 gene were analyzed for six
still less than controls (Fig. 1D). histone H3 covalent modifications in the control group
to determine a “normal” histone code of the rat hepatic
IGF-1 P1 DNA methylation IGF-1 gene. The extent of each modification at the
specific sites was quantified by ChIP/real-time PCR and
Twelve CpG sites were analyzed for methylation status expressed as a percentage of that observed at site P1,
within P1 of IGF-1. At DOL0 in males, uteroplacental the predominant promoter in most tissues. For control
DOL0 male and females (Fig. 4A), acetylation at K9 was
significantly higher at P2 relative to P1, and acetylation
TABLE 5. IGF-1 real-time/ChIP primer/probe efficiency
of this site progressively decreased toward the 3⬘ UTR
Synthetic template/
region of IGF-1. Acetylation at K14 was also increased in
rxn (fmol) Site Mean Ct % of P1 both sexes but was statistically significant only in fe-
males. Di- and trimethylation at K4 followed a similar
0.1 P1 18.7 100.0 pattern, with both forms of methylation being higher at
0.1 P2 19.0 101.6 P2 relative to P1. Though not as robust, trimethylation
0.1 Exon 5 19.1 100.3 at K9 was increased significantly at P2 relative to P1,
0.1 Proximal 3⬘ UTR 18.9 99.0
without the diminution of this marker in the 3⬘ UTR
0.1 Distal 3⬘ UTR 18.8 99.5
regions. In contrast to patterns of the previous de-

2442 Vol. 23 August 2009 The FASEB Journal FU ET AL.

 A B
90% Promoter 1 CpG sites 90% Promoter 1 CpG sites
-528 +22 -528 +22
80% 80%
Exon 1 * Exon 1

70% 70%
*
* *
% of CpG methylation

% of CpG methylation
60% Con 60% Con

in DOL0 females
in DOL0 males

*
50% 50%

40% 40%

30% 30%

20% 20%

10% IUGR 10% IUGR

0% 0%
28 23 70 02 60 31 43 -86 -31 -29 3
+1 +2
2 28 23 70 02 60 31 43 -86 -31 -29 3
+1 +2
2
-5 -5 -4 -3 -2 - 2 -1 -5 -5 -4 -3 -2 -2 -1

Promoter 1 CpG sites Promoter 1 CpG sites

C Promoter 1 CpG sites

D Promoter 1 CpG sites
-528 +22 -528 +22
Exon 1 Exon 1
50% 50%
% of CpG methylation

% of CpG methylation
in DOL21 females
*
in DOL21 males

40% 40%
Con Con
*
30% * 30%

20% 20%

10% 10%

0% 0%
28 23 70 02 60 31 43 -86 -31 -29 3
+1 +2
2 28 23 70 02 60 31 43 -86 -31 -29 3
+1 +2
2
-5 -5 - 4 - 3 -2 -2 -1 -5 -5 -4 -3 -2 -2 -1
Promoter 1 CpG sites IUGR Promoter 1 CpG sites IUGR

Control methylated-CpG
IUGR unmethylated-CpG

Figure 2. Rat hepatic IGF-1 P1 CpG methylation. Graphs represent mean ⫾ se percentage of CpG methylation between ⫺528
and ⫹22. A) DOL0 male. B) DOL0 female. C) DOL21 male. D) DOL21 female. White bars indicate control values; gray bars
indicate IUGR. Right panels show methylation pattern; each horizontal row of beads represents 12 CpG sites. Open circles
represent unmethylated CpG sites; solid circles represent methylated CpG sites. *P ⬍ 0.05.

scribed covalent modifications, trimethylation of K36 concentrations of me2K4, while me3K36 decreased at
was highest at exon 5 and the 3⬘ UTR regions vs. the 5⬘ all sites, with P2 and the distal 3⬘ UTR site being
end of the hepatic IGF-1 gene. It is important to note statistically significant (Fig. 5A). At DOL21, similar to
that a similar pattern of histone code for these modifi- the DOL0 findings, IUGR significantly increased
cations was observed for control DOL0 male and fe- me2K4 and decreased me3K36 at the P2 site (Fig. 5C).
males (Fig. 4B). Furthermore, less me3K36 was also evident along the 3⬘
At DOL21 in control males, the distribution patterns end of the hepatic IGF-1 gene, with statistical signifi-
of acK9 and acK14 were essentially equivalent to DOL0, cance being reached for exon 5.
while the histone H3 methylation patterns differed In females, in contrast to the males, both hepatic
(Fig. 4C). A shift away from me2K4 and toward exten- H3 methylation and acetylation were affected by
sive accumulation of me3K4 at P2 was noted. Trimethyl IUGR. IUGR significantly increased me3K4 of the
K9 was uniformly distributed across the gene. The DOL0 female IGF-1 gene at P1, as opposed to me2K4
pattern for me3K36 was similar to that seen at DOL0 in males (Fig. 5B). Furthermore, me3K36 was also
but at a much higher level. Importantly, as was seen at decreased significantly at all five sites in DOL0 IUGR
DOL0, DOL21 females showed a pattern similar to females. In terms of acetylation, IUGR significantly
DOL21 males (Fig. 4D). increased acK14 at P1, exon 5, and 3⬘UTR distal sites
The same six histone H3 covalent modifications at of the hepatic IGF-1 gene in the DOL0 females. At
the five sites were then analyzed in IUGR rat liver and DOL21, in IUGR females me3K36 remained lower
quantified relative to the control animals, where the along the entire length of the gene, in contrast to
controls were considered to be 100%, after normaliza- males in which me3K36 was significantly decreased at
tion with the 263.8-kb intergenic region for both two sites (Fig. 5D).
groups. Data in the figures are presented as percentage
of gender- and age-matched control samples. In some
circumstances in which it appears that IUGR had a DISCUSSION
significant effect on a specific modification, the change
was not statistically significant secondary to variability in The primary finding of this study is that IUGR affects
the control animals. the epigenetic characteristics of hepatic IGF-1 along its
In males, hepatic H3 methylation was affected by entire length and that many of these changes persist
IUGR. At DOL0, P1, P2, and exon 5 had a higher postnatally within the context of decreased hepatic

