J Periodont Res 2014; 49: 164–178 © 2013 John Wiley & Sons A/S.

All rights reserved Published by John Wiley & Sons Ltd

JOURNAL OF PERIODONTAL RESEARCH

doi:10.1111/jre.12090

Chantarawaratit1,2,
Acemannan sponges
P.
P. Sangvanich3, W. Banlunara4,
K. Soontornvipart5,

stimulate alveolar bone, P.

1
Thunyakitpisal6
Faculty of Dentistry, Dental Biomaterials
Program, Graduate School, Chulalongkorn

cementum and periodontal University, Bangkok, Thailand, 2Department of

Materials Science, Faculty of Science,
Chulalongkorn University, Bangkok, Thailand,
3

ligament regeneration in a
Department of Chemistry, Faculty of Science,
Chulalongkorn University, Bangkok, Thailand,
4
Department of Pathology, Faculty of
Veterinary Science, Chulalongkorn University,

canine class II furcation Bangkok, Thailand, 5Department of Surgery,

Faculty of Veterinary Science, Chulalongkorn
University, Bangkok, Thailand and 6Research

defect model Unit of Herbal Medicine and Natural Product for

Dental Application, Department of Anatomy,
Faculty of Dentistry, Chulalongkorn University,
Bangkok, Thailand

Chantarawaratit P, Sangvanich P, Banlunara W, Soontornvipart K,

Thunyakitpisal P. Acemannan sponges stimulate alveolar bone, cementum and
periodontal ligament regeneration in a canine class II furcation defect model.
J Periodont Res 2014; 49: 164–178. © 2013 John Wiley & Sons A/S. Published
by John Wiley & Sons Ltd

Background and Objective: Periodontal disease is a common infectious disease,

found worldwide, causing the destruction of the periodontium. The periodon-
tium is a complex structure composed of both soft and hard tissues, thus an
agent applied to regenerate the periodontium must be able to stimulate
periodontal ligament, cementum and alveolar bone regeneration. Recent studies
demonstrated that acemannan, a polysaccharide extracted from Aloe vera gel,
stimulated both soft and hard tissue healing. This study investigated effect
of acemannan as a bioactive molecule and scaffold for periodontal tissue
regeneration.
Material and Methods: Primary human periodontal ligament cells were treated
with acemannan in vitro. New DNA synthesis, expression of growth/differentia-
tion factor 5 and runt-related transcription factor 2, expression of vascular
endothelial growth factor, bone morphogenetic protein-2 and type I collagen,
alkaline phosphatase activity, and mineralized nodule formation were deter-
mined using [3H]-thymidine incorporation, reverse transcription–polymerase
chain reaction, enzyme-linked immunoabsorbent assay, biochemical assay and
alizarin red staining, respectively. In our in vivo study, premolar class II furca-
tion defects were made in four mongrel dogs. Acemannan sponges were applied
Pasutha Thunyakitpisal, Research Unit of
into the defects. Untreated defects were used as a negative control group. The Herbal Medicine and Natural Product for Dental
amount of new bone, cementum and periodontal ligament formation were eval- Application, Department of Anatomy, Faculty of
uated 30 and 60 d after the operation. Dentistry, Chulalongkorn University, Henri-
Dunant Rd, Patumwan, Bangkok 10330,
Results: Acemannan significantly increased periodontal ligament cell prolifera- Thailand
Tel: +66817133311
tion, upregulation of growth/differentiation factor 5, runt-related transcription Fax: +6622188870
factor 2, vascular endothelial growth factor, bone morphogenetic protein 2, type e-mail: pthunyak@yahoo.com
I collagen and alkaline phosphatase activity, and mineral deposition as com- Key words: acemannan; animal study; class II
pared with the untreated control group in vitro. Moreover, acemannan signifi- furcation defect model; periodontal ligament
cells; periodontal regeneration
cantly accelerated new alveolar bone, cementum and periodontal ligament
formation in class II furcation defects. Accepted for publication March 29, 2013

