MOL 214

EXAM 2
April 3, 2012

Your exam code number is:

Please write this number on each

page of your exam.

Please be sure that you have all 13 pages in your exam.

If you provide more than one answer we will only grade the first answer.
Please write legibly, if we can’t read it we can’t grade it!

I pledge my honor that this exam represents my own work in accordance with
Princeton University regulations.

Signature:_________________________________________

Printed Name:____________________________________
 Exam Code Number:_______________________

MOL 214 Exam 2

Multiple Choice (2 points each)

1. Which of the following statements about telomeres and telomerase is true?

a) human telomeres are rich in AT bases.
b) telomere extension requires shelterin proteins.
c) telomerase is composed of protein and RNA.
d) telomerase has reverse transcriptase activity.
e) a and c
f) a and d
g) b and d
h) c and d
i) a, b, c, and d

2. Which of the following statements about DNA sequencing is true?

a) During Sanger (dideoxy) sequencing, dideoxynucleotides are added in excess.
b) Deoxynucleotides have a hydroxyl group at the 2’ carbon.
c) Incorporation of deoxynucleotides prevents strand extension at the 5’ end.
d) Hierarchical shotgun genome sequencing does not require cloning steps.
e) Whole genome shotgun sequencing makes assembling repeated sequences difficult.

3. What accounts for 60% of the mass of eukaryotic ribosomes?

a) rRNA.
b) tRNA.
c) mRNA.
d) protein.
e) DNA.

4. Which of the following statements about sigma factors is true?

a) All sigma factors recognize the same promoter sequences.
b) Sigma factors interact with RNA polymerase II prior to forming the closed complex.
c) Sigma factors remain bound to the promoter after transcription initiates.
d) Alternative sigma factors induce expression of functionally related genes.
e) All sigma factors are expressed at the same level, at the same time

2
 Exam Code Number:_______________________

5. Which of the following statements is false?

a) Genome wide association studies are used to determine if genetic variations are
associated with a particular trait.
b) TBP causes RNA to bend.
c) Genetically modified organisms like golden rice can express genes from foreign
organisms like bacteria.
d) The traits (phenotypes) displayed by an organism depend on the genotype and
environmental factors.
e) The length of the transcription bubble stays the same during transcription.
f) A new RNA transcript is synthesized 5’ to 3’.

6. In the absence of arabinose, the regulatory protein AraC

a) forms a dimer, binds to two regulatory sequences near the promoter, and activates
transcription of the arabinose operon structural genes.
b) forms a dimer, binds to two regulatory sequences far from the promoter, and
represses transcription of the arabinose operon structural genes.
c) forms a tetramer, binds to the operator, and activates transcription of the arabinose
operon structural genes.
d) forms a tetramer, binds to the operator, and represses transcription of the arabinose
operon structural genes.

7. Regulation of the tryptophan operon occurs through

a) a tryptophan-activated repressor that binds to operator sites.
b) transcriptional attenuation by differential folding of RNA.
c) a ribozyme riboswitch.
d) an alternative sigma factor.
e) a and b
f) c and d
g) all of the above.

3
 Exam Code Number:_______________________

8. Which of the following statements about ribosome is true?

a) the eukaryotic ribosome is composed of 50S and 30S subunits.
b) the prokaryotic ribosome is composed of 60S and 40S subunits.
c) the large subunit is important for assembly of translation factors and catalyzing
peptide bond formation.
d) GTP hydrolysis is required for initiation factors to bind the ribosome.
e) GTP hydrolysis releases the tRNA to allow peptide bond formation.
f) Peptide bond formation is catalyzed by a ribosomal protein.

9. Which of the following events does NOT require base pairing interactions?
a) delivery of tRNAs to the P site of a ribosome
b) recognition of 5’ splice sites
c) binding of prokaryotic ribosomes near the translation initiation site
d) polyadenylation
e) telomere elongation

10. Mutations in the C-terminal domain of RNA polymerase II might affect all of the following
except
a) addition of the cap
b) splicing
c) Rho-dependent termination
d) transcriptional elongation
e) binding of TFIIs
f) all of the above

4
 Exam Code Number:_______________________

Short Answer

1. In class we discussed the initial experiment used to identify telomerase from an extract
of Tetrahymena cells. What is the meaning of the ladder-like appearance of the DNA
when Greider ran the product of her telomerase reaction on a gel? (2 points)

2. What is the Hayflick limit? (1 point)

3. Why is telomerase thought to be a good target for anti-cancer drugs? (1 point)

4. A person is found to have a mutation in their DNA glycosylase gene. What effect would
this mutation have on their ability repair damaged DNA bases? What effect would this
have on their ability to perform mismatch repair? (4 points)

5. Do small non-coding RNAs regulate genes positively or negatively (1 point)? Do they

function at the transcriptional or post-transcriptional level (1 point)?