IUGR AFFECTS HEPATIC IGF-1 HISTONE CODE 2443

Figure 3. Rat hepatic IGF-1 P2 CpG methylation. Graphs represent mean ⫾ se percentage of CpG methylation between ⫺231
and ⫺41. A) DOL0 male. B) DOL0 female. C) DOL21 male. D) DOL21 female. White bars indicate control values; gray bars
indicate IUGR. Right panels show methylation pattern; each horizontal row of beads represents 6 CpG sites. Open circles
represent unmethylated CpG sites; solid circles represent methylated CpG sites. *P ⬍ 0.05; **P ⬍ 0.01; ***P ⬍ 0.001.

IGF-1 mRNA and serum protein levels. A secondary yet
important finding of this study relates to gender. While
the hepatic IGF-1 histone code does not vary between
the genders under normal conditions, the postnatal
effect of uteroplacental insufficiency and IUGR on the
hepatic IGF-1 histone code is gender specific.
In the rat, previous studies used unilateral uterine
artery ligation to investigate the effects of IUGR on
IGF-1 expression. Vileisis et al. (19) used unilateral
ligation to induce IUGR and found that fetal weight
positively correlated with serum glucose (P⬍0.001),
liver IGF-1 protein (P⬍0.001), and serum IGF-1 protein
(P⬍0.001) levels (19). No correlation was evident for
either serum insulin or lung IGF-1 protein, demonstrat-
ing that the effect of IUGR is gene- and tissue-specific.
Interestingly, serum fetal glucose concentrations corre-

Figure 4. Distribution pattern of histone modifications along the IGF-1 gene in control DOL0 and DOL21 rat livers. Six histone
modifications at 5 sites on the IGF-1 locus were analyzed by ChIP/real-time PCR. Values for 4 sites, including P2, exon 5, and
proximal and distal 3⬘ UTR, are presented as mean ⫾ se percentage of P1value (set to 100%). A) DOL0 male. B) DOL0 female.
C) DOL21 male. D) DOL21 female. *P ⬍ 0.05; **P ⬍ 0.01; ***P ⬍ 0.001; ****P ⬍ 0.0001.

