TRANSCRIPTION, TRANSLATION AND

REPLICATION
CONTENTS
1. 1DNA, RNA and protein synthesis
2. 2DNA replication
1. 2.1Mistakes in DNA replication
3. 3Transcription
1. 3.1Formation of pre-messenger RNA
2. 3.2RNA splicing
3. 3.3Alternative splicing
4. 3.4Reverse transcription
4. 4Translation
5. 5Transfer RNA
6. 6The Genetic code
1. 6.1An exercise in the use of the genetic code
7. 7The Wobble hypothesis

DNA, RNA AND PROTEIN SYNTHESIS

The genetic material is stored in the form of DNA in most organisms. In humans, the nucleus of each
cell contains 3 × 109 base pairs of DNA distributed over 23 pairs of chromosomes, and each cell has
two copies of the genetic material. This is known collectively as the human genome. The human
genome contains around 30 000 genes, each of which codes for one protein.
Large stretches of DNA in the human genome are transcribed but do not code for proteins. These
regions are called introns and make up around 95% of the genome. The nucleotide sequence of the
human genome is now known to a reasonable degree of accuracy but we do not yet understand why
so much of it is non-coding. Some of this non-coding DNA controls gene expression but the purpose
of much of it is not yet understood. This is a fascinating subject that is certain to advance rapidly
over the next few years.
The Central Dogma of Molecular Biology states that DNA makes RNA makes proteins (Figure 1).

Figure 1 | The Central Dogma of Molecular Biology: DNA makes RNA makes proteins
The process by which DNA is copied to RNA is called transcription, and that by which RNA is used
to produce proteins is called translation.

DNA REPLICATION
Each time a cell divides, each of its double strands of DNA splits into two single strands. Each of
these single strands acts as a template for a new strand of complementary DNA. As a result, each
new cell has its own complete genome. This process is known as DNA replication. Replication is
controlled by the Watson-Crick pairing of the bases in the template strand with incoming
deoxynucleoside triphosphates, and is directed by DNA polymerase enzymes. It is a complex
process, particularly in eukaryotes, involving an array of enzymes. A simplified version of bacterial
DNA replication is described in Figure 2.
Figure 2 | DNA replication in bacteriaSimplified representation of DNA replication in bacteria.
DNA biosynthesis proceeds in the 5′- to 3′-direction. This makes it impossible for DNA polymerases
to synthesize both strands simultaneously. A portion of the double helix must first unwind, and this is
mediated by helicase enzymes.
The leading strand is synthesized continuously but the opposite strand is copied in short bursts of
about 1000 bases, as the lagging strand template becomes available. The resulting short strands
are called Okazaki fragments (after their discoverers, Reiji and Tsuneko Okazaki). Bacteria have at
least three distinct DNA polymerases: Pol I, Pol II and Pol III; it is Pol III that is largely involved in
chain elongation. Strangely, DNA polymerases cannot initiate DNA synthesis de novo, but require a
short primer with a free 3′-hydroxyl group. This is produced in the lagging strand by an RNA
polymerase (called DNA primase) that is able to use the DNA template and synthesize a short piece
of RNA around 20 bases in length. Pol III can then take over, but it eventually encounters one of the
previously synthesized short RNA fragments in its path. At this point Pol I takes over, using its 5′- to
3′-exonuclease activity to digest the RNA and fill the gap with DNA until it reaches a continuous
stretch of DNA. This leaves a gap between the 3′-end of the newly synthesized DNA and the 5′-end
of the DNA previously synthesized by Pol III. The gap is filled by DNA ligase, an enzyme that makes
a covalent bond between a 5′-phosphate and a 3′-hydroxyl group (Figure 3). The initiation of DNA
replication at the leading strand is more complex and is discussed in detail in more specialized texts.

Figure 3 | DNA polymerases in DNA replicationSimplified representation of the action of DNA polymerases in
DNA replication in bacteria.

Mistakes in DNA replication

DNA replication is not perfect. Errors occur in DNA replication, when the incorrect base is
incorporated into the growing DNA strand. This leads to mismatched base pairs, or mispairs. DNA
polymerases have proofreading activity, and a DNA repair enzymes have evolved to correct these
mistakes. Occasionally, mispairs survive and are incorporated into the genome in the next round of
replication. These mutations may have no consequence, they may result in the death of the
organism, they may result in a genetic disease or cancer; or they may give the organism a
competitive advantage over its neighbours, which leads to evolution by natural selection.

TRANSCRIPTION
Transcription is the process by which DNA is copied (transcribed) to mRNA, which carries the
information needed for protein synthesis. Transcription takes place in two broad steps. First, pre-
messenger RNA is formed, with the involvement of RNA polymerase enzymes. The process relies
on Watson-Crick base pairing, and the resultant single strand of RNA is the reverse-complement of
the original DNA sequence. The pre-messenger RNA is then "edited" to produce the desired mRNA
molecule in a process called RNA splicing.