5
 Exam Code Number:_______________________

6. Your friend Zemer works part-time at a company that sequences DNA. On his first day,
he sets up a standard Sanger sequencing reaction. Sadly, he gets distracted playing
Words with Friends and forgets to add dideoxy CTP to the reaction. What effect does
this have? Will he still be able to determine the sequence of the DNA? (4 points)

7. What role does U5 play in splicing? (1 point)

8. A mutation in the 5’ splice site would affect binding by which snRNP? (1 point)

9. How does the terminator sequence allow Rho to catch up to RNA polymerase? (2
points)

10. In what way are Rho-independent and Rho-dependent transcription terminators similar
to each other? (2 points)

6
 Exam Code Number:_______________________

11. Your advisor asks you to clone your favorite gene (yfg) into a plasmid vector. The
restriction map of the plasmid and the region around yfg are pictured below. Promoters
are marked with a P. The plasmid origin of replication is marked as ori.

a) Would yfg be expressed if you cloned it as a BamHI-NdeI fragment? (1 point)

b) Would yfg be expressed if you cloned it as a NdeI-XbaI fragment? (1 point)

c) If you cloned yfg as a BamHI-BamHI fragment, how could you determine the
orientation of the inserted fragment? (2 points)

d) What characteristic describes the DNA sequence that is recognized by restriction

enzymes? (1 point)

7
 Exam Code Number:_______________________

12. PCR is a commonly used technique in molecular biology. What is special about the
polymerase used in PCR reactions? (1 point)

Your lab partner made a mistake when he programmed his PCR cycle conditions and
set the temperature of the 2nd cycle at 85°C instead of 55°C. What effect will this have
on the results of his PCR reaction? (2 points)

When he tries to correct his programming error, he accidentally deletes the initial cycle
at 95°C. What effect will his latest error have on the PCR reaction? (2 points)

13. Pictured below is a doubled stranded DNA molecule and 8 different oligonucleotide
primers. Which primer(s) would you use to amplify gene X using PCR? (4 points)

8
 Exam Code Number:_______________________

14. In the days before whole-genome sequencing, techniques like subtractive hybridization
were used to identify genes associated with particular diseases. To clone the gene for
Duchenne Muscular Dystrophy (DMD), DNA from a healthy individual and DNA from a
DMD patient who was known to have a large deletion on the chromosome where the
DMD gene was thought to be located were isolated. The DNA samples were cut using
either restriction enzymes or random shearing by sonication.

Which DNA was cut with enzymes and which DNA was cut by shearing? (2 points)

Would this experiment still work if DMD was caused by a point mutation instead of a
deletion? Explain your answer (2 points)

15. Assembly of the eukaryotic transcription machinery is an ordered process. What is the
function of the following factors? (4 points)
a) TFIID

b) Mediator

16. Explain why the 5’ cap on mRNA is important for translation in eukaryotes but not in
bacteria. (2 points)

17. Does the addition of the 5’ cap to a eukaryotic mRNA occur before or after addition of
the poly A tail? Explain your answer. (2 points)

9
 Exam Code Number:_______________________

18. Imagine you isolated an E. coli mutant where the LacI repressor protein is unable to bind
DNA. Draw the lac operon and then predict what would happen to expression of the lac
operon if this mutant strain was grown under the 4 conditions described below. (4
points)
a. + glucose, + lactose
b. + glucose, - lactose
c. - glucose, - lactose
d. - glucose, - lactose

19. Is the LacI mutation described in #18 cis-acting or trans-acting? (1 point)

20. What effect would deletion of the lacY gene have on the four conditions in #18? (2
points)

21. How can 3 different proteins be produced from one eukaryotic mRNA? Draw a picture to
illustrate your answer. (2 points)

10
 Exam Code Number:_______________________

22. The diagram below depicts a eukaryotic gene that codes for a phosphatase enzyme.

a) In which region would the insertion of a single base pair of DNA be most likely to
cause a frameshift mutation? (1 point)

b) Why might a deletion of 10 base pairs in the vicinity of C be deleterious? (2 points)

c) A mutation that changes a CGU codon to AGU destroys the function of the
phosphatase. However, a mutation that changes this same codon to CGC has no effect
on phosphatase function. Explain why this might be. (2 points)

23. Base excision repair and mismatch repair are two pathways that remove damaged DNA.
a) How do mutations arise that trigger the mismatch repair pathway? (2 points)

b) Name one type of DNA damage that can trigger base excision repair. (2 points)

c) Explain why it is essential to have a base excision repair pathway. (2 points)

11
 Exam Code Number:_______________________

25. The following segment of DNA codes for a pre-mRNA (also known as a primary
transcript). The uppercase letters represent exons. The lowercase letters represent
introns. The bottom strand is the template strand.

5’- GCTAAATGGAGgtattgccggatgagGCACATTGACTCGGgttcgagGGTCAGATGC – 3’
3’- CGATTTACCTCcataacggcctactcCGTGTAACTGAGCCcaagctcCCAGTCTACG – 5’

a) Draw the mature mRNA sequence resulting from this DNA segment. Label the 5’
and 3’ ends. (2 points)

b) Underline the codon at which translation begins. (1 point)

c) How many amino acids does this mRNA encode? (1 point)

26. Pictured below is the DNA surrounding Gene Z. Expression of Gene Z is influenced by
two small molecules (mactose and yactose) and two proteins (Protein X and Protein Y).
Protein X is a repressor that only binds to DNA in the presence of mactose. Protein Y is
an activator that only binds to DNA in the absence of yactose. In addition to the wild-
type strain, you obtain a mutant that no longer produces Protein X and a mutant that no
longer produces Protein Y. In the table below, indicate where Gene Z will be expressed
(using a “+” or “–“ to indicate your answer is sufficient). (6 points)

12
 Exam Code Number:_______________________

27. Pictured below is the DNA sequence upstream of your favorite E. coli gene prlA. The
four underlined areas are important for transcription and translation.

5’-ATTGACAGCGGTGCAATCGGCGTTATAATCCATGCTTCATTGTCAACCCTGCATAATCGCAGGAGGT

CATGGCATGCTATGTGTTTCCAAATTTGGTTAATGCTGTTAACGGTGTCAGACTGCTTTTTAACTGG-3’

You discover that the structure of the mRNA transcript is critically important for initiating
translation of PrlA. Based on what you know about the ability of RNA to form secondary
structures and translational control, propose a model to explain your observation.
Design an experiment to test your model. (4 points)

13