2444 Vol. 23 August 2009 The FASEB Journal FU ET AL.

Figure 5. Histone modifications along the IGF-1 gene in DOL0 and DOL21 rat IUGR livers relative to control. Six histone
modifications at 5 sites, including P1, P2, exon 5, and proximal and distal 3⬘ UTR on the IGF-1 locus, were analyzed by
ChIP/real-time PCR. IUGR values at each site were compared to their equivalent control values (set to 100%). A) DOL0 male.
B) DOL0 female. C) DOL21 male. D) DOL21 female. *P ⬍ 0.05; **P ⬍ 0.01; ***P ⬍ 0.001.
lated positively with liver and serum IGF-1 protein
levels, implicating fetal glucose delivery in the regula-
tion of hepatic IGF-1 synthesis.
In our model of bilateral uterine artery ligation, we
found at DOL0 that IUGR reduced serum IGF-1 levels.
IUGR reduced hepatic IGF-1 mRNA transcripts initi-
ated from alternative promoters as well as reduced
levels of alternative splice variants A and B in the DOL0
animals. At DOL0, the reduction in serum IGF-1 pro-
tein levels was not as great as the reduction in mRNA.
One possible explanation might involve translation
efficiency. It has been shown recently in yeast under
conditions of starvation that gene-specific translation
efficiency appears to increase, particularly when multi-
ple upstream open reading frames (uORFs) exist
within the 5⬘ UTR. In the case of IGF-1 P2 transcripts,
there are 8 uORFs (51). At DOL21, IUGR decreased
hepatic IGF-1 transcription initiated from P2 as well as
transcripts containing exon 5. The DOL21 mRNA data
are more consistent with the lesser decrease in serum
IGF-1. The reduction in IGF-1B transcripts in IUGR
males and females would influence Eb peptide levels
but not circulating mature IGF-1 protein levels.
In terms of IGF-1 transcriptional regulation from
different promoters, several groups, including Adamo
et al. (26, 52) and Simmons et al. (53), established the
structure and start-site usage of the 5⬘ end of the rat
hepatic IGF-1 gene. Based on combined works, multi-
ple dispersed sites over a 350-bp 5⬘ region produce a P1
transcript that includes exon 1, whereas multiple highly
localized sites within exon 2 produce the P2 transcript.
The two different predominant IGF-1 mRNA species
initiate translation at distinct AUG codons and result in
IUGR AFFECTS HEPATIC IGF-1 HISTONE CODE
IGF-1 proteins with either a 48-residue class-1 prepep-
tide or a 32-residue class-2 prepeptide.
Postnatally, both the P1 and P2 sites respond to
diabetes, fasting, and increased caloric intake, with the
P2 sites appearing to be more sensitive to the latter set
of conditions (52). Furthermore, when compared to
the P1 site, P2 differentially responds to GH signaling
(54, 55). For example, increased serum levels of IGF-1
in C3H/HeJ mice vs. C57BL/6J mice appear to result
from increased transcription from the hepatic P2 pro-
moter (56), while other studies have shown that GH
stimulates both P1 and P2 transcripts equally well (57).
In terms of the phenotypic significance related to the
usage of exon 5, only limited literature is specific to the
liver. Zhang et al. (58) have demonstrated that fasting
decreases levels of the IGF-1B transcript in adult rat
liver without affecting levels of the IGF-1A transcript.
The specific transcript is important because it deter-
mines which E-peptide is produced (e.g., Ea or Eb). In
the rat, the Eb peptide (or the E1 amide) has growth-
promoting effects on epithelial cells. This action is not
diminished significantly by competition with IGF-1,
insulin, or antagonist antibodies to IGF-1 receptor. In
humans, the synthetic hEb peptide can regulate cell
growth and differentiation of several cancer cell lines in
a manner that is also distinct from either IGF-1 or
insulin (59). Furthermore, the human liver makes an
Ec peptide that is 73% homologous to the rat Eb
peptide from the IGF-1B mRNA species (60).
As suggested by these multiple mRNA species, the
hepatic IGF-1 gene is regulated epigenetically. Though
studies have noted specific epigenetic changes in re-
sponse to IUGR in other genes, the vast majority of
these analyses have been limited to promoter regions.
2445
Recent studies involving epigenetic programming of
the hepatic DUSP5 gene led us to the insight that many
of the epigenetic consequences of perinatal environ-
mental events are not limited to the 5⬘ regulatory
region (42).
One of these epigenetic consequences is DNA
methylation. DNA CpG methylation plays a central role
in gene expression. Traditionally, DNA methylation
within CpG sites within promoters is thought to silence
genes in an “on– off” manner (36). Evidence of this
phenomenon is seen in developmental processes regu-
lating tissue-specific gene expression. In contrast, we
have observed in two disparate genes (i.e., DUSP5,
IGF-1) that environmental stresses in the perinatal
period affect CpG DNA methylation in regions margin-
ally populated by CpGs, leading to moderate decreases
in gene expression, at least at a tissue level.
More specifically, the modest extent of IGF-1 P1 and
P2 DNA hypermethylation appears to dampen IGF-1
expression in the IUGR liver. Similar results were seen
for CpG methylation within the promoter of the gluta-
mate decarboxylase (GAD) gene (61). GAD DNA iso-
lated from repressive GAD nonexpressing brain tissue
showed a 2- to 4-fold increase in methylation compared
to GAD⫹ tissue but still only represented ⬃5% increase
in sites methylated. In addition, DNA methylation has
also been used to demonstrate changes in nucleosome
positioning to explain changes in gene expression (62).
The changes in DNA methylation seen here between
IUGR and control may be an indication of altered
histone placement.
Histones and associated modifications have also been
implicated in gene activation and silencing and play a
role in all stages of transcription, including initiation,