Conclusion: Our data suggest that acemannan could be a candidate biomolecule
for periodontal tissue regeneration.
Periodontal disease is a common
chronic infectious disease causing the
destruction of the periodontium: peri-
odontal ligament (PDL), alveolar
bone and cementum. Although con-
ventional scaling and root planing
therapy can halt the progression of
this disease, and results in an increase
in clinical periodontal attachment,
this treatment is only effective in the
early phase of the disease. Following
scaling and root planing, periodontal
tissue repair frequently results in a
widened PDL space and incomplete
regeneration of cementum and alveo-
lar bone (1). Therefore, the ultimate
goal of periodontal treatment is not
only to cease and prevent further peri-
odontal tissue destruction, but also to
regenerate the periodontal apparatus
(2,3).
Both anatomically and physiologi-
cally, the periodontium is a very com-
plicated organ containing both soft
tissue and hard tissue functioning
together to support the teeth in the
jaw. Therefore, the methods and
agents used in periodontal tissue
regeneration should stimulate all peri-
odontal tissue types. Polysaccharides
such as hyaluronic acid, chitosan, algi-
nate and pectin have been proposed
for use in tissue engineering and regen-
erative medicine (4–7). These natural
materials have demonstrated biocom-
patibility, biodegradability, immuno-
modulation, antimicrobial, wound
healing and osteogenic activities (4–8).
Thus, they have the potential to be
used as periodontal regenerative
agents. Polysaccharides can be pre-
pared in various forms such as gels,
films, beads, sponges and scaffolds
(4–7,9). Therefore, polysaccharides
could function as either active mole-
cules or scaffolds for periodontal
regenerative therapy.
Acemannan is a biodegradable poly-
saccharide composed of b-(1,4)-acety-
lated polymannose extracted from
Aloe vera gel. Acemannan has been
shown to stimulate gingival fibroblast,
Acemannan and periodontal regeneration
dental pulp fibroblast, cementoblast
and bone marrow stromal cell prolifer-
ation and differentiation in vitro (10–
13). In vivo, acemannan enhanced oral
ulcer and oral aphthous ulcer healing,
reparative dentin formation and bone
formation (10–12,14). Based on its
bioactivity in inducing soft and hard
tissue healing, acemannan is a candi-
date for use in periodontal tissue
regeneration. However, the effect of
acemannan on the regeneration of the
periodontium has not been investi-
gated. In this study, the effect of
acemannan on the proliferation of
periodontal ligament cells (PDLCs)
and their differentiation to hard tissue
forming cells was investigated. The
effect of acemannan sponges on new
PDL, alveolar bone and cementum
formation in a canine furcation defect
model was also evaluated.
Material and methods
Isolation and characterization of
acemannan
Aloe vera (A. barbadensis Miller) was
obtained from a local herbal supplier
in Thailand. Aloe vera was identified
by Assoc. Prof. Dr. Suchada Sukrong
(Department of Pharmacognosy and
Pharmaceutical Botany, Faculty of
Pharmaceutical Sciences, Chulalongk-
orn University). The specimen (no.
051101) was deposited in the Museum
of Natural Medicines, Faculty of
Pharmaceutical Sciences, Chulalongk-
orn University (Bangkok, Thailand).
Acemannan was isolated and char-
acterized as previously described with
some modifications (11,15). Briefly,
fresh mature Aloe vera leaves were
washed and the skin removed. The
Aloe vera parenchyma were washed in
running tap water for 30 min, and
soaked in distilled water for 30 min.
The parenchyma gels were blended
using a homogenizer and centrifuged
at 18,890 g for 60 min at 4°C. The
supernatant was collected and mixed
165
with absolute alcohol at a 1 : 3 ratio.
The precipitated white opaque parti-
cles were collected by centrifugation
at 12,090 g for 30 min at 4°C. After
lyophilization, the pellets were ground
and kept dry until use.
The molecular weight of the ground
powder was analyzed using high-
performance liquid chromatography
connected to a reflective index detector
(RID-10A; Shimadzu, Shimadzu Cor-
poration, Tokyo, Japan). The separa-
tion was performed with a Shodex
Sugar KS-804 column and compared
with Shodex standard P-82 (Showa
Denko K.K., Yokohama, Japan). The
monosaccharide compositions were
analyzed using gas chromatography-
mass spectroscopy and 13C-NMR spec-
troscopy as previously described
(16,17). The data obtained were compa-
rable to that of previous studies, indi-
cating that the polysaccharide extracted
from fresh Aloe vera gel was acemannan
(15–17). The yield of acemannan
extraction was approximately 0.2%.
Cell culture
All study protocols were approved by
the Human Research Ethics Commit-
tee of the Faculty of Dentistry, Chul-
alongkorn University. PDLCs were
isolated from third molars extracted
from healthy young donors. The teeth
were washed 3 9 with phosphate-
buffered saline (PBS). PDL tissue was
removed using sterile surgical blades
from the middle one-third of the root
surface to avoid gingival and apical
tissue contamination (18,19). The iso-
lated tissue was cut into 1–2 mm3
pieces, placed into 60 mm culture
dishes, and incubated with growth
medium (Dulbecco’s modified Eagle’s
medium supplemented with 10% fetal
bovine serum, 10,000 IU/mL penicil-
lin G sodium, 100,000 lg/mL strepto-
mycin sulfate, 25 lg/mL amphotericin
B and 1% L-glutamine) at 37°C, in an
atmosphere containing 5% CO2. The
growth medium was replaced every
166 Chantarawaratit et al.
other day. When the outgrown cells
reached confluence, the cells were sub-
cultured using 0.25% trypsin-EDTA
solution. All experiments were per-
formed using cells from the third to
the fifth passage. All cell culture
media were purchased from Gibco
BRLTM (InvitrogenTM, Grand Island,
NY, USA).
DNA synthesis assay
New DNA synthesis was investigated
using an [3H]-thymidine incorporation
assay (20). Briefly, PDLCs (5 9 104
cells/well) were seeded into 24-well
cell culture plates and cultured in
growth medium for 16 h. The growth
medium was then removed and the
cells were cultured in serum-free
growth medium for 3 h, and treated
with 0.25, 0.5, 1.0, 2.0 or 4.0 mg/mL
acemannan for 24 h. After 20 h, the
cells were labeled with 0.25 lCi/well
of [3H]-thymidine (Amersham Bio-
sciences, Little Chalfont, UK). Cells
treated with the same volume of med-
ium without acemannan served as a
control group. After 24 h, the cells
were washed 3 9 with PBS, fixed with
10% trichloroacetic acid, washed with
5% trichloroacetic acid twice, and sol-
ubilized in 0.5 M NaOH overnight.
After neutralization with 0.5 M HCl,
the lysate was thoroughly mixed with
2 mL of scintillation fluid (Opti-
PhaseHiSafe; Fisher Scientific, Milton
Keynes, UK). The amount of beta
radiation was determined using a
liquid scintillation counter (Wallac,
Turku, Finland). The assay was
carried out in three independent
experiments.
RNA isolation and RT-PCR analysis
PDLCs were cultured in osteogenic
medium (growth medium supple-
mented with 50 lg/mL L-ascorbic acid,
10 mM glycerophosphate, and 100 nM
dexamethasone) with acemannan at
the concentrations described above for
24 h. Cells treated with osteogenic
medium without acemannan were
included as a control group. After
24 h, total cellular RNA was collected
(Total RNA mini kit; Geneaid, Taipei,
China). Total RNA (5 lg) was
converted to cDNA. Then the target
cDNA was amplified (Prime RT Pre-
mix and Prime Taq Premix; Genet Bio,
Chungnam, Korea). The sense and
antisense primer sequences used for
GAPDH, growth/differentiation factor
5 (GDF-5) and runt-related transcrip-
tion factor 2 (Runx2) are shown in
Table 1.
The amplification cycles were com-
posed of 94°C for 30 s, 56°C for 30 s
and 72°C for 1 min. After 30 cycles,
the PCR products were separated by
electrophoresis on 1.5% agarose gel
(570 bp for GDF-5, 229 bp for
Runx2 and 307 bp for GADPH).
Vascular endothelial growth factor,
bone morphogenetic protein 2 and
type I collagen measurement
Vascular endothelial growth factor
(VEGF), bone morphogenetic protein
2 (BMP-2), and type I collagen levels
were measured according to the
manufacturers’ instructions (VEGF
and BMP-2; R&D Systems, Minne-
apolis, MN, USA; type I collagen;
Takara Bio Inc., Shiga, Japan).
Briefly, PDLCs (5 9 104 cells) were
seeded in 24-well plates and grown
to 80% confluence. Then the
medium was replaced by osteogenic
medium containing the same concen-
trations of acemannan as described
above. Cells treated with medium
without acemannan were included as
a control group. Culture supernatant
was collected for VEGF, BMP-2 and
type I collagen level determination.
The sensitivities of the ELISA kits
for VEGF, BMP-2 and type I colla-
gen are 5 pg/mL, 11 pg/mL and
10 ng/mL, respectively. The assay
was carried out in three independent
experiments.
Table 1. Nucleotide sequence of sense and antisense primers of GAPDH, GDF-5 and
Runx2
Gene Company name Primer
GAPDH Bio Basic Inc. forward
reverse
GDF-5 Sigma Genosys forward
reverse
Runx2 Bio Basic Inc forward
reverse
Alkaline phosphatase activity assay
PDLCs were prepared and treated
with acemannan as described above.
Alkaline phosphatase (ALPase) activ-
ity was determined after 72 h. The
cells were washed 3 9 with PBS, and
incubated with glycine buffer (100 mM
glycine, 2 mM MgCl2, pH 10.5) con-
taining 0.35 mg/mL p-nitrophenyl-
phosphate (Sigma-Aldrich, St. Louis,
MO, USA) at 30°C for 30 min. The
reaction was terminated with 1 M
NaOH. ALPase activity was reported
in terms of p-nitrophenol production
which was measured at 405 nm and
normalized to total cellular protein
(nmol p-nitrophenol/min per lg) (21).
Mineralization staining
PDLCs were prepared and treated
with acemannan as described above.
Mineral deposition by cultured
PDLCs was determined by alizarin
red (AR) staining after 9 and 18 d.
The cells were washed 3 9 with PBS,
fixed with 70% ethanol, and stained
with 2% AR (pH 4; Wako Pure
Chemical Industries, Osaka, Japan).
After photographing the staining
results, the stained mineral nodules
were destained with 100 mM cetylpy-
ridinium chloride for 15 min. The
absorbance of the released stain was
measured at 570 nm (12,22).
Preparation of acemannan sponges
Acemannan sponges were prepared by
direct lyophilization as previously
described (23). Briefly, 5% and 10%
acemannan solutions (w/v) were fro-
zen at 80°C for 16 h, lyophilized for
16 h and exposed to ultraviolet light
for 1 h. The 5% and 10% acemannan
GTCATCCATGACAACTTTGG
GGAAGGCCATGCCAGTGACG
CTCCTCACTTTCTTGCTTTGG
CCTCCAACTTCACGCTGCTGT
TCTTCACAAATCCTCCCC
TGGATTAAAAGGACTTGGTG