Formation of pre-messenger RNA

The mechanism of transcription has parallels in that of DNA replication. As with DNA replication,
partial unwinding of the double helix must occur before transcription can take place, and it is the
RNA polymerase enzymes that catalyze this process.
Unlike DNA replication, in which both strands are copied, only one strand is transcribed. The strand
that contains the gene is called the sense strand, while the complementary strand is
the antisense strand. The mRNA produced in transcription is a copy of the sense strand, but it is the
antisense strand that is transcribed.
Ribonucleoside triphosphates (NTPs) align along the antisense DNA strand, with Watson-Crick base
pairing (A pairs with U). RNA polymerase joins the ribonucleotides together to form a pre-messenger
RNA molecule that is complementary to a region of the antisense DNA strand. Transcription ends
when the RNA polymerase enzyme reaches a triplet of bases that is read as a "stop" signal. The
DNA molecule re-winds to re-form the double helix.

Figure 4 | TranscriptionSimplified representation of the formation of pre-messenger RNA (orange) from double-
stranded DNA (blue) in transcription.

RNA splicing
The pre-messenger RNA thus formed contains introns which are not required for protein synthesis.
The pre-messenger RNA is chopped up to remove the introns and create messenger RNA (mRNA)
in a process called RNA splicing (Figure 5).

Figure 5 | RNA splicingIntrons are spliced from the pre-messenger RNA to give messenger RNA (mRNA).

Alternative splicing
In alternative splicing, individual exons are either spliced or included, giving rise to several different
possible mRNA products. Each mRNA product codes for a different protein isoform; these protein
isoforms differ in their peptide sequence and therefore their biological activity. It is estimated that up
to 60% of human gene products undergo alternative splicing. Several different mechanisms of
alternative splicing are known, two of which are illustrated in Figure 6.

Figure 6 | Alternative splicingSeveral different mechanisms of alternative splicing exist − a cassette exon can be
either included in or excluded from the final RNA (top), or two cassette exons may be mutually exclusive (bottom).

Alternative splicing contributes to protein diversity − a single gene transcript (RNA) can have
thousands of different splicing patterns, and will therefore code for thousands of different proteins: a
diverse proteome is generated from a relatively limited genome. Splicing is important in genetic
regulation (alteration of the splicing pattern in response to cellular conditions changes protein
expression). Perhaps not surprisingly, abnormal splicing patterns can lead to disease states
including cancer.

Reverse transcription
In reverse transcription, RNA is "reverse transcribed" into DNA. This process, catalyzed by reverse
transcriptase enzymes, allows retroviruses, including the human immunodeficiency virus (HIV), to
use RNA as their genetic material. Reverse transcriptase enzymes have also found applications in
biotechnology, allowing scientists to convert RNA to DNA for techniques such as PCR.

TRANSLATION
The mRNA formed in transcription is transported out of the nucleus, into the cytoplasm, to the
ribosome (the cell's protein synthesis factory). Here, it directs protein synthesis. Messenger RNA is
not directly involved in protein synthesis − transfer RNA (tRNA) is required for this. The process by
which mRNA directs protein synthesis with the assistance of tRNA is called translation.
The ribosome is a very large complex of RNA and protein molecules. Each three-base stretch of
mRNA (triplet) is known as a codon, and one codon contains the information for a specific amino
acid. As the mRNA passes through the ribosome, each codon interacts with the anticodon of a
specific transfer RNA (tRNA) molecule by Watson-Crick base pairing. This tRNA molecule carries an
amino acid at its 3′-terminus, which is incorporated into the growing protein chain. The tRNA is then
expelled from the ribosome. Figure 7 shows the steps involved in protein synthesis.

Figure 7 | Translation(a) and (b) tRNA molecules bind to the two binding sites of the ribosome, and by hydrogen
bonding to the mRNA; (c) a peptide bond forms between the two amino acids to make a dipeptide, while the tRNA
molecule is left uncharged; (d) the uncharged tRNA molecule leaves the ribosome, while the ribosome moves one
codon to the right (the dipeptide is translocated from one binding site to the other); (e) another tRNA molecule
binds; (f) a peptide bond forms between the two amino acids to make a tripeptide; (g) the uncharged tRNA molecule
leaves the ribosome.

TRANSFER RNA
Transfer RNA adopts a well defined tertiary structure which is normally represented in two
dimensions as a cloverleaf shape, as in Figure 7. The structure of tRNA is shown in more detail
in Figure 8.