elongation, and termination. Site-specific histone mod-
ifications, including histone acetylation and methyl-
ation, have been identified around transcription start
sites. The main sites of lysine methylation associated
with gene activation include K4, K36, and K79 on
histone H3, while acetylation occurs at H3K9 and K14.
Though earlier works focused on the consequences of
single site histone modifications, it is now evident that
modifications at different sites influence their effect on
transcription, which involves simultaneously reading
multiple histone markers (63).
To establish a more complete histone code for IGF-1,
we looked at six histone H3 markers. Trimethyl K4
(me3K4), acetyl K9 (acK9), and acK14 are traditionally
associated with gene activation. Dimethyl K4 (me2K4)
and me3K36 are traditionally associated with tran-
scription elongation, while me3K9 is considered to
be involved in gene silencing. Recently, however,
me3K9 also has shown to be associated with active
genes (66 – 68).
In the context of mapping the histone code for the
“normal” rat IGF-1 gene, acetyl K9 and K14 were
highest at the 5⬘ end, while me3K36 accumulated more
at the 3⬘end. The two IGF-1 promoters displayed differ-
ent modification patterns with P2 having a greater
accumulation of all histone covalent modifications an-
2446 Vol. 23 August 2009 The FASEB Journal
alyzed. The increased accumulation seen here was not
associated with increased hepatic expression from P2
(26, 27). The differences between P1 and P2 could be
due to multiple factors. First, the transcriptional activity
at P1 may influence modifications at P2. Second, P2
initiates transcription from a single cluster of sites and
contains a putative CAAT box and TATA box, both of
which attract particular chromatin modifying com-
plexes (52). These core promoter elements are missing
from P1. Promoters lacking TATA boxes attract a
different set of factors and therefore a different chro-
matin modifying complexes are likely attracted (64).
The lack of core promoter elements and associated
protein complexes in P1 may be responsible for dis-
persed transcription initiation from two major and two
minor sites spread over several hundred bases (52, 64,
65). Finally, the greater accumulation of modifications
at P2 may simply be due to an overall increase in
histone residency across P2.
Interestingly, histone modifications spanning the
normal IGF-1 gene were similar between male and
female controls, though a great deal variability did exist
among the controls. However, when challenged with
IUGR, males and females responded differently. For
example, IUGR increased me2K4 at P1, P2, and exon 5
in DOL0 male livers, whereas IUGR increased me3K4 at
P1 and acetyl K14 across the entire locus DOL0 female
livers. At DOL21, me2K4 at P2 was still increased in
IUGR male livers, whereas IUGR decreased me3K4 at
P2 in IUGR female livers. Interestingly, less variability
was often found among the IUGR animals relative to
the controls, which suggests that the response to IUGR
forces a relative synchronization of the histone code.
This epigenetic synchronization may limit the ability of
the liver to respond to the continuum of demands
placed on it throughout the life of the animal. Al-
though the technology is not yet available to test
directly the consequences of these histone modifica-
tions in a gene-specific manner in vivo, it is clear that
the IGF-1 hepatic histone code differs for males and
females under the stress of IUGR.
A telling example of this difference is me3K4 at P1,
which is increased in IUGR female livers at DOL0, but
not in male IUGR livers. me3K4 occurs secondary to
the attraction of the methyltransferase Set1 by phos-
phorylated RNA polymerase II (66 – 68). me3K4 of the
5⬘ end of a gene is commonly associated with gene
activation and initiation of elongation (69 –74). Subse-
quently, the increase in me3K4 at P1 in DOL0 IUGR
females relative to the controls was unexpected given
the decrease in IGF-1 mRNA levels. This finding sug-
gests that the initial stage of RNAPII polymerase migra-
tion on the IGF-1 gene may not have been affected.
In contrast, transcriptional elongation may be af-
fected. This theory is suggested by IUGR decreasing
me3K36 in the body and 3⬘ end of the gene in IUGR
males and females at both ages, in association with the
decreased levels of IGF-1 mRNA. As RNAPII polymer-
ase migrates toward the 3⬘end of the gene, the methyl-
transferase Set2 is attracted to the transcription com-
FU ET AL.
plex under normal conditions (66 – 68, 75, 76). Set2
methylates K36 of histone H3, and this methylation
appears to be critical to transcriptional elongation. Our
findings suggest that uteroplacental insufficiency and
IUGR disrupt components of this system, such as Set2
or RNAPII polymerase phosphorylation, the latter of
which is necessary for Set2 binding. At a minimum, our
findings represent a downstream marker of aberrant
transcriptional regulation of the hepatic IGF-1 gene in
the IUGR rat and demonstrate the value of assessing
chromatin structure at more than the 5⬘ promoter region.
It is possible that our findings will further represent an
initial disruption of the histone code that leads to subse-
quent failure of IGF-1 transcriptional elongation.
In our study, an IUGR insult altered components of
the IGF-1 histone code that persist from the perinatal
period into juvenile life. Alterations to the histone code
that continue well beyond the point of insult offer
insight into possible mechanisms through which utero-
placental insufficiency may predispose toward the phe-
notypic changes seen later in life. Two persistent
changes are particularly intriguing. The first change is
the persistence decrease in me3K36 at DOL0 and