solutions generated 10 mg and 20 mg
acemannan sponges, respectively. The
sponges were kept in a desiccator at
room temperature until used.
Scanning electron microscopy and
pore size analysis
Acemannan sponges were sputter coated
with gold-palladium and analyzed under
scanning electron microscopy (SEM;
JSM-5410LV; JEOL, Tokyo, Japan).
Samples were analyzed in both longitu-
dinal and transverse planes. Thirty pores
were randomly selected. Pore diameter,
circularity and pore size were mea-
sured using the IMAGE PRO-PLUS pro-
gram, version 6.0 (MediaCybernetics,
Rockville, MD, USA). Because the
pore shapes were predominantly ellip-
tical, the pore diameter was calcu-
lated by the average of the longest
and shortest axis of each pore. Circu-
larity was the ratio between the short-
est and the longest axis of each pore
(24).
Biocompatibility evaluation
According to ISO, both extract test
and direct contact assays were used as
in vitro cytotoxicity tests (25,26). For
the extract test, acemannan sponges
were incubated in growth medium
(1 sponge/2 mL) at 37°C with gentle
agitation. The conditioned media were
collected at 1 and 3 d of immersion.
PDLCs (5 9 104 cells) were seeded
in 24-well plates and incubated until
80% confluent. The growth medium
was removed and the cells were washed
with PBS. The cells were then incu-
bated with conditioned media for 72 h.
Cells incubated with growth medium
were used as a control group. Subse-
quently an 3-[4,5-dimethylthiazol-2-
yl]-2,5-diphenyl tetrazolium bromide
(MTT) viability test was performed as
described (27). Briefly, the cells were
washed twice with PBS and incubated
with 0.5 mg/mL MTT solution for
10 min. The formazan crystals were
dissolved in dimethyl sulfoxide and the
optical density was determined by
measuring the light absorbance at
570 nm. The background absorbance
of dimethyl sulfoxide was subtracted
from the sample absorbance (26).
Acemannan and periodontal regeneration
For the direct contact assay,
sponges were soaked in growth med-
ium for 4 h. Then the sponges were
placed in center of each well in 12-
well culture plates. PDLCs (8 9 104)
were seeded around the sponges. Cell
morphology was observed under the
phase contrast microscope at 0, 4, 24,
48 and 72 h after seeding (25).
In vivo study
Four young adult mongrel dogs (12 mo
of age) were obtained from the Faculty
of Veterinary Science, Chulalongkorn
University, Bangkok, Thailand. The
protocol for the animal study was
approved by the Animal Ethics Com-
mittee of the Faculty of Veterinary
Science, Chulalongkorn University.
The animals were adapted to a 12-h
light/12-h dark cycle for 2 wk before
the operation. During the experiment,
the animals had access to food and
water ad libitum. Two weeks before
the operation, all subjects received
scaling and root planing. Cefazolin
(first generation cephalosporin) 25
mg/kg IV was used for pre-
operative antibiotics prophylaxis.
Sedation was achieved using propofol
1–4 mg/kg and maintained with iso-
flurane (2% in 100% oxygen). The
operation area was locally anesthe-
tized using 2% lidocaine with
1 : 100,000 norepinephrine.
Class II furcation defects were cre-
ated in the furcation areas of the
maxillary and mandibular second and
third premolars (P2 and P3) of each
dog for a total of 32 defects (28,29).
Briefly, a mucoperiosteal flap was
raised. The alveolar crest in the
furcation area was vertically reduced
5 mm from the cemento-enamel junc-
tion using atraumatic osteotomy. The
mesial and distal roots served as
the mesial and distal walls of the
defect, respectively. The bucco-lingual
depth of the defect was approximately
two-thirds the diameter of the tooth
crown. The average width and depth
of the defects was 5 and 3 mm,
respectively. All PDL tissue and
cementum were removed from the
root surface of the defect area using
a curette. Reference notches were
placed in the mesial and distal roots
167
at the base of the defect using a
0.25 mm diameter round bur
(Fig. 1A).
In each dog, the defects randomly
received one of the following treat-
ments: (i) blood clot in an untreated
defect (negative control); (ii) 10 mg
acemannan sponge (5% w/v); (iii)
20 mg acemannan sponge (10% w/v);
and (iv) sham/no operation as a refer-
ence of the normal anatomy of the
periodontium. The flap was reposi-
tioned and sutured with absorbable
sutures (FSSB, Jestetten, Germany).
The animals received postoperative
antibiotic and analgesic treatment
twice a day using cefazolin 12.5 mg/kg
and carprofen 2.2 mg/kg, respectively.
Two dogs were killed 30 and 60 d
after the operation. Jaw blocks of the
premolar regions, including bone, teeth
and soft tissue, were removed, fixed in
10% neutral formalin buffer, and
demineralized with 4% nitric acid in
10% neutral formalin buffer. Tissue
dehydration was carried out using
ethanol–acetone dehydration and sam-
ples were routinely embedded in paraf-
fin. Five micrometer sections were
prepared from each tissue block in a
lingual–buccal direction.
Histomorphometric analysis
Histomorphometric analysis was per-
formed following the method of
Kosen et al. (30) with some modifica-
tions. Five sections were selected from
each specimen. The first section was
from the mid-point of the furcation
defect and the rest were obtained
every 120 lm in a buccal direction
from the initial section. The selected
sections were stained with hematoxy-
lin and eosin and photographed using
the OLIVIA program (Olympus, Tokyo,
Japan).
The following five histomorphomet-
ric measurements were determined for
each stained section using the IMAGE
PRO-PLUS program, version 6 (Media-
Cybernetics, Rockville, MD, USA)
(Fig. 1C).
1. Defect area: the total area from
the furcation to the apical border
of the notches on the mesial and
distal roots.
168 Chantarawaratit et al.

A B with the untreated group (Fig. 2B).

Acemannan also significantly increased
the mRNA level of GDF-5. Aceman-
nan at 1 mg/mL showed the maximum
effect, an approximately 1.48-fold
increase compared with the negative
control group (Fig. 2C).
C
Acemannan enhanced vascular
endothelial growth factor, type I
collagen and bone morphogenetic
protein 2 expression

After 24 h of incubation, acemannan

at concentrations of 2 and 4 mg/mL
significantly increased the expression
of VEGF 1.93- and 1.72-fold, respec-
tively, compared with the control
D group, while slightly increasing the
expression of BMP-2 and type I colla-
gen. However, after 48 and 72 h,
acemannan significantly enhanced
expression of type I collagen and
BMP-2, respectively, compared with
Fig. 1. Class II furcation defect. Schematic illustration of the class II furcation defects (A). the control group. Acemannan exhib-
A defect created at the premolar furcation area (B). Histomorphometric measurements ited a dose-dependent upregulation of
performed in hematoxylin and eosin sections (C). The formulas used to calculate new type I collagen and BMP-2. Aceman-
cementum formation, new bone formation, and PDL length (D). (a) New bone; (b) defect nan at concentrations of 2 and 4 mg/
length; (c, d) new cementum; and (e, f) new PDL. PDL, periodontal ligament. mL exhibited the maximum effect on
BMP-2 and type I collagen expres-
sion, respectively (Fig. 3).
2. New bone: the percentage of newly multiple comparisons were performed
formed alveolar bone area in rela- in this study. Values of p < 0.05 were
Acemannan stimulated alkaline
tion to the defect area (a). considered as statistically significant.
phosphatase activity and mineral
3. Defect length: the length of the
deposition
root surface located between the
Results
notches on the mesial and the dis- After 72 h of treatment, acemannan at
tal roots (b). concentrations of 2 and 4 mg/mL sig-
Acemannan-induced periodontal
4. New cementum: the percentage of nificantly enhanced PDLC ALPase
ligament cell proliferation and
the length of the newly formed activity 1.39- and 1.63-fold, respectively
mRNA expression of runt-related
amorphous substance, cementoid- (Fig. 4A). AR staining indicated that,
transcription factor 2 and growth/
like tissue or cementum-like tissue by 9 and 18 d, acemannan induced
differentiation factor 5
on the root surface in relation to mineral deposition by PDLCs. More
the defect length (c, d). The [3H]-thymidine incorporation intense AR staining was observed in
5. New PDL length: the percentage assay showed that after 24 h, aceman- the acemannan-treated groups com-
of the length of fibrous tissue nan at concentrations of 2 and 4 mg/ pared with the negative control group.
between newly formed cementum mL significantly increased new DNA The increase in mineralized nodules
and alveolar bone in relation to synthesis in PDLCs compared with occurred in a dose-dependent manner.
the defect length (e, f). the negative control group (p < 0.05; The greatest mineralization was
Fig. 2A). Acemannan at a concentra- observed at a concentration of 4 mg/
tion of 4 mg/mL exhibited the maxi- mL (Fig. 4B and 4C).
Statistical analysis
mum effect on DNA synthesis, which
The data were collected and analyzed was approximately three-fold that of
Characterization and
using the SPSS program for Windows, the untreated group.
biocompatibility of acemannan
version 17.0 (SPSS, Chicago, IL, Acemannan at concentrations of 1, 2
sponges
USA). The results were expressed as and 4 mg/mL significantly upregulated
mean  standard error. One-way the mRNA level of Runx2 1.18, 1.17 SEM evaluation revealed that the
analysis of variance and Dunnett and 1.25-fold, respectively, compared concentration of acemannan used in
 Acemannan and periodontal regeneration 169

A and proliferated around, the aceman-

nan sponges (Fig. 5C).