Figure 8 | Two-dimensional structures of tRNA (transfer RNA)In some tRNAs the DHU arm has only three base
pairs.
Each amino acid has its own special tRNA (or set of tRNAs). For example, the tRNA for
phenylalanine (tRNAPhe) is different from that for histidine (tRNAHis). Each amino acid is attached
to its tRNA through the 3′-OH group to form an ester which reacts with the α-amino group of the
terminal amino-acid of the growing protein chain to form a new amide bond (peptide bond) during
protein synthesis (Figure 9). The reaction of esters with amines is generally favourable but the rate
of reaction is increased greatly in the ribosome.

Figure 9 | Protein synthesisReaction of the growing polypeptide chain with the 3′-end of the charged tRNA. The
amino acid is transferred from the tRNA molecule to the protein.
Each transfer RNA molecule has a well defined tertiary structure that is recognized by the enzyme
aminoacyl tRNA synthetase, which adds the correct amino acid to the 3′-end of the uncharged tRNA.
The presence of modified nucleosides is important in stabilizing the tRNA structure. Some of these
modifications are shown in Figure 10.

Figure 10 | Modified bases in tRNAStructures of some of the modified bases found in tRNA.

THE GENETIC CODE

The genetic code is almost universal. It is the basis of the transmission of hereditary information by
nucleic acids in all organisms. There are four bases in RNA (A,G,C and U), so there are 64 possible
triplet codes (43 = 64). In theory only 22 codes are required: one for each of the 20 naturally
occurring amino acids, with the addition of a start codon and a stop codon (to indicate the beginning
and end of a protein sequence). Many amino acids have several codes (degeneracy), so that all 64
possible triplet codes are used. For example Arg and Ser each have 6 codons whereas Trp and Met
have only one. No two amino acids have the same code but amino acids whose side-chains have
similar physical or chemical properties tend to have similar codon sequences, e.g. the side-chains of
Phe, Leu, Ile, Val are all hydrophobic, and Asp and Glu are both carboxylic acids (see Figure 11).
This means that if the incorrect tRNA is selected during translation (owing to mispairing of a single
base at the codon-anticodon interface) the misincorporated amino acid will probably have similar
properties to the intended tRNA molecule. Although the resultant protein will have one incorrect
amino acid it stands a high probability of being functional. Organisms show "codon bias" and use
certain codons for a particular amino acid more than others. For example, the codon usage in
humans is different from that in bacteria; it can sometimes be difficult to express a human protein in
bacteria because the relevant tRNA might be present at too low a concentration.

Figure 11 | The Genetic code − triplet codon assignments for the 20 amino acids. As well as coding for
methionine, AUG is used as a start codon, initiating protein biosynthesis

An exercise in the use of the genetic code

One strand of genomic DNA (strand A, coding strand) contains the following sequence reading from
5′- to 3′-:

TCGTCGACGATGATCATCGGCTACTCGA

This strand will form the following duplex:

5′-TCGTCGACGATGATCATCGGCTACTCGA-3'
3′-AGCAGCTGCTACTAGTAGCCGATGAGCT-5'

The sequence of bases in the other strand of DNA (strand B) written 5′- to 3′- is therefore

TCGAGTAGCCGATGATCATCGTCGACGA

The sequence of bases in the mRNA transcribed from strand A of DNA written 5′- to 3′- is

UCGAGUAGCCGAUGAUCAUCGUCGACGA

The amino acid sequence coded by the above mRNA is

Ser-Ser-Ser-Arg-STOP

However, if DNA strand B is the coding strand the mRNA sequence will be:

UCGUCGACGAUGAUCAUCGGCUACUCGA

and the amino-acid sequence will be:

Ser-Ser-Thr-Arg-Ser-Ser-Gly-Cys-Ser-

THE WOBBLE HYPOTHESIS

Close inspection of all of the available codons for a particular amino acid reveals that the variation is
greatest in the third position (for example, the codons for alanine are GCU, GCC, GCA and GCG).
Crick and Brenner proposed that a single tRNA molecule can recognize codons with different bases
at the 3′-end owing to non-Watson-Crick base pair formation with the third base in the codon-
anticodon interaction. These non-standard base pairs are different in shape from A·U and G·C and
the term wobble hypothesis indicates that a certain degree of flexibility or "wobbling" is allowed at this
position in the ribosome. Not all combinations are possible; examples of "allowed" pairings are
shown in Figure 12.