DOL21 in both genders at multiple sites. As discussed
above, this may lead a dampening of IGF-1 transcrip-
tional elongation and a subsequent decrease in expres-
sion. The second change is the increase in me2K4 at P2
in the male animals. Though often thought of as an
“activating marker” of transcription, evidence exists
that the increase in me2K4 may come at the expense of
me3K4, likely an even more potent transcriptional
activator (77, 78). The significant decrease of me3K4 in
the DOL21 female IUGR liver in association with the
decreased expression of IGF-1 mRNA is consistent with
the concept that the ratio of me2K4: me3K4 may be an
important regulator of transcriptional regulator. The
latter highlights the concept that similar responses in
gene expression to a stimulus may occur through
gender-specific modifications of the histone code. How-
ever, caution needs to be exerted in speculating on the
long-term effects of persistent modifications of histone
marks, particularly considering that the effects of these
changes are likely dependent on multiple factors, in-
cluding the histone code of multiple other nucleo-
somes. At this juncture, no primary “epigenetic trans-
genic” animal model exists to demonstrate how an
initial change in an epigenetic characteristic changes
expression of a specific gene.
The translational relevance of our findings lies in the
potential importance of IGF-1 to several components of
the IUGR postnatal phenotype. The first and most
obvious is growth. IGF-1 mediates many of the anabolic
and mitogenic actions of growth hormone in postnatal
life. Fattal-Valevski et al. (17) determined IGF-1 levels in
preadolescent IUGR children (mean age 6.5⫾2.1 yr;
n⫽57) vs. control children (7.6⫾2.8 yr; n⫽30), IGF-1
serum levels were significantly decreased in the non
catch-up IUGR group. Similarly, Verkauskiene et al.
(79) investigated a group of adults (mean age 22.6⫾4.3
yr) that were born small for gestational age (SGA)
IUGR AFFECTS HEPATIC IGF-1 HISTONE CODE
verses adults (mean age 22.6⫾4.2 yr) who were appro-
priately sized at birth. IUGR adults who were character-
ized by low weight and height also demonstrated signif-
icantly lower mean serum IGF-1 levels.
Low IGF-1 levels also contribute to adult insulin
resistance, another major morbidity associated with
IUGR. Hepatic IGF-1 is of vital importance for normal
carbohydrate metabolism in both mice and humans. In
mice, elimination of hepatic IGF-1 production using a
Cre/loxP recombination system increases serum levels
of insulin without significantly affecting glucose elimi-
nation (80). In humans, recombinant IGF-1 is ⬃6% as
potent as insulin in the production of hypoglycemia
(81). Furthermore, severe IGF-1 deficiency in humans
leads to insulin resistance, which is reversible with
recombinant IGF-1 (18).
Caution is always necessary when attempting to apply
data from a rat model to human pathophysiology. The
fetal and juvenile rat are physiologically immature
relative to the human, and the insult imposed on the
fetal rat in this model of uteroplacental insufficiency is
severe, while the effect of uteroplacental insufficiency
experienced by humans ranges across a continuum.
Furthermore, we acknowledge that early postnatal nu-
trition is important. We have previously characterized
breast milk from our control and IUGR dams after 21 d
of supporting their respective pups, and no significant
differences in KCAL, protein, fat, or zinc were noted
between the two groups (48).
The work we present here establishes part of the
histone code for the rat hepatic IGF-1 gene under
normal and intrauterine growth restricted conditions.
The results show unique patterns of multiple histone
modifications at defined locations within the gene. Our
findings strongly support the concept that alterations in
the histone code along the IGF-1 gene are responsible
for the reduced levels of IGF-1 observed in IUGR rats.
Changes in both histone acetylation and methylation
were observed, which indicates that multiple histone
modifying complexes are affected by UPI.
The project was funded by the U.S. National Institutes of
Health, grant HD41075. We thank the Division of Neonatol-
ogy and the Developmental Origins of Health Laboratories at
the University of Utah for their support and guidance.
REFERENCES
1. Syddall, H. E., Sayer, A. A., Simmonds, S. J., Osmond, C., Cox,
V., Dennison, E. M., Barker, D. J., and Cooper, C. (2005) Birth
weight, infant weight gain, and cause-specific mortality: the
Hertfordshire cohort study. Am. J. Epidemiol. 161, 1074 –1080
2. Witlin, A. G., and Sibai, B. M. (1997) Hypertension in pregnancy:
current concepts of preeclampsia. Annu. Rev. Med. 48, 115–127
3. Zimmermann, P., Eirio, V., Koskinen, J., Kujansuu, E., and
Ranta, T. (1997) Doppler assessment of the uterine and utero-
placental circulation in the second trimester in pregnancies at
high risk for pre-eclampsia and/or intrauterine growth retarda-
tion: comparison and correlation between different Doppler
parameters. Ultrasound Obstet. Gynecol. 9, 330 –338
4. Frusca, T., Soregaroli, M., Valcamonico, A., Guandalini, F., and
Danti, L. (1997) Doppler velocimetry of the uterine arteries in
nulliparous women. Early Hum. Dev. 48, 177–185
2447
 5. Barker, D. J., Hales, C. N., Fall, C. H., Osmond, C., Phipps, K.,
and Clark, P. M. (1993) Type 2 (non-insulin-dependent) diabe-
tes mellitus, hypertension and hyperlipidaemia (syndrome X):
relation to reduced fetal growth. Diabetologia 36, 62– 67
6. Mi, J., Law, C., Zhang, K. L., Osmond, C., Stein, C., and Barker,
D. (2000) Effects of infant birthweight and maternal body mass
index in pregnancy on components of the insulin resistance
syndrome in China. Ann. Intern. Med. 132, 253–260
7. Radunovic, N., Kuczynski, E., Rosen, T., Dukanac, J., Petkovic,