Acemannan-induced periodontal
regeneration in a class II furcation
defect model

Following surgery, all dogs recovered

uneventfully and gained weight over
the experimental period (data not
shown). The animals were examined
for inflammation and foreign body
B
interaction 30 and 60 d after the oper-
ation, and neither was detected in
either control or acemannan-treated
groups.
Histological analysis revealed that
30 d after treatment, the defects were
partly filled with alveolar bone. The
negative control and acemannan-
treated groups all demonstrated new
alveolar bone, cementum and PDL
formation (Fig. 6A–C). These tissues
extended from the pre-existing bone,
cementum and PDL at the base of the
defect. However, the amount of new
C
bone and cementum was much greater
in the acemannan-treated groups than
in the control group. Serial histologi-
cal sections demonstrated that bone
formation progressed from the mid-
point of the furcation defect in a buc-
cal direction. Sixty days post-surgery,
all groups demonstrated more alveo-
lar bone, cementum and PDL forma-
tion than that seen after 30 d
(Fig. 6D–F). Marked periodontal
regeneration, including new bone,
cementum, and PDL, was detected in
the acemannan-treated groups.
Examining the newly formed bone
Fig. 2. Acemannan-induced PDLC proliferation and the Runx2 and GDF-5 mRNA
at 30 d post-surgery more closely
expression in PDLCs after 24 h. Acemannan significantly enhanced PDLC proliferation at
revealed woven bone with narrow tra-
concentrations of 2 and 4 mg/mL (A). Acemannan at concentrations of 1, 2 and 4 mg/mL
significantly upregulated mRNA expression of Runx2 (B). Acemannan at concentrations
beculae lined with osteoblasts. The tra-
of 0.25, 0.5, 1, 2 and 4 mg/mL significantly upregulated mRNA level of GDF-5 (C). GAP- beculae contained irregularly arranged
DH served as internal control. *Compared with the untreated group; p < 0.05, n = 3. osteocytes (Fig. 7A–C). Sixty days
GDF-5, growth/differentiation factor 5; PDLC, periodontal ligament cell; Runx2, runt- post-surgery, more new lamellar bone
related transcription factor 2. formation containing osteons and
Haversian canal patterns was observed
in the control and acemannan-treated
the preparation of acemannan sponges assay and direct contact assay results groups (Fig. 7D–F). Thin cellular
determined their pore diameter and indicated that the acemannan sponges cementum and cementoid-like tissue
pore size. Increased concentration of were biocompatible with PDLCs. The partially covered the root surface after
acemannan resulted in larger pore acemannan sponge extracts signifi- 30 d (Fig. 8A, a–c). The newly formed
diameters and pore areas (Fig. 5A). cantly enhanced cell proliferation com- PDL was characterized by a cell-rich
The pore geometry of both the 5% pared with the control group (Fig. 5B). and vascularized dense connective
and 10% acemannan sponges was Moreover, the direct contact test tissue between the root surface and
generally elliptical (Table 2). The MTT showed that PDLs migrated towards, new bone. The PDL fibers were loose,
170 Chantarawaratit et al.

A control group at 30 and 60 d post-

implantation (Fig. 9A). Acemannan
also significantly induced cementum
and PDL formation after 60 d of
treatment (Fig. 9B and 9C). At 60 d
post-surgery, the values of new bone,
cementum, and PDL length formation
found in the 10 mg acemannan
sponge-treated group were slightly
higher than those of the 20 mg group.

Discussion
Tissue engineering and regenerative
B medicine in combination with peri-
odontal therapy can be used to over-
come the limitations of conventional
treatment and regenerate new peri-
odontal tissue. The PDL is a fibrous
connective tissue connecting the alve-
olar bone and tooth root cementum.
In addition to anchoring the teeth
in the jaw, the PDL is a key contribu-
tor of the cells involved in periodon-
tal regeneration (31). Many studies
have demonstrated that the PDL con-
tains stem cells that participate in
C periodontal tissue homeostasis and
regeneration. These cell populations
contain progenitors of the fibroblast
and osteoblast/cementoblast cell lin-
eages, which are involved in periodon-
tium regeneration. Under suitable
inductive conditions, PDLCs prolifer-
ate and differentiate to osteoblast-like
and cementoblast-like cells, express
bone-associated protein markers and
generate mineralized nodules and
ectopic hard tissue (32,33). These data
suggest that PDLCs have the poten-
tial to regenerate all types of peri-
Fig. 3. Acemannan promoted the expression of VEGF, type I collagen, and BMP-2. (A)
Acemannan significantly induced VEGF expression at 24 h, (B) type I collagen at 48 h
odontal tissues.
and (C) BMP-2 at 72 h. *Compared to the untreated group; p < 0.05, n = 3. BMP-2, bone
In the present study, acemannan
morphogenetic protein 2; VEGF, vascular endothelial growth factor. functioned as a bioactive molecule,
stimulating PDLC proliferation, expres-
sion of Runx2, GDF-5, BMP-2,
poorly organized and irregularly orien- (8B, d–f). However, the PDL space of VEGF, type I collagen, ALPase activ-
tated (Fig. 8B, a–c). Sharpey’s fibers all groups was wider than that of the ity, and mineral deposition. Runx2 is
inserted into both the new cementum pre-existing space. a transcription factor considered to
and alveolar bone were observed in The histomorphometric analysis be a regulator of osteoblast/cemento-
some specimens by 30 d after the oper- indicated that the application of blast differentiation and function
ation (Fig. 8B, b). At 60 d post- acemannan to the furcation defects (34,35). BMP-2, GDF-5 and VEGF
treatment, the width and length of the induced greater periodontal tissue are important growth factors for peri-
cementum in the acemannan-treated regeneration than in the control group odontal tissue healing and regenera-
groups was greater than that of the (Fig. 9). There were significant differ- tion. BMP-2 is one of the most potent
untreated group (8A, d–f). The PDL ences in the mean percentage of new growth factors inducing osteogenic/
fibers were denser and better organized bone formation between the aceman- cementogenic differentiation (36–38).
compared with the specimens at 30 d nan-treated groups and untreated GDF-5 has been demonstrated
 Acemannan and periodontal regeneration 171

A B

Fig. 4. Acemannan increased ALPase activity and mineral deposition. Acemannan significantly enhanced periodontal ligament cell
ALPase activity after 72 h of incubation at concentrations of 2 and 4 mg/mL (A). *denotes statistical difference with the untreated group;
p < 0.05, n = 3. Acemannan increased periodontal ligament cell mineral deposition at 9 and 18 d (B, C). The 0.5, 1, 2 and 4 mg/mL
acemannan-treated groups had larger and more intensely stained areas than the untreated group. By quantitative alizarin red staining, the
0.5, 1, 2 and 4 mg/mL acemannan-treated groups significantly promoted mineralization. *,#Compared with the untreated group at the 9th
and 18th day of incubation, respectively, p < 0.05, n = 9. ALPase, alkaline phosphatase.

to stimulate PDL development, new
cementum formation and bone regen-
eration (39,40). GDF-5 and its recep-
tor have been detected in PDLCs
(41). Intrabony defects treated with
BMP-2 or GDF-5 exhibited enhanced
periodontal healing/regeneration with
new alveolar bone, cementum and
PDL formation (37,39,42). VEGF has
been shown to induce angiogenesis by
increasing endothelial cell prolifera-
tion and migration (43). BMP-2 and
VEGF have been observed to stimu-
late dental follicle cells to differenti-
ate toward an osteoblast/cementoblast
phenotype (44,45). Therefore, aceman-
nan may accelerate periodontal tissue
healing/regeneration by stimulating
PDLC expression of BMP-2, GDF-5
and VEGF.
In addition to enhanced growth
factor synthesis, acemannan induced
the expression of type I collagen,
ALPase activity and mineral deposi-
tion by PDLCs. Type I collagen is the
predominant extracellular matrix pro-
tein in the PDL, cementum and alveo-
lar bone (46,47), providing physical
support and acting as a template
for mineral deposition in hard tissue.
172 Chantarawaratit et al.