Figure 12 | Structures of wobble base pairs found in RNA

The ability of DNA bases to form wobble base pairs as well as Watson-Crick base pairs can result
in base-pair mismatches occurring during DNA replication. If not repaired by DNA repair enzymes,
these mismatches can lead to genetic diseases and cancer.
mRNA mRNA, or messenger RNA, is the link between a gene and a protein. The gene is transcribed by
RNA polymerase, and the resulting mRNA travels to the cytoplasm, where it is translated by ribosomes
into a protein with the help of tRNA. This form of RNA is extensively altered post-transcriptionally with
modifications such as methylguanosine caps and polyadenosine tails. Eukaryotic mRNA frequently
includes introns which must be spliced out of the message to form the mature mRNA molecule. rRNA
rRNA, or ribosomal RNA, is a major component of ribosomes. After transcription, these RNA molecules
travel to the cytoplasm and join with other rRNAs and many proteins to form a ribosome. rRNA is used
both for structural and functional purposes. Many reactions in the translational process are catalyzed by
key portions of certain rRNAs in the ribosome. tRNA tRNA, or transfer RNA, is the "decoder" of the
mRNA message during protein translation. After transcription, tRNA is extensively modified to include
nonstandard bases such as pseudouridine, inosine, and methylguanosine. By themselves, ribosomes
cannot form a protein when the mRNA makes contact. The anticodon, a string of three key bases on the
tRNA, match with three bases on the mRNA message called the codon. That is only the first function of
tRNA, as each molecule also carries with it an amino acid which matches the mRNA codon. The
ribosome functions to polymerize the amino acids linked to the tRNA into a functional protein.

Although DNA stores the information for protein synthesis and RNA carries out the instructions encoded
in DNA, most biological activities are carried out by proteins. The accurate synthesis of proteins thus is
critical to the proper functioning of cells and organisms. We saw in Chapter 3 that the linear order of
amino acids in each protein determines its three-dimensional structure and activity. For this reason,
assembly of amino acids in their correct order, as encoded in DNA, is the key to production of functional
proteins. Three kinds of RNA molecules perform different but cooperative functions in protein synthesis
(Figure 4-20): Figure 4-20. The three roles of RNA in protein synthesis. Figure 4-20 The three roles of
RNA in protein synthesis. Messenger RNA (mRNA) is translated into protein by the joint action of
transfer RNA (tRNA) and the ribosome, which is composed of numerous proteins and two major
ribosomal RNA (rRNA) molecules. [Adapted from (more...) 1. Messenger RNA (mRNA) carries the genetic
information copied from DNA in the form of a series of three-base code “words,” each of which specifies
a particular amino acid. 2. Transfer RNA (tRNA) is the key to deciphering the code words in mRNA. Each
type of amino acid has its own type of tRNA, which binds it and carries it to the growing end of a
polypeptide chain if the next code word on mRNA calls for it. The correct tRNA with its attached amino
acid is selected at each step because each specific tRNA molecule contains a three-base sequence that
can base-pair with its complementary code word in the mRNA. 3. Ribosomal RNA (rRNA) associates with
a set of proteins to form ribosomes. These complex structures, which physically move along an mRNA
molecule, catalyze the assembly of amino acids into protein chains. They also bind tRNAs and various
accessory molecules necessary for protein synthesis. Ribosomes are composed of a large and small
subunit, each of which contains its own rRNA molecule or molecules. Translation is the whole process by
which the base sequence of an mRNA is used to order and to join the amino acids in a protein. The three
types of RNA participate in this essential protein-synthesizing pathway in all cells; in fact, the
development of the three distinct functions of RNA was probably the molecular key to the origin of life.
How each RNA carries out its specific task is discussed in this section, while the biochemical events in
protein synthesis and the required protein factors are described in the final section of the chapter.

This mRNA molecule carries DNA's message from the nucleus to ribosomes in the cytoplasm, where
proteins are assembled. However, before it can do this, the mRNA strand must separate itself from the
DNA template and, in some cases, it must also undergo an editing process of sort.
What happens after mRNA is transcribed? It uses DNA as a template to make an RNA molecule. RNA
then leaves the nucleus and goes to a ribosome in the cytoplasm, where translation occurs. Translation
reads the genetic code in mRNA and makes a protein. ... Transcription uses the sequence of bases in a
strand of DNA to make a complementary strand of mRNA.

The process in which cells make proteins is called protein synthesis. It actually consists of two processes:
transcription and translation. Transcription takes place in the nucleus. It uses DNA as a template to
make an RNA molecule. RNA then leaves the nucleus and goes to a ribosome in the cytoplasm, where
translation occurs. Translation reads the genetic code in mRNA and makes a protein. Transcription is the
first part of the central dogma of molecular biology: DNA → RNA. It is the transfer of genetic instructions
in DNA to messenger RNA (mRNA). During transcription, a strand of mRNA is made that is
complementary to a strand of DNA. Figure 1 shows how this occurs.

The Information in DNA Determines Cellular Function via Translation. To manufacture protein
molecules, a cell must first transfer information from DNA to mRNA through the process of
transcription. Then, a process called translation uses this mRNA as a template for protein assembly.

Messenger RNA (mRNA), molecule in cells that carries codes from the DNA in the nucleus to the sites of
protein synthesis in the cytoplasm (the ribosomes).