S., and Lockwood, C. J. (2000) Plasma apolipoprotein A-I and B
concentrations in growth-retarded fetuses: a link between low
birth weight and adult atherosclerosis. J. Clin. Endocrinol. Metab.
85, 85– 88
8. Valdez, R., Athens, M. A., Thompson, G. H., Bradshaw, B. S.,
and Stern, M. P. (1994) Birthweight and adult health outcomes
in a biethnic population in the USA. Diabetologia 37, 624 – 631
9. Yarbrough, D. E., Barrett-Connor, E., Kritz-Silverstein, D., and
Wingard, D. L. (1998) Birth weight, adult weight, and girth as
predictors of the metabolic syndrome in postmenopausal wom-
en: the Rancho Bernardo study. Diabetes Care 21, 1652–1658
10. Phillips, D. I., Barker, D. J., Hales, C. N., Hirst, S., and Osmond,
C. (1994) Thinness at birth and insulin resistance in adult life.
Diabetologia 37, 150 –154
11. Tenhola, S., Halonen, P., Jaaskelainen, J., and Voutilainen, R.
(2005) Serum markers of GH and insulin action in 12-year-old
children born small for gestational age. Eur. J. Endocrinol. 152,
335–340
12. Flanagan, D. E., Moore, V. M., Godsland, I. F., Cockington,
R. A., Robinson, J. S., and Phillips, D. I. (2000) Fetal growth and
the physiological control of glucose tolerance in adults: a
minimal model analysis. Am. J. Physiol. Endocrinol. Metab. 278,
E700 –706
13. Woods, K. A., Camacho-Hubner, C., Savage, M. O., and Clark,
A. J. (1996) Intrauterine growth retardation and postnatal
growth failure associated with deletion of the insulin-like growth
factor I gene. N. Engl. J. Med. 335, 1363–1367
14. Lassarre, C., Hardouin, S., Daffos, F., Forestier, F., Frankenne,
F., and Binoux, M. (1991) Serum insulin-like growth factors and
insulin-like growth factor binding proteins in the human fetus.
Relationships with growth in normal subjects and in subjects
with intrauterine growth retardation. Pediatr. Res. 29, 219 –225
15. Ashton, I. K., Zapf, J., Einschenk, I., and MacKenzie, I. Z. (1985)
Insulin-like growth factors (IGF) 1 and 2 in human foetal
plasma and relationship to gestational age and foetal size during
midpregnancy. Acta Endocrinol. (Copenh.) 110, 558 –563
16. Ozkan, H., Aydin, A., Demir, N., Erci, T., and Buyukgebiz, A.
(1999) Associations of IGF-I, IGFBP-1 and IGFBP-3 on intrauterine
growth and early catch-up growth. Biol. Neonate 76, 274 –282
17. Fattal-Valevski, A., Toledano-Alhadef, H., Golander, A., Leitner, Y.,
and Harel, S. (2005) Endocrine profile of children with intrauter-
ine growth retardation. J. Pediatr. Endocrinol. Metab. 18, 671– 676
18. Woods, K. A., Camacho-Hubner, C., Bergman, R. N., Barter, D.,
Clark, A. J., and Savage, M. O. (2000) Effects of insulin-like growth
factor I (IGF-I) therapy on body composition and insulin resistance
in IGF-I gene deletion. J. Clin. Endocrinol. Metab. 85, 1407–1411
19. Vileisis, R. A., and D’Ercole, A. J. (1986) Tissue and serum
concentrations of somatomedin-C/insulin-like growth factor I
in fetal rats made growth retarded by uterine artery ligation.
Pediatr. Res. 20, 126 –130
20. El-Khattabi, I., Gregoire, F., Remacle, C., and Reusens, B.
(2003) Isocaloric maternal low-protein diet alters IGF-I, IGFBPs,
and hepatocyte proliferation in the fetal rat. Am. J. Physiol.
Endocrinol. Metab. 285, E991–E1000
21. Shimatsu, A., and Rotwein, P. (1987) Sequence of two rat
insulin-like growth factor I mRNAs differing within the 5⬘
untranslated region. Nucleic Acids Res. 15, 7196
22. Shimatsu, A., and Rotwein, P. (1987) Mosaic evolution of the
insulin-like growth factors. Organization, sequence, and expres-
sion of the rat insulin-like growth factor I gene. J. Biol. Chem.
262, 7894 –7900
23. Roberts, C. T., Jr., Lasky, S. R., Lowe, W. L., Jr., and LeRoith, D.
(1987) Rat IGF-I cDNA’s contain multiple 5⬘-untranslated re-
gions. Biochem. Biophys. Res. Commun. 146, 1154 –1159
24. Roberts, C. T., Jr., Lasky, S. R., Lowe, W. L., Jr., Seaman, W. T.,
and LeRoith, D. (1987) Molecular cloning of rat insulin-like
growth factor I complementary deoxyribonucleic acids: differ-
ential messenger ribonucleic acid processing and regulation by
2448 Vol. 23 August 2009 The FASEB Journal
growth hormone in extrahepatic tissues. Mol. Endocrinol. 1,
243–248
25. Tobin, G., Yee, D., Brunner, N., and Rotwein, P. (1990) A novel
human insulin-like growth factor I messenger RNA is expressed in
normal and tumor cells. Mol. Endocrinol. 4, 1914 –1920
26. Adamo, M., Lowe, W. L., Jr., LeRoith, D., and Roberts, C. T., Jr.
(1989) Insulin-like growth factor I messenger ribonucleic acids
with alternative 5⬘-untranslated regions are differentially expressed
during development of the rat. Endocrinology 124, 2737–2744
27. Shemer, J., Adamo, M., Raizada, M. K., Heffez, D., Zick, Y., and
LeRoith, D. (1989) Insulin and IGF-I stimulate phosphorylation
of their respective receptors in intact neuronal and glial cells in
primary culture. J. Mol. Neurosci. 1, 3– 8
28. Bell, G. I., Stempien, M. M., Fong, N. M., and Rall, L. B. (1986)
Sequences of liver cDNAs encoding two different mouse insulin-
like growth factor I precursors. Nucleic Acids Res. 14, 7873–7882
29. Lowe, W. L., Jr., Lasky, S. R., LeRoith, D., and Roberts, C. T., Jr.
(1988) Distribution and regulation of rat insulin-like growth
factor I messenger ribonucleic acids encoding alternative car-
boxyterminal E-peptides: evidence for differential processing
and regulation in liver. Mol. Endocrinol. 2, 528 –535
30. Richards, E. J. (2002) Chromatin methylation: who’s on first?
Curr. Biol. 12, R694 – 695
31. Ahmad, K., and Henikoff, S. (2002) Epigenetic consequences of
nucleosome dynamics. Cell 111, 281–284
32. Grewal, S. I., and Moazed, D. (2003) Heterochromatin and
epigenetic control of gene expression. Science 301, 798 – 802
33. Ng, H. H., and Bird, A. (1999) DNA methylation and chromatin
modification. Curr. Opin. Genet. Dev. 9, 158 –163