ALPase is an osteogenic/cementogenic ity in periodontal tissues correlated unique characteristic of hard tissue
differentiation early phase marker with periodontal tissue regeneration forming cells. Our data suggest that
(48). Increased levels of ALPase activ- (49,50). Mineral deposition is a acemannan can induce extracellular
matrix synthesis and the differenti-
Table 2. Characteristic of the sponge pores
ation of PDLCs into hard tissue
Parameters 5% Acemannan sponge 10% Acemannan sponge forming cells, osteoblasts and ce-
mentoblasts, which generate bone and
Pore diameter (lm) 167.95  36.17 189.35  69.42 cementum, respectively.
Circularity 0.72  0.16 0.58  0.2
Although our in vitro results indi-
Pore size/area (lm2) 1.843E4  7.105E3 2.7552E4  1.9867E4
cated acemannan induced PDLC

A B
a b

c d

C
a b c

d e f

Fig. 5. Scanning electron microscopy analysis of the 5% (a, c) and 10% (b, d) acemannan sponges. Note the increased pore size in the
10% sponges (A). The acemannan sponge extracts significantly increased periodontal ligament cell proliferation (MTT assay) *Compared
with the untreated group; p < 0.05, n = 3. (B). Acemannan sponge biocompatibility with periodontal ligament cell. Direct contact test of
the 5% (a–c) and 10% (d–f) acemannan sponges was analyzed via the phase contrast microscope at 0 (a, d), 24 (b, e), and 72 h (c, f) after
seeding. #Sponge (C).
 Acemannan and periodontal regeneration 173

A B C gests that an acemannan sponge could

function in vivo by inducing PDLC
proliferation and activity and act as a
scaffold permitting PDLC infiltration
and growth.
Currently, the precise molecular
mechanisms governing the effects
of acemannan on cellular activity
remain unknown. Based on its struc-
ture, sugar composition and molecu-
lar weight, acemannan could bind to
a specific cell surface receptor and
then initiate downstream intracellular
signaling pathways to stimulate prolif-
eration and differentiation. Aceman-
nan induced the phosphorylation of
p38 mitogen-activated protein kinase
(MAPK) in dental pulp cells. Preincu-
D E F
bation with the specific p38 MAPK
inhibitor SB203580 resulted in a 50%
decrease in the phosphorylation level
of p38 MAPK as compared with the
acemannan-treated group (52). Peri-
odontal ligament cell proliferation,
gene expression, osteogenic differenti-
ation, and mineralization have all
been shown to be regulated by p38
MAPK (53). Therefore, acemannan
may activate periodontal ligament cell
proliferation and differentiation via
the MAPK pathway. Another possi-
ble pathway is via acemannan binding
to the mannose receptor. The man-
nose receptor family is composed of
Endo180 (CD280), the M-type phos-
pholipase A2 receptor, and the DEC-
205/gp200-MR6 subfamily. These
Fig. 6. Histology of periodontal regeneration in class II furcation defects at 30 d (A–C) receptors contain C-type lectin-like
and 60 d (D–F) post-surgery of control group (A, D), 10-mg acemannan sponge group (B, domains that recognize mannose,
E) and 20-mg acemannan sponge group (C, F). At both time points the sponge-treated fructose or N-acetylglucosamine at
groups showed more new bone and cementum formation than the control group. NB, new the end of a polysaccharide chain
bone; PB, pre-existing bone; black arrowhead, new cementum; white arrowhead, pre-exist- (54,55). After binding, the ligand–
ing cementum; white arrow, the apical limit of the defect. Scale bar = 500 lm. receptor complex is internalized and
subsequently releases the ligands
inside the cell. To better understand
activity, which could lead to periodon- diameter range is suitable for PDLC the molecular mechanisms of aceman-
tal tissue regeneration, acemannan in attachment and growth (51). After nan activity, future study is required.
solution may not be appropriate for being inserted into a periodontal In periodontal disease, the involve-
applying to periodontal pockets to defect, an acemannan sponge would ment of a furcation defect is consid-
induce periodontal regeneration because absorb and maintain serum or inter- ered a complex and severe condition,
in solution acemannan would be stitial fluid from the surrounding tis- causing extensive and rapid attach-
diluted by crevicular fluid. Because of sue, which is enriched with growth ment loss and tooth loss. The success
its physical properties as a polysac- factors and nutrients that promote tis- of furcation defect treatment is often
charide, acemannan can be prepared sue healing. We found that aceman- limited (56,57). To demonstrate the
as a sponge. SEM analysis revealed nan sponges were biocompatible and effect of acemannan on periodontal
acemannan sponges contained inter- exhibited biological activity as shown regeneration, an in vivo class II furca-
connected pores with diameters rang- by their ability to stimulate PDLC tion defect model was chosen. An
ing from 100 to 260 lm. This migration and proliferation. This sug- advantage of a class II furcation
174 Chantarawaratit et al.
A B
D E
Fig. 7. Histology of bone regeneration in class II furcation defects at 30 d (A–C) and 60 d
(D–F) post-surgery of control groups (A, D), 10-mg acemannan sponge groups (B, E) and
20-mg acemannan sponge groups (C, F). At 30 d of treatment, newly formed woven bone
was observed, while at 60 d, a more mature bone pattern containing osteons was found.
NB, new bone; PB, pre-existing bone.
defect model is that it limits the severe
gingival recession problems often
found in class III furcation defect
models. Severe gingival recession can
result in the loss of test material from
the defect and exposure of the defect
area leading to microbial contamina-
tion (58). However, class II furcation
defect models still have limitations in
their use in periodontal regeneration
C this, we employed criteria used in a
F sponges were prepared and placed in
studies. The lingual wall of a class II
defect is in contact with intact alveolar
bone, cementum and PDL, which is
not the case in a class III defect. Con-
sequently, the lingual defect area has a
greater healing rate than the buccal
area. Sectioning along the mesiodistal
plane of class II furcation defects may
lead to some difficulties in interpreting
the histological results. To account for
previous study to select the sections to
be examined (30). In a buccal direc-
tion beginning at the midsection, a
section every 120 lm of each defect
was selected and measured. The mean
of the histomorphometric results
obtained from each distance was used
in the statistical analysis.
A study by Jittapiromsak et al.,
reported that a dose of 300–600 lg
acemannan was effective as a direct
pulp capping material for a pinpoint
pulpal exposure area of 1 mm2 (12,59).
The volume of the class II furcation
defects in the present study was
37 mm3. For use in a three-dimen-
sional defect, we calculated that the
appropriate amount of acemannan
sponge per defect should be 11–22 mg.
Therefore, 10 and 20 mg acemannan
the defects. To minimize the effect of
bone density variations between the
upper and lower jaw, and between
each animal, every group was repre-
sented in each jaw of each animal. In
this preliminary study, a convenient
sample of dogs and defects was used to
evaluate the effect of acemannan on
periodontal regeneration in canines.
Histomorphometric analysis revealed
that in all groups, more bone than
cementum was regenerated. This may be
because cementum has no direct blood
supply, lymphatic drainage or innerva-
tion. Thus, cementum lacks sources of
important factors for remodeling, repair
and regeneration as compared with
bone, which contains a blood supply
system. Consequently, cementum repair
and regeneration is lower and more
unpredictable than bone regeneration
(20,60,61). In our histological evalua-
tion, the new cementum, which covered
the denuded root dentin surface, exhib-
ited various patterns; amorphous eosin-
ophilic substance, cementoid-like tissue
and cellular cementum. This finding
corresponds to a previous report (62).
Ankylosis is the pathological fusion
between tooth root and alveolar bone.
Our study did not reveal any instances
of ankylosis in either the control or
experimental groups. Ankylosis has
been proposed to be caused by an
imbalance between new alveolar bone
and periodontal tissue formation,
 Acemannan and periodontal regeneration 175