What is the difference between DNA replication transcription and translation? Transcription copies the
DNA into RNA, while replication makes another copy of DNA. Both processes involve the generation of a
new molecule of nucleic acids, either DNA or RNA; however, the function of each process is very
different, with one involved in gene expression and the other involved in cell division.

DNA REPLICATION Each time a cell divides, each of its double strands of DNA splits into two single
strands. Each of these single strands acts as a template for a new strand of complementary DNA. As a
result, each new cell has its own complete genome. This process is known as DNA replication.
Replication is controlled by the Watson-Crick pairing of the bases in the template strand with incoming
deoxynucleoside triphosphates, and is directed by DNA polymerase enzymes. It is a complex process,
particularly in eukaryotes, involving an array of enzymes.

TRANSCRIPTION Transcription is the process by which DNA is copied (transcribed) to mRNA, which
carries the information needed for protein synthesis. Transcription takes place in two broad steps. First,
pre-messenger RNA is formed, with the involvement of RNA polymerase enzymes. The process relies on
Watson-Crick base pairing, and the resultant single strand of RNA is the reverse-complement of the
original DNA sequence. The pre-messenger RNA is then "edited" to produce the desired mRNA molecule
in a process called RNA splicing.

TRANSLATION The mRNA formed in transcription is transported out of the nucleus, into the cytoplasm,
to the ribosome (the cell's protein synthesis factory). Here, it directs protein synthesis. Messenger RNA
is not directly involved in protein synthesis − transfer RNA (tRNA) is required for this. The process by
which mRNA directs protein synthesis with the assistance of tRNA is called translation. The ribosome is a
very large complex of RNA and protein molecules. Each three-base stretch of mRNA (triplet) is known as
a codon, and one codon contains the information for a specific amino acid. As the mRNA passes through
the ribosome, each codon interacts with the anticodon of a specific transfer RNA (tRNA) molecule by
Watson-Crick base pairing. This tRNA molecule carries an amino acid at its 3′-terminus, which is
incorporated into the growing protein chain. The tRNA is then expelled from the ribosome. Figure 7
shows the steps involved in protein synthesis.
Tapos na ang Pakikipag-usap sa Chat

Mag-type ng message...

Higit pang mga kuwento ang nil-load.

  | Lead Editor: Bob Moss
NUCLEIC ACID STRUCTURE AND FUNCTION

Translation: DNA to mRNA to Protein

By: Suzanne Clancy, Ph.D. & William Brown, Ph.D. (Write Science Right) © 2008 Nature Education

Citation: Clancy, S. & Brown, W. (2008) Translation: DNA to mRNA to Protein. Nature Education 1(1):101

How does the cell convert DNA into working proteins? The process of translation can be seen as the decoding of
instructions for making proteins, involving mRNA in transcription as well as tRNA.

Aa Aa Aa

The genes in DNA encode protein molecules, which are the "workhorses" of the cell, carrying out all the functions necessary
for life. For example, enzymes, including those that metabolize nutrients and synthesize new cellular constituents, as well as
DNA polymerases and other enzymes that make copies of DNA during cell division, are all proteins.
In the simplest sense, expressing a gene means manufacturing its corresponding protein, and this multilayered process has
two major steps. In the first step, the information in DNA is transferred to a messenger RNA (mRNA) molecule by way of a
process called transcription. During transcription, the DNA of a gene serves as a template for complementary base-pairing,
and an enzyme called RNA polymerase II catalyzes the formation of a pre-mRNA molecule, which is then processed to form
mature mRNA (Figure 1). The resulting mRNA is a single-stranded copy of the gene, which next must be translated into a
protein molecule.

Figure 1: A gene is expressed through the processes of transcription and translation.

During transcription, the enzyme RNA polymerase (green) uses DNA as a template to produce a pre-mRNA transcript
(pink). The pre-mRNA is processed to form a mature mRNA molecule that can be translated to build the protein molecule
(polypeptide) encoded by the original gene.

© 2013 Nature Education All rights reserved.

Figure Detail

During translation, which is the second major step in gene expression, the mRNA is "read" according to the genetic code,
which relates the DNA sequence to the amino acid sequence in proteins (Figure 2). Each group of three bases in mRNA
constitutes a codon, and each codon specifies a particular amino acid (hence, it is a triplet code). The mRNA sequence is
thus used as a template to assemble—in order—the chain of amino acids that form a protein.

Figure 2: The amino acids specified by each mRNA codon. Multiple codons can code for the same amino acid.

The codons are written 5' to 3', as they appear in the mRNA. AUG is an initiation codon; UAA, UAG, and UGA are
termination (stop) codons.

© 2014 Nature Education All rights reserved.

Figure Detail

But where does translation take place within a cell? What individual substeps are a part of this process? And does
translation differ between prokaryotes and eukaryotes? The answers to questions such as these reveal a great deal about
the essential similarities between all species.