34. McNairn, A. J., and Gilbert, D. M. (2003) Epigenomic replication:
linking epigenetics to DNA replication. Bioessays 25, 647– 656
35. Cheutin, T., McNairn, A. J., Jenuwein, T., Gilbert, D. M., Singh,
P. B., and Misteli, T. (2003) Maintenance of stable heterochro-
matin domains by dynamic HP1 binding. Science 299, 721–725
36. Jones, P. A. (1999) The DNA methylation paradox. Trends Genet.
15, 34 –37
37. Pokholok, D. K., Harbison, C. T., Levine, S., Cole, M., Hannett,
N. M., Lee, T. I., Bell, G. W., Walker, K., Rolfe, P. A., Herbol-
sheimer, E., Zeitlinger, J., Lewitter, F., Gifford, D. K., and
Young, R. A. (2005) Genome-wide map of nucleosome acetyla-
tion and methylation in yeast. Cell 122, 517–527
38. Kurdistani, S. K., Tavazoie, S., and Grunstein, M. (2004) Map-
ping global histone acetylation patterns to gene expression. Cell
117, 721–733
39. Santos-Rosa, H., Schneider, R., Bannister, A. J., Sherriff, J.,
Bernstein, B. E., Emre, N. C., Schreiber, S. L., Mellor, J., and
Kouzarides, T. (2002) Active genes are tri-methylated at K4 of
histone H3. Nature 419, 407– 411
40. Bernstein, B. E., Humphrey, E. L., Erlich, R. L., Schneider, R.,
Bouman, P., Liu, J. S., Kouzarides, T., and Schreiber, S. L.
(2002) Methylation of histone H3 Lys 4 in coding regions of
active genes. Proc. Natl. Acad. Sci. U. S. A. 99, 8695– 8700
41. Rea, S., Eisenhaber, F., O’Carroll, D., Strahl, B. D., Sun, Z. W.,
Schmid, M., Opravil, S., Mechtler, K., Ponting, C. P., Allis, C. D.,
and Jenuwein, T. (2000) Regulation of chromatin structure by
site-specific histone H3 methyltransferases. Nature 406, 593–599
42. Fu, Q., McKnight, R. A., Yu, X., Callaway, C. W., and Lane, R. H.
(2006) Growth retardation alters the epigenetic characteristics of
hepatic dual specificity phosphatase 5. FASEB J. 20, 2127–2129
43. Fu, Q., McKnight, R. A., Yu, X., Wang, L., Callaway, C. W., and
Lane, R. H. (2004) Uteroplacental insufficiency induces site
specific changes in histone H3 covalent modifications and
affects DNA-histone H3 positioning in day 0 IUGR rat liver.
Physiol. Genomics 20, 108 –116
44. Simmons, R. A., Templeton, L. J., and Gertz, S. J. (2001)
Intrauterine growth retardation leads to the development of
type 2 diabetes in the rat. Diabetes 50, 2279 –2286
45. Tsirka, A. E., Gruetzmacher, E. M., Kelley, D. E., Ritov, V. H.,
Devaskar, S. U., and Lane, R. H. (2001) Myocardial gene
expression of glucose transporter 1 and glucose transporter 4 in
response to uteroplacental insufficiency in the rat. J. Endocrinol.
169, 373–380
46. (2002) Guiding principles for research involving animals and
human beings. Am. J. Physiol. 283, R281–283
47. Baserga, M., Hale, M. A., McKnight, R. A., Yu, X., Callaway,
C. W., and Lane, R. H. (2005) Uteroplacental insufficiency
alters hepatic expression, phosphorylation, and activity of the
FU ET AL.
 glucocorticoid receptor in fetal IUGR rats. Am. J. Physiol. 289,
R1348 –1353
48. Ke, X., Lei, Q., James, S. J., Kelleher, S. L., Melnyk, S., Jernigan,
S., Yu, X., Wang, L., Callaway, C. W., Gill, G., Chan, G. M.,
Albertine, K. H., McKnight, R. A., and Lane, R. H. (2006)
Uteroplacental insufficiency affects epigenetic determinants of
chromatin structure in brains of neonatal and juvenile IUGR
rats. Physiol. Genomics 25, 16 –28
49. Ke, X., McKnight, R. A., Wang, Z. M., Yu, X., Wang, L., Callaway,
C. W., Albertine, K. H., and Lane, R. H. (2005) Nonresponsive-
ness of cerebral p53-MDM2 functional circuit in newborn rat
pups rendered IUGR via uteroplacental insufficiency. Am. J.
Physiol. 288, R1038 –1045
50. Lan, F., Collins, R. E., De Cegli, R., Alpatov, R., Horton, J. R.,
Shi, X., Gozani, O., Cheng, X., and Shi, Y. (2007) Recognition
of unmethylated histone H3 lysine 4 links BHC80 to LSD1-
mediated gene repression. Nature 448, 718 –722
51. Ingolia, N. T., Ghaemmaghami, S., Newman, J. R., and Weiss-
man, J. S. (2009) Genome-wide analysis in vivo of translation
with nucleotide resolution using ribosome profiling. [E-pub
ahead of print] Science doi: 10.1126/science.1168978
52. Adamo, M. L., Ben-Hur, H., Roberts, C. T., Jr., and LeRoith, D.
(1991) Regulation of start site usage in the leader exons of the
rat insulin-like growth factor-I gene by development, fasting,
and diabetes. Mol. Endocrinol. 5, 1677–1686
53. Simmons, J. G., Van Wyk, J. J., Hoyt, E. C., and Lund, P. K.
(1993) Multiple transcription start sites in the rat insulin-like
growth factor-I gene give rise to IGF-I mRNAs that encode
different IGF-I precursors and are processed differently in vitro.
Growth Factors 9, 205–221
54. Foyt, H. L., Lanau, F., Woloschak, M., LeRoith, D., and Roberts,
C. T., Jr. (1992) Effect of growth hormone on levels of differentially
processed insulin-like growth factor I mRNAs in total and polyso-
mal mRNA populations. Mol. Endocrinol. 6, 1881–1888
55. Butler, A. A., Ambler, G. R., Breier, B. H., LeRoith, D., Roberts,
C. T., Jr., and Gluckman, P. D. (1994) Growth hormone (GH)
and insulin-like growth factor-I (IGF-I) treatment of the GH-
deficient dwarf rat: differential effects on IGF-I transcription
start site expression in hepatic and extrahepatic tissues and lack
of effect on type I IGF receptor mRNA expression. Mol. Cell.
Endocrinol. 101, 321–330
56. Adamo, M. L., Ma, X., Ackert-Bicknell, C. L., Donahue, L. R.,
Beamer, W. G., and Rosen, C. J. (2006) Genetic increase in
serum insulin-like growth factor-I (IGF-I) in C3H/HeJ com-
pared with C57BL/6J mice is associated with increased tran-
scription from the IGF-I exon 2 promoter. Endocrinology 147,
2944 –2955
57. Woelfle, J., Billiard, J., and Rotwein, P. (2003) Acute control of
insulin-like growth factor-I gene transcription by growth hor-
mone through Stat5b. J. Biol. Chem. 278, 22696 –22702
58. Zhang, J., Whitehead, R. E., Jr., and Underwood, L. E. (1997)
Effect of fasting on insulin-like growth factor (IGF)-IA and