Aa b c unclear, this phenomenon is com-

monly seen, indicating a weak cohesion
between cementum and dentin (58,
65–67). The formation of a smear layer
on the surgically denuded dentin sur-
face before new cementum synthesis
has been proposed as its cause (66,67).
Electron microscopy revealed the
smear layer as an electron-dense, gran-
ular and non-collagenous layer present
between these tissues (65,68). This
smear layer can inhibit the reattach-
ment between newly formed cementum
and dentin. Another possible cause of
d e f slit formation is tissue shrinkage dur-
ing the paraffin sectioning process that
can break the weak attachment
between these two tissues (66). Recent
studies have shown that bone sialopro-
tein and osteopontin play a role in
adhesion between these two tissues
(69,70).
Currently, a number of bioactive
substances and techniques have been
introduced as clinical periodontal regen-
eration therapies such as GEM21,
EMDOGAIN and guided tissue
regeneration (65,66,71–74). GEM21 is
Ba b c a mixture of recombinant human
platelet derived growth factor BB
and beta-tricalcium phosphate, while
EMDOGAIN is a purified extract of
porcine enamel matrix proteins, lar-
gely consisting of amelogenin. Guided
tissue regeneration is a technique that
d e f uses membranes as a barrier to sup-
port the ingrowth of periodontal tis-
sue and inhibit the invasion of
gingival epithelium in to the periodon-
tal defect. There have been many mod-
ifications made to the membrane,
including gene, protein or cell therapy
Fig. 8. Histology of cementum and PDL regeneration in class II furcation defects at 30 d approaches. All of these materials have
(a–c) and 60 d (d–f) post-surgery of control groups (a, d), 10-mg acemannan sponge been reported as successful in animal
groups (b, e), and 20-mg acemannan sponge groups (c, f). The width and length of the and clinical periodontal regeneration
cementum in the acemannan-treated groups was greater than that of the untreated group studies (71,72).
(A). At 60 d post-surgery, the PDL fibers were denser and more organized at 30 d post- Based on the source and composi-
surgery (B). NB, new bone; PB, pre-existing bone; NC, new cementum; PC, pre-existing
tion of acemannan, the sponges may
cementum; PDL, PDL space; D, dentin; black arrow, Sharpey’s fibers; white arrow, the
be an alternative biomaterial for
apical limit of the defect. Scale bar = 50 lm.
patients who wish to avoid the use of
recombinant protein or have restric-
which impairs or hinders periodontal can stimulate both soft and hard tissue tions on the source of a material.
regeneration. In vivo, ankylosis is asso- regeneration (10–14,63,64). Moreover, in sponge form, aceman-
ciated with the application of recombi- In some of our samples, we found a nan is easy to insert into periodontal
nant human BMP-2. The possible small space, known as slit formation, defects. An acemannan sponge can be
explanation is that BMP-2 is strongly located between newly formed cemen- conveniently combined with various
osteoinductive with low periodontal tum and denuded dentin. Although the types of periodontal surgery tech-
regeneration activity, while acemannan mechanism of slit formation is still niques. Unlike a solution or gel, an
176 Chantarawaratit et al.

A inflammation and tissue destruction as

occurs in periodontal defects. To con-
firm our data and verify its clinical
applicability, further in vivo studies of
acemannan in bacteria-induced peri-
odontal defects should be performed.

Conclusion
In conclusion, acemannan increased
PDLC proliferation, growth factor and
extracellular matrix synthesis, differen-
B tiation and mineralization in vitro,
and enhanced periodontal regeneration
in class II furcation defects. Taken
together, our data suggest that ace-
mannan could be a candidate herbal
biomolecule for periodontal tissue
regeneration.

Acknowledgements
We thank Professor Dr. Visaka Lim-
wong, Associate Professor Dr. Dolly
C Methatharathip, and Dr. Kevin A.
Tompkins for their valuable sugges-
tions. This work was supported by the
Higher Education Research Promotion
and National Research University Pro-
ject of Thailand (AS549A), Thailand
Government Research Fund, Develop-
ing Research Unit in Herbal Medicine
for Oral Tissue Regeneration Fund,
and the 90th Anniversary of Chul-
alongkorn University Fund (Ratcha-
daphiseksomphot Endowment Fund).
No conflicts of interest exist.
Fig. 9. Acemannan sponge induced periodontal regeneration. Acemannan significantly
increased the percentage of new bone formation at 30 and 60 d post-surgery (A). Aceman-
nan significantly increased the percentage of new cementum formation at 60 d (B). Peri- References
odontal ligament length in acemannan-treated groups was shorter than those of untreated
1. Drisko CH. Nonsurgical periodontal
control (C). Columns bars labeled by different letters are statistically different. p < 0.05, therapy. Periodontol 2000;2001:77–88.
n = 4. 2. Benatti BB, Silverio KG, Casati MZ,
Sallum EA, Nociti FH Jr. Physiological
features of periodontal regeneration and
acemannan sponge remains in the With some modification, acemannan approaches for periodontal tissue engi-
defect for several weeks and gradually can be prepared as a scaffold and be neering utilizing periodontal ligament
releases its bioactive molecules to pro- used as a cell carrier in tissue engi- cells. J Biosci Bioeng 2007;103:1–6.
mote regeneration of the surrounding neering techniques. However, more 3. Grzesik WJ, Narayanan AS. Cementum
tissue. We found in our in vivo study animal and clinical studies regarding and periodontal wound healing and
regeneration. Crit Rev Oral Biol Med
that the sponge itself is able to stop the efficiency of acemannan on peri-
2002;13:474–484.
excessive bleeding. The blood and tis- odontal regeneration and a compari- 4. Bansal J, Kedige SD, Anand S. Hyal-
sue fluid held in the sponge can be a son with these other materials and uronic acid: a promising mediator for
source of growth factors and nutrients techniques are required. periodontal regeneration. Indian J Dent
for tissue regeneration. The ability to We note that the class II furcation Res 2010;21:575–578.
physically remain in the surgical defects in our study were iatrogenically 5. Francesko A, Tzanov T. Chitin, chitosan
and derivatives for wound healing and
defect might help to decrease epithe- created in healthy periodontal tissue.
tissue engineering. Adv Biochem Eng Bio-
lial downgrowth and provide space Therefore, there was neither microor-
technol 2011;125:1–27.
for periodontal tissue regeneration. ganism invasion nor the chronic