Where Translation Occurs

Within all cells, the translation machinery resides within a specialized organelle called the ribosome. In eukaryotes, mature
mRNA molecules must leave the nucleus and travel to the cytoplasm, where the ribosomes are located. On the other hand,
in prokaryotic organisms, ribosomes can attach to mRNA while it is still being transcribed. In this situation, translation begins
at the 5' end of the mRNA while the 3' end is still attached to DNA.
In all types of cells, the ribosome is composed of two subunits: the large (50S) subunit and the small (30S) subunit (S, for
svedberg unit, is a measure of sedimentation velocity and, therefore, mass). Each subunit exists separately in the
cytoplasm, but the two join together on the mRNA molecule. The ribosomal subunits contain proteins and specialized RNA
molecules—specifically, ribosomal RNA (rRNA) and transfer RNA (tRNA). The tRNA molecules are adaptor molecules—
they have one end that can read the triplet code in the mRNA through complementary base-pairing, and another end that
attaches to a specific amino acid (Chapeville et al., 1962; Grunberger et al., 1969). The idea that tRNA was an adaptor
molecule was first proposed by Francis Crick, co-discoverer of DNA structure, who did much of the key work in deciphering
the genetic code (Crick, 1958).
Within the ribosome, the mRNA and aminoacyl-tRNA complexes are held together closely, which facilitates base-pairing.
The rRNA catalyzes the attachment of each new amino acid to the growing chain.

The Beginning of mRNA Is Not Translated

Interestingly, not all regions of an mRNA molecule correspond to particular amino acids. In particular, there is an area near
the 5' end of the molecule that is known as the untranslated region (UTR) or leader sequence. This portion of mRNA is
located between the first nucleotide that is transcribed and the start codon (AUG) of the coding region, and it does not affect
the sequence of amino acids in a protein (Figure 3).
So, what is the purpose of the UTR? It turns out that the leader sequence is important because it contains a ribosome-
binding site. In bacteria, this site is known as the Shine-Dalgarno box (AGGAGG), after scientists John Shine and Lynn
Dalgarno, who first characterized it. A similar site in vertebrates was characterized by Marilyn Kozak and is thus known as
the Kozak box. In bacterial mRNA, the 5' UTR is normally short; in human mRNA, the median length of the 5' UTR is about
170 nucleotides. If the leader is long, it may contain regulatory sequences, including binding sites for proteins, that can affect
the stability of the mRNA or the efficiency of its translation.

Figure 3: A DNA transcription unit.

A DNA transcription unit is composed, from its 3' to 5' end, of an RNA-coding region (pink rectangle) flanked by a promoter
region (green rectangle) and a terminator region (black rectangle). Regions to the left, or moving towards the 3' end, of the
transcription start site are considered \"upstream;\" regions to the right, or moving towards the 5' end, of the transcription
start site are considered \"downstream.\"
© 2014 Nature Education Adapted from Pierce, Benjamin. Genetics: A Conceptual Approach, 2nd ed. All rights

reserved.

Translation Begins After the Assembly of a Complex Structure

The translation of mRNA begins with the formation of a complex on the mRNA (Figure 4). First, three initiation factor
proteins (known as IF1, IF2, and IF3) bind to the small subunit of the ribosome. This preinitiation complex and a methionine-
carrying tRNA then bind to the mRNA, near the AUG start codon, forming the initiation complex.

Figure 4: The translation initiation complex.

When translation begins, the small subunit of the ribosome and an initiator tRNA molecule assemble on the mRNA
transcript. The small subunit of the ribosome has three binding sites: an amino acid site (A), a polypeptide site (P), and an
exit site (E). The initiator tRNA molecule carrying the amino acid methionine binds to the AUG start codon of the mRNA
transcript at the ribosome’s P site where it will become the first amino acid incorporated into the growing polypeptide chain.
Here, the initiator tRNA molecule is shown binding after the small ribosomal subunit has assembled on the mRNA; the order
in which this occurs is unique to prokaryotic cells. In eukaryotes, the free initiator tRNA first binds the small ribosomal
subunit to form a complex. The complex then binds the mRNA transcript, so that the tRNA and the small ribosomal subunit
bind the mRNA simultaneously.

© 2013 Nature Education All rights reserved.

Figure Detail

Although methionine (Met) is the first amino acid incorporated into any new protein, it is not always the first amino acid in
mature proteins—in many proteins, methionine is removed after translation. In fact, if a large number of proteins are
sequenced and compared with their known gene sequences, methionine (or formylmethionine) occurs at the N-terminus of
all of them. However, not all amino acids are equally likely to occur second in the chain, and the second amino acid
influences whether the initial methionine is enzymatically removed. For example, many proteins begin with methionine
followed by alanine. In both prokaryotes and eukaryotes, these proteins have the methionine removed, so that alanine
becomes the N-terminal amino acid (Table 1). However, if the second amino acid is lysine, which is also frequently the case,
methionine is not removed (at least in the sample proteins that have been studied thus far). These proteins therefore begin
with methionine followed by lysine (Flinta et al., 1986).