IGF-IB messenger ribonucleic acids and prehormones in rat
liver. Endocrinology 138, 3112–3118
59. Siegfried, J. M., Kasprzyk, P. G., Treston, A. M., Mulshine, J. L.,
Quinn, K. A., and Cuttitta, F. (1992) A mitogenic peptide amide
encoded within the E peptide domain of the insulin-like growth
factor IB prohormone. Proc. Natl. Acad. Sci. U. S. A. 89, 8107– 8111
60. Chew, S. L., Lavender, P., Clark, A. J., and Ross, R. J. (1995) An
alternatively spliced human insulin-like growth factor-I tran-
script with hepatic tissue expression that diverts away from the
mitogenic IBE1 peptide. Endocrinology 136, 1939 –1944
61. Huang, H. S., and Akbarian, S. (2007) GAD1 mRNA expression
and DNA methylation in prefrontal cortex of subjects with
schizophrenia. PLoS ONE 2, e809
62. Fatemi, M., Pao, M. M., Jeong, S., Gal-Yam, E. N., Egger, G.,
Weisenberger, D. J., and Jones, P. A. (2005) Footprinting of
mammalian promoters: use of a CpG DNA methyltransferase
revealing nucleosome positions at a single molecule level.
Nucleic Acids Res. 33, e176
63. Liang, G., Lin, J. C., Wei, V., Yoo, C., Cheng, J. C., Nguyen, C. T.,
Weisenberger, D. J., Egger, G., Takai, D., Gonzales, F. A., and
Jones, P. A. (2004) Distinct localization of histone H3 acetyla-
tion and H3–K4 methylation to the transcription start sites in
the human genome. Proc. Natl. Acad. Sci. U. S. A. 101, 7357–7362
64. Demeny, M. A., Soutoglou, E., Nagy, Z., Scheer, E., Janoshazi,
A., Richardot, M., Argentini, M., Kessler, P., and Tora, L. (2007)
IUGR AFFECTS HEPATIC IGF-1 HISTONE CODE
Identification of a small TAF complex and its role in the
assembly of TAF-containing complexes. PLoS ONE 2, e316
65. Hardy, S., Brand, M., Mittler, G., Yanagisawa, J., Kato, S.,
Meisterernst, M., and Tora, L. (2002) TATA-binding protein-
free TAF-containing complex (TFTC) and p300 are both re-
quired for efficient transcriptional activation. J. Biol. Chem. 277,
32875–32882
66. Gerber, M., and Shilatifard, A. (2003) Transcriptional elonga-
tion by RNA polymerase II and histone methylation. J. Biol.
Chem. 278, 26303–26306
67. Hampsey, M., and Reinberg, D. (2003) Tails of intrigue: phos-
phorylation of RNA polymerase II mediates histone methyl-
ation. Cell 113, 429 – 432
68. Xiao, T., Hall, H., Kizer, K. O., Shibata, Y., Hall, M. C., Borchers,
C. H., and Strahl, B. D. (2003) Phosphorylation of RNA
polymerase II CTD regulates H3 methylation in yeast. Genes Dev.
17, 654 – 663
69. Schneider, R., Bannister, A. J., Myers, F. A., Thorne, A. W.,
Crane-Robinson, C., and Kouzarides, T. (2004) Histone H3
lysine 4 methylation patterns in higher eukaryotic genes. Nat.
Cell Biol. 6, 73–77
70. Alisi, A., Leoni, S., Piacentani, A., and Conti Devirgiliis, L.
(2003) Retinoic acid modulates the cell-cycle in fetal rat hepa-
tocytes and HepG2 cells by regulating cyclin-cdk activities. Liver
23, 179 –186
71. Pray-Grant, M. G., Daniel, J. A., Schieltz, D., Yates, J. R., 3rd, and
Grant, P. A. (2005) Chd1 chromodomain links histone H3
methylation with SAGA- and SLIK-dependent acetylation. Nature
433, 434 – 438
72. Sims, R. J., 3rd, and Reinberg, D. (2006) Histone H3 Lys 4
methylation: caught in a bind? Genes Dev. 20, 2779 –2786
73. Martin, D. G., Baetz, K., Shi, X., Walter, K. L., MacDonald, V. E.,
Wlodarski, M. J., Gozani, O., Hieter, P., and Howe, L. (2006)
The Yng1p plant homeodomain finger is a methyl-histone
binding module that recognizes lysine 4-methylated histone H3.
Mol. Cell. Biol. 26, 7871–7879
74. Howe, L., Auston, D., Grant, P., John, S., Cook, R. G., Workman,
J. L., and Pillus, L. (2001) Histone H3 specific acetyltransferases
are essential for cell cycle progression. Genes Dev. 15, 3144 –3154
75. Krogan, N. J., Dover, J., Wood, A., Schneider, J., Heidt, J.,
Boateng, M. A., Dean, K., Ryan, O. W., Golshani, A., Johnston,
M., Greenblatt, J. F., and Shilatifard, A. (2003) The Paf1
complex is required for histone H3 methylation by COMPASS
and Dot1p: linking transcriptional elongation to histone meth-
ylation. Mol. Cell 11, 721–729
76. Li, B., Howe, L., Anderson, S., Yates, J. R., 3rd, and Workman,
J. L. (2003) The Set2 histone methyltransferase functions
through the phosphorylated carboxyl-terminal domain of RNA
polymerase II. J. Biol. Chem. 278, 8897– 8903
77. Dehe, P. M., Dichtl, B., Schaft, D., Roguev, A., Pamblanco, M.,
Lebrun, R., Rodriguez-Gil, A., Mkandawire, M., Landsberg, K.,
Shevchenko, A., Rosaleny, L. E., Tordera, V., Chavez, S., Stewart,
A. F., and Geli, V. (2006) Protein interactions within the Set1
complex and their roles in the regulation of histone 3 lysine 4
methylation. J. Biol. Chem. 281, 35404 –35412
78. Tresaugues, L., Dehe, P. M., Guerois, R., Rodriguez-Gil, A.,
Varlet, I., Salah, P., Pamblanco, M., Luciano, P., Quevillon-
Cheruel, S., Sollier, J., Leulliot, N., Couprie, J., Tordera, V.,
Zinn-Justin, S., Chavez, S., van Tilbeurgh, H., and Geli, V.
(2006) Structural characterization of Set1 RNA recognition
motifs and their role in histone H3 lysine 4 methylation. J. Mol.
Biol. 359, 1170 –1181
79. Verkauskiene, R., Jaquet, D., Deghmoun, S., Chevenne, D.,
Czernichow, P., and Levy-Marchal, C. (2005) Smallness for
gestational age is associated with persistent change in insulin-
like growth factor I (IGF-I) and the ratio of IGF-I/IGF-binding
protein-3 in adulthood. J. Clin. Endocrinol. Metab. 90, 5672–5676
80. Isaksson, O. G., Jansson, J. O., Sjogren, K., and Ohlsson, C.
(2001) Metabolic functions of liver-derived (endocrine) insulin-
like growth factor I. Horm. Res. 55(Suppl. 2), 18 –21
81. Guler, H. P., Zapf, J., and Froesch, E. R. (1987) Short-term
metabolic effects of recombinant human insulin-like growth
factor I in healthy adults. N. Engl. J. Med. 317, 137–140
Received for publication November 12, 2008.
Accepted for publication March 19, 2009.
2449