6. Munarin F, Guerreiro SG, Grellier MA
et al. Pectin-based injectable biomaterials
for bone tissue engineering. Biomacro-
molecules 2011;12:568–577.
7. Wong M. Alginates in tissue engineering.
Methods Mol Biol 2004;238:77–86.
8. Barbosa MA, Granja PL, Barrias CC,
Amaral IF. Polysaccharides as scaffolds
for bone regeneration. ITBM-RBM
2005;26:212–217.
9. Santo VE, Gomes ME, Mano JF, Reis
RL. Chitosan-chondroitin sulphate nano-
particles for controlled delivery of plate-
let lysates in bone regenerative medicine.
J Tissue Eng Regen Med 2012;6(suppl 3):
s47–s59.
10. Boonyakul S, Banlunara W, Sangvanich
P, Thunyakitpisal P. Effect of aceman-
nan, an extracted polysaccharide from
aloe vera, on BMSCs proliferation, dif-
ferentiation, extracellular matrix synthe-
sis, mineralization, and bone formation
in a tooth extraction model. Odontology
2013 (in press) doi:10.1007/s10266-012-
0101-2.
11. Jettanacheawchankit S, Sasithanasate S,
Sangvanich P, Banlunara W,
Thunyakitpisal P. Acemannan stimulates
gingival fibroblast proliferation; expres-
sions of keratinocyte growth factor-1,
vascular endothelial growth factor, and
type I collagen; and wound healing. J
Pharmacol Sci 2009;109:525–531.
12. Jittapiromsak N, Sahawat D, Banlunara
W, Sangvanich P, Thunyakitpisal P.
Acemannan, an extracted product from
Aloe vera, stimulates dental pulp cell
proliferation, differentiation, mineraliza-
tion, and dentin formation. Tissue Eng
Part A 2010;16:1997–2006.
13. Sahawat D, Kanthasuwan S, Sangvanich
P, Takata T, Kitagawa M, Thunyakitpi-
sal P. Acemannan induces cementoblast
proliferation, differentiation, extracellular
matrix secretion, and mineral deposition.
J Med Plant Res 2012;6:4069–4076.
14. Bhalang K, Thunyakitpisal P, Rungsir-
isatean N. Acemannan, a polysaccharide
extracted from Aloe vera, is effective in
the treatment of oral aphthous ulcera-
tion. J Altern Complement Med 2012 (in
press) doi:10.1089/acm.2012.0164.
15. Ni Y, Turner D, Yates KM, Tizard I.
Isolation and characterization of struc-
tural components of Aloe vera L. leaf
pulp. Int Immunopharmacol 2004;4:
1745–1755.
16. Jittapiromsak N, Jettanacheawchankit S,
Lardungdee P, Sangvanich P, Thun-
yakitpisal P. Effect of acemannan on
BMP-2 expression in primary pulpal
fibroblasts and periodontal fibroblasts, in
vitro study. J Oral Tissue Eng 2007;4:
149–154.
17. Tai-Nin CJ, Williamson DA, Yates KM,
Goux WJ. Chemical characterization of
Acemannan and periodontal regeneration
the immunomodulating polysaccharide of
Aloe vera L. Carbohydr Res
2005;340:1131–1142.
18. Kadar K, Kiraly M, Porcsalmy B et al.
Differentiation potential of stem cells
from human dental origin - promise for
tissue engineering. J Physiol Pharmacol
2009;60(suppl 7):167–175.
19. Marmary Y, Brunette DM, Heersche JN.
Differences in vitro between cells derived
from periodontal ligament and skin of
Macaca irus. Arch Oral Biol 1976;21:
709–716.
20. Yoshizumi M, Kagami S, Suzaki Y et al.
Effect of endothelin-1 (1–31) on human
mesangial cell proliferation. Jpn J Phar-
macol 2000;84:146–155.
21. Chou AM, Sea-Lim V, Lim TM et al.
Culturing and characterization of human
periodontal ligament fibroblasts - a preli-
minary study. Mater Sci Eng, C
2002;20:77–83.
22. Wang W, Kirsch T. Retinoic acid stimu-
lates annexin-mediated growth plate
chondrocyte mineralization. J Cell Biol
2002;157:1061–1069.
23. Peniche C, Fernandez M, Rodriguez G
et al. Cell supports of chitosan/hyal-
uronic acid and chondroitin sulphate sys-
tems. Morphology and biological
behaviour. J Mater Sci Mater Med
2007;18:1719–1726.
24. Parenteau-Bareil R, Gauvin R, Cliche S,
Gariepy C, Germain L, Berthod F. Com-
parative study of bovine, porcine and
avian collagens for the production of a
tissue engineered dermis. Acta Biomater
2011;7:3757–3765.
25. Yan-Zhi X, Jing-Jing W, Chen YP, Liu
J, Li N, Yang FY. The use of zein and
Shuanghuangbu for periodontal tissue
engineering. Int J Oral Sci 2010;2:
142–148.
26. Martins AM, Santos MI, Azevedo HS,
Malafaya PB, Reis RL. Natural origin
scaffolds with in situ pore forming capa-
bility for bone tissue engineering applica-
tions. Acta Biomater 2008;4:1637–1645.
27. Mosmann T. Rapid colorimetric assay for
cellular growth and survival: application
to proliferation and cytotoxicity assays. J
Immunol Methods 1983;65:55–63.
28. Carlo RE, Borges AP, Del Carlo RJ
et al. Guided tissue regeneration using
rigid absorbable membranes in the dog
model of chronic furcation defect. Acta
Odontol Scand 2012 (in press) doi:10.
3109/00016357.2012.680909.
29. Deliberador TM, Nagata MJ, Furlaneto
FA et al. Autogenous bone graft with or
without a calcium sulfate barrier in the
treatment of Class II furcation defects: a
histologic and histometric study in dogs.
J Periodontol 2006;77:780–789.
30. Kosen Y, Miyaji H, Kato A, Sugaya T,
Kawanami M. Application of collagen
177
hydrogel/sponge scaffold facilitates peri-
odontal wound healing in class II furca-
tion defects in beagle dogs. J Periodontal
Res 2012;47:626–634.
31. Marchesan JT, Scanlon CS, Soehren S,
Matsuo M, Kapila YL. Implications of
cultured periodontal ligament cells for
the clinical and experimental setting: a
review. Arch Oral Biol 2011;56:933–943.
32. Gay IC, Chen S, MacDougall M. Isola-
tion and characterization of multipotent
human periodontal ligament stem cells.
Orthod Craniofac Res 2007;10:149–160.
33. Seo BM, Miura M, Gronthos S et al.
Investigation of multipotent postnatal
stem cells from human periodontal liga-
ment. Lancet 2004;364:149–155.
34. Bronckers AL, Engelse MA, Cavender
A, Gaikwad J, D’Souza RN. Cell-specific
patterns of Cbfa1 mRNA and protein
expression in postnatal murine dental tis-
sues. Mech Dev 2001;101:255–258.
35. Ducy P, Zhang R, Geoffroy V, Ridall
AL, Karsenty G. Osf2/Cbfa1: a tran-
scriptional activator of osteoblast differ-
entiation. Cell 1997;89:747–754.
36. Kobayashi M, Takiguchi T, Suzuki R
et al. Recombinant human bone mor-
phogenetic protein-2 stimulates osteo-
blastic differentiation in cells isolated
from human periodontal ligament. J
Dent Res 1999;78:1624–1633.
37. Miyaji H, Sugaya T, Ibe K, Ishizuka R,
Tokunaga K, Kawanami M. Root sur-
face conditioning with bone morphoge-
netic protein-2 facilitates cementum-like
tissue deposition in beagle dogs. J Peri-
odontal Res 2010;45:658–663.
38. Zhao M, Xiao G, Berry JE, Franceschi
RT, Reddi A, Somerman MJ. Bone
morphogenetic protein 2 induces dental
follicle cells to differentiate toward a ce-
mentoblast/osteoblast phenotype. J Bone
Miner Res 2002;17:1441–1451.
39. Kwon HR, Wikesjo UM, Park JC et al.
Growth/differentiation factor-5 signifi-
cantly enhances periodontal wound
healing/regeneration compared with plate-
let-derived growth factor-BB in dogs.
J Clin Periodontol 2010;37:739–746.
40. Moore YR, Dickinson DP, Wikesjo