Table 1 shows the N-terminal sequences of proteins in prokaryotes and eukaryotes, based on a sample of 170 prokaryotic
and 120 eukaryotic proteins (Flinta et al., 1986). In the table, M represents methionine, A represents alanine, K represents
lysine, S represents serine, and T represents threonine.
Table 1: N-Terminal Sequences of Proteins
N-Terminal Percent of Prokaryotic Percent of Eukaryotic
Sequence Proteins with This Sequence Proteins with This
Sequence

MA* 28.24% 19.17%

MK** 10.59% 2.50%

MS* 9.41% 11.67%

MT* 7.65% 6.67%

* Methionine was removed in all of these proteins

** Methionine was not removed from any of these proteins

Once the initiation complex is formed on the mRNA, the large ribosomal subunit binds to this complex, which causes the
release of IFs (initiation factors). The large subunit of the ribosome has three sites at which tRNA molecules can bind. The A
(amino acid) site is the location at which the aminoacyl-tRNA anticodon base pairs up with the mRNA codon, ensuring that
correct amino acid is added to the growing polypeptide chain. The P (polypeptide) site is the location at which the amino
acid is transferred from its tRNA to the growing polypeptide chain. Finally, the E (exit) site is the location at which the
"empty" tRNA sits before being released back into the cytoplasm to bind another amino acid and repeat the process. The
initiator methionine tRNA is the only aminoacyl-tRNA that can bind in the P site of the ribosome, and the A site is aligned
with the second mRNA codon. The ribosome is thus ready to bind the second aminoacyl-tRNA at the A site, which will be
joined to the initiator methionine by the first peptide bond (Figure 5).

Figure 5: The large ribosomal subunit binds to the small ribosomal subunit to complete the initiation complex.

The initiator tRNA molecule, carrying the methionine amino acid that will serve as the first amino acid of the polypeptide
chain, is bound to the P site on the ribosome. The A site is aligned with the next codon, which will be bound by the anticodon
of the next incoming tRNA.

© 2013 Nature Education All rights reserved.

The Elongation Phase

Figure 6

Figure Detail

The next phase in translation is known as the elongation phase (Figure 6). First, the ribosome moves along the mRNA in the
5'-to-3'direction, which requires the elongation factor G, in a process called translocation. The tRNA that corresponds to the
second codon can then bind to the A site, a step that requires elongation factors (in E. coli, these are called EF-Tu and EF-
Ts), as well as guanosine triphosphate (GTP) as an energy source for the process. Upon binding of the tRNA-amino acid
complex in the A site, GTP is cleaved to form guanosine diphosphate (GDP), then released along with EF-Tu to be recycled
by EF-Ts for the next round.

Next, peptide bonds between the now-adjacent first and second amino acids are formed through a peptidyl
transferase activity. For many years, it was thought that an enzyme catalyzed this step, but recent evidence indicates that
the transferase activity is a catalytic function of rRNA (Pierce, 2000). After the peptide bond is formed, the ribosome shifts,
or translocates, again, thus causing the tRNA to occupy the E site. The tRNA is then released to the cytoplasm to pick up
another amino acid. In addition, the A site is now empty and ready to receive the tRNA for the next codon.
This process is repeated until all the codons in the mRNA have been read by tRNA molecules, and the amino acids attached
to the tRNAs have been linked together in the growing polypeptide chain in the appropriate order. At this point, translation
must be terminated, and the nascent protein must be released from the mRNA and ribosome.

Termination of Translation
There are three termination codons that are employed at the end of a protein-coding sequence in mRNA: UAA, UAG, and
UGA. No tRNAs recognize these codons. Thus, in the place of these tRNAs, one of several proteins, called release factors,
binds and facilitates release of the mRNA from the ribosome and subsequent dissociation of the ribosome.

Comparing Eukaryotic and Prokaryotic Translation

The translation process is very similar in prokaryotes and eukaryotes. Although different elongation, initiation, and
termination factors are used, the genetic code is generally identical. As previously noted, in bacteria, transcription and
translation take place simultaneously, and mRNAs are relatively short-lived. In eukaryotes, however, mRNAs have
highly variable half-lives, are subject to modifications, and must exit the nucleus to be translated; these multiple steps offer
additional opportunities to regulate levels of protein production, and thereby fine-tune gene expression.
What Are mRNA, rRNA and tRNA?