UM. Growth/differentiation factor-5: a
candidate therapeutic agent for peri-
odontal regeneration? A review of pre-
clinical data. J Clin Periodontol 2010;37:
288–298.
41. Nakamura T, Yamamoto M, Tamura M,
Izumi Y. Effects of growth/differentiation
factor-5 on human periodontal ligament
cells. J Periodontal Res 2003;38:597–605.
42. King GN, King N, Cruchley AT, Wozney
JM, Hughes FJ. Recombinant human
bone morphogenetic protein-2 promotes
wound healing in rat periodontal fenestra-
tion defects. J Dent Res 1997;76:
1460–1470.
178 Chantarawaratit et al.
43. Bao P, Kodra A, Tomic-Canic M, Golinko
MS, Ehrlich HP, Brem H. The role of vas-
cular endothelial growth factor in wound
healing. J Surg Res 2009;153:347–358.
44. Chen XP, Qian H, Wu JJ et al. Expres-
sion of vascular endothelial growth fac-
tor in cultured human dental follicle cells
and its biological roles. Acta Pharmacol
Sin 2007;28:985–993.
45. Xu LL, Liu HC, Wang DS et al. Effects
of BMP-2 and dexamethasone on osteo-
genic differentiation of rat dental follicle
progenitor cells seeded on three-
dimensional beta-TCP. Biomed Mater
2009;4:065010.
46. Kook SH, Hwang JM, Park JS et al.
Mechanical force induces type I collagen
expression in human periodontal liga-
ment fibroblasts through activation of
ERK/JNK and AP-1. J Cell Biochem
2009;106:1060–1067.
47. Lukinmaa PL, Waltimo J. Immunohisto-
chemical localization of types I, V, and
VI collagen in human permanent teeth
and periodontal ligament. J Dent Res
1992;71:391–397.
48. Marom R, Shur I, Solomon R,
Benayahu D. Characterization of adhe-
sion and differentiation markers of osteo-
genic marrow stromal cells. J Cell
Physiol 2005;202:41–48.
49. Kawasaki N, Hamamoto Y, Nakajima
T, Irie K, Ozawa H. Periodontal regener-
ation of transplanted rat molars after
cryopreservation. Arch Oral Biol 2004;
49:59–69.
50. Goncalves PF, Lima LL, Sallum EA,
Casati MZ, Nociti FH Jr. Root cementum
may modulate gene expression during
periodontal regeneration: a preliminary
study in humans. J Periodontol 2008;79:
323–331.
51. Schander K, Arvidson K, Mustafa K
et al. Response of bone and periodontal
ligament cells to biodegradable polymer
scaffolds in vitro. J Bioact Compat Pol
2010;25:584–602.
52. Boonpaisanseree W, Jaru-Ampornpan K,
Koontongkaew S, Thunyakitpisal P.
Acemannan stimulated dentine sialophos-
phoprotein expression in human dental
pulp cell via p38 mitogen activated pro-
tein kinase. In: Fan S, Le T, Le Q, Yue
Y, eds. Proceeding of International Con-
ference: Innovative Research in a Chang-
ing and Challenging World. Thailand:
Australian Multicultural Interaction
Institute, 2012:356–365.
53. Kook SH, Lee JC. Tensile force inhibits
the proliferation of human periodontal
ligament fibroblasts through Ras-p38
MAPK up-regulation. J Cell Physiol
2012;227:1098–1106.
54. Boskovic J, Arnold JN, Stilion R et al.
Structural model for the mannose receptor
family uncovered by electron microscopy
of Endo180 and the mannose receptor.
J Biol Chem 2006;281:8780–8787.
55. Martinez-Pomares L. The mannose
receptor. J Leukoc Biol 2012;92:1177–
1186.
56. Payot P, Bickel M, Cimasoni G. Longi-
tudinal quantitative radiodensitometric
study of treated and untreated lower
molar furcation involvements. J Clin
Periodontol 1987;14:8–18.
57. Carranza FA Jr, Jolkovsky DL. Current
status of periodontal therapy for furca-
tion involvements. Dent Clin North Am
1991;35:555–570.
58. Pontoriero R, Nyman S, Ericsson I,
Lindhe J. Guided tissue regeneration in
surgically-produced furcation defects. An
experimental study in the beagle dog. J
Clin Periodontol 1992;19:159–163.
59. Horsted P, Sandergaard B, Thylstrup A,
El Attar K, Fejerskov O. A retrospective
study of direct pulp capping with calcium
hydroxide compounds. Endod Dent Trau-
matol 1985;1:29–34.
60. Wikesjo UM, Selvig KA. Periodontal
wound healing and regeneration. Period-
ontol 2000;1999:21–39.
61. Goncalves PF, Sallum EA, Sallum WS,
Casati MZ, Toledo S, Nociti FH Jr.
Dental cementum reviewed: development,
structure, composition, regeneration and
potential functions. Braz J Oral Sci
2005;4:651–658.
62. Ripamonti U, Petit JC, Teare J.
Cementogenesis and the induction of
periodontal tissue regeneration by the
osteogenic proteins of the transforming
growth factor-beta superfamily. J Peri-
odontal Res 2009;44:141–152.
63. Takahashi D, Odajima T, Morita M,
Kawanami M, Kato H. Formation and
resolution of ankylosis under application
of recombinant human bone morphoge-
netic protein-2 (rhBMP-2) to class III
furcation defects in cats. J Periodontal
Res 2005;40:299–305.
64. Wikesjo UM, Sorensen RG, Kinoshita
A, Jian Li X, Wozney JM. Periodontal
repair in dogs: effect of recombinant
human bone morphogenetic protein-12
(rhBMP-12) on regeneration of alveolar
bone and periodontal attachment. J Clin
Periodontol 2004;31:662–670.
65. Al-Hezaimi K, Al-Askar M, Al-Rasheed
A. Characteristics of newly-formed
cementum following Emdogain applica-
tion. Int J Oral Sci 2011;3:21–26.
66. Bosshardt DD, Sculean A, Windisch P,
Pjetursson BE, Lang NP. Effects of
enamel matrix proteins on tissue forma-
tion along the roots of human teeth. J
Periodontal Res 2005;40:158–167.
67. Park JC, Um YJ, Jung UW, Kim CS,
Choi SH, Kim CK. Histological charac-
teristics of newly formed cementum in
surgically created one-wall intrabony
defects in a canine model. J Periodontal
Implant Sci 2010;40:3–10.
68. Listgarten MA. Electron microscopic
study of the junction between surgically
denuded root surfaces and regenerated
periodontal tissues. J Periodontal Res
1972;7:68–90.
69. Bosshardt DD, Degen T, Lang NP.
Sequence of protein expression of bone
sialoprotein and osteopontin at the devel-
oping interface between repair cementum
and dentin in human deciduous teeth.
Cell Tissue Res 2005;320:399–407.
70. Harahashi H, Odajima T, Yamamoto T,
Kawanami M. Immunohistochemical
analysis of periodontal reattachment on
denuded root dentin after periodontal
surgery. Biomed Res 2010;31:319–328.
71. Kaigler D, Cirelli JA, Giannobile WV.
Growth factor delivery for oral and peri-
odontal tissue engineering. Expert Opin
Drug Deliv 2006;3:647–662.
72. Needleman IG, Worthington HV, Gied-
rys-Leeper E, Tucker RJ. Guided tissue
regeneration for periodontal infra-bony
defects. Cochrane Database Syst Rev
2006;19:CD001724.
73. Ridgway HK, Mellonig JT, Cochran DL.
Human histologic and clinical evaluation
of recombinant human platelet-derived
growth factor and beta-tricalcium phos-
phate for the treatment of periodontal
intraosseous defects. Int J Periodontics
Restorative Dent 2008;28:171–179.
74. Nevins M, Giannobile WV, McGuire
MK et al. Platelet-derived growth factor
stimulates bone fill and rate of attach-
ment level gain: results of a large multi-
center randomized controlled trial. J
Periodontol 2005;76:2205–2215.