RELATED

Nucleic Acid Functions

Updated September 17, 2018

By Robert Mullis

RNA is a critical component of every single living cell in the universe. Without it, life as
we know it could not exist. There are three types of RNA, each with a unique function.
mRNA is used to produce proteins from genes. rRNA, along with protein, forms the
ribosome, which translates mRNA. tRNA is the link between the two other types of
RNA.

RNA Features
RNA, or ribonucleic acid, is a linear polymer of adenine, thymine, cytosine, and uracil
that is created in the cell by a process called transcription, and it differs from DNA in
several ways. First, the ribose sugars on DNA nucleotides are short one hydroxyl
group compared to RNA, hence the name deoxyribonucleic acid. This key modification
makes RNA much more chemically reactive. Second, DNA uses thymine to base pair
with cytosine, while RNA uses uracil. Third, DNA tends to form into a helix of double-
stranded nucleotides, with base pairs making up the "rungs" of the helical ladder. RNA
can be found in single-stranded form, but it more commonly forms complex three-
dimensional structures, and this feature usually serves to confer functionality on RNA
molecules.

RNA Synthesis
RNA transcription is a process mediated by RNA polymerase, an enzyme that creates
an RNA complement to template DNA with the help of a complex of proteins.
Transcription is heavily regulated by promoter elements and inhibitors. All three types
of RNA are synthesized in this manner.

mRNA
mRNA, or messenger RNA, is the link between a gene and a protein. The gene is
transcribed by RNA polymerase, and the resulting mRNA travels to the cytoplasm,
where it is translated by ribosomes into a protein with the help of tRNA. This form of
RNA is extensively altered post-transcriptionally with modifications such as
methylguanosine caps and polyadenosine tails. Eukaryotic mRNA frequently includes
introns which must be spliced out of the message to form the mature mRNA molecule.

rRNA
rRNA, or ribosomal RNA, is a major component of ribosomes. After transcription,
these RNA molecules travel to the cytoplasm and join with other rRNAs and many
proteins to form a ribosome. rRNA is used both for structural and functional purposes.
Many reactions in the translational process are catalyzed by key portions of certain
rRNAs in the ribosome.

tRNA
tRNA, or transfer RNA, is the "decoder" of the mRNA message during protein
translation. After transcription, tRNA is extensively modified to include nonstandard
bases such as pseudouridine, inosine, and methylguanosine. By themselves,
ribosomes cannot form a protein when the mRNA makes contact. The anticodon, a
string of three key bases on the tRNA, match with three bases on the mRNA message
called the codon. That is only the first function of tRNA, as each molecule also carries
with it an amino acid which matches the mRNA codon. The ribosome functions to
polymerize the amino acids linked to the tRNA into a functional protein.
SUMMARY
 Genetic information is copied into mRNA in the form of a commaless,
overlapping, degenerate triplet code. Each amino acid is encoded by one or more three-
base sequences, or codons, in mRNA. Each codon specifies one amino acid, but most
amino acids are encoded by multiple codons (see Table 4-2).
 The AUG codon for methionine is the most common start codon, specifying the amino
acid at the NH2-terminus of a protein chain. Three codons function as stop codons and
specify no amino acids.
 A reading frame, the uninterrupted sequence of codons in mRNA from a
specific start codon to a stop codon, is translated into the linear sequence of amino acids
in a protein.
 Decoding of the nucleotide sequence in mRNA into the amino acid sequence of proteins
depends on transfer RNAs and amino-acyl tRNA synthetases (see Figure 4-25).
 All tRNAs have a similar three-dimensional structure that includes an acceptor arm for
attachment of a specific amino acid and a stem-loop with a three-
base anticodon sequence at its ends (see Figure 4-26). The anticodon can base-pair with
its corresponding codon or codons in mRNA.
 Because of nonstandard interactions, a tRNA may base-pair with more than one
mRNA codon, and conversely, a particular codon may base-pair with multiple tRNAs.
 Each of the 20 aminoacyl-tRNA synthetases recognizes a single amino acid and
covalently links it to a cognate tRNA, forming an aminoacyl-tRNA (see Figure 4-29).
This reaction activates the amino acid, so it can participate in peptide-bond formation.
 The composition of ribosomes — the large ribonucleoprotein complexes on which
proteins are synthesized — is quite similar in all organisms (see Figure 4-32). All
ribosomes are composed of a small and a large subunit. Each contains numerous different
proteins and one rRNA (small or large). The large subunit also contains one
accessory RNA (5S).
 Analogous rRNAs from many different species fold into quite similar three-dimensional
structures containing numerous stem-loops and binding sites for proteins, mRNA, and
tRNAs. As a ribosome moves along an mRNA, a region of the large rRNA mole- cule in
each ribosome sequentially binds the aminoacyl-ated ends of incoming tRNAs and
probably catalyzes peptide-bond formation (see Figure 4-34).