International Journal of Food Microbiology 168–169 (2014) 57–62

Contents lists available at ScienceDirect

International Journal of Food Microbiology

journal homepage: www.elsevier.com/locate/ijfoodmicro

Isolation and molecular characterization of Salmonella enterica,

Escherichia coli O157:H7 and Shigella spp. from meat and dairy products
in Egypt
Ashraf M. Ahmed a, Tadashi Shimamoto b,⁎
a
Department of Bacteriology, Mycology and Immunology, Faculty of Veterinary Medicine, Kafrelsheikh University, Kafr El-Sheikh 33516, Egypt
b
Laboratory of Food Microbiology and Hygiene, Graduate School of Biosphere Science, Hiroshima University, Higashihiroshima 739-8528, Japan

a r t i c l e i n f o a b s t r a c t

Article history: Foodborne pathogens are a major threat to food safety, especially in developing countries where hygiene and
Received 22 April 2013 sanitation facilities are often poor. Salmonella enterica, Escherichia coli O157:H7 and Shigella spp. are among the
Received in revised form 8 August 2013 major causes of outbreaks of foodborne diseases. This large-scale study investigated the prevalence of these
Accepted 21 October 2013
foodborne pathogens in meat (beef and chicken) and dairy products collected from street vendors, butchers, re-
Available online 29 October 2013
tail markets and slaughterhouses in Egypt. A total of 1600 food samples (800 meat products and 800 dairy prod-
Keywords:
ucts) were analyzed using culture and PCR based methods. S. enterica, E. coli O157:H7 and Shigella spp. were
Africa detected in 69 (4.3%), 54 (3.4%) and 27 (1.7%) samples respectively. S. enterica serovar Typhimurium, S. enterica
Foodborne pathogens serovar Enteritidis, S. enterica serovar Infantis and non-typable serovars were detected in 28 (1.8%), 22 (1.4%), 16
Prevalence (1.0%) and 3 (0.1%) samples respectively. All E. coli O157:H7 isolates were positive for stx1 and/or stx2 virulence
Retail markets toxin genes. Shigella flexneri, Shigella sonnei and Shigella dysenteriae were detected in 18 (1.2%), 7 (0.4%) and 2
(0.1%) samples respectively. The incidences of S. enterica and Shigella spp. were higher in meat products (53;
6.6% and 16; 2.0%, respectively) than in dairy products (16; 2.0% and 11; 1.4%, respectively), while, E. coli
O157:H7 was higher in dairy products (29; 3.6%) than in meat products (25; 3.1%). The incidence of foodborne
pathogens in meat and dairy products was determined in a large-scale survey in Africa.
© 2013 Elsevier B.V. All rights reserved.

1. Introduction 3,840,000 with 3840 deaths and at an estimated cost between

Over the last 25 years, the global incidence of foodborne infections
has markedly increased, with nearly a quarter of the population at a
high risk of illness (Oliver et al., 2005). The World Health Organization
(WHO, 2010) estimates that foodborne and waterborne diarrheal dis-
eases together kill around 2.2 million people annually. According to
the Center for Disease Control and Prevention (CDC), each year millions
of illnesses throughout the world can be traced to foodborne pathogens.
Recently, in the USA, the Foodborne Diseases Active Surveillance Net-
work (FoodNet) conducts surveillance in 10 U.S. sites for all infections
caused by selected pathogens transmitted commonly through food. A
total of 19,531 infections, 4563 hospitalizations, and 68 deaths associat-
ed with foodborne diseases were reported in 2012 (CDC, 2013). The
foods most commonly incriminated include meat and dairy products,
eggs, fish and raw vegetables. Salmonella enterica, Escherichia coli
O157:H7 and Shigella spp. are among the major foodborne pathogens
affecting people worldwide (CDC, 2010). S. enterica is a significant
cause of foodborne illness in humans with 95,548 reported cases in
the European Union in 2011 (EFSA, 2013). In the USA, the number of
cases of Salmonellosis was estimated at between 696,000 and
⁎ Corresponding author. Tel./fax: +81 82 424 7897.
E-mail address: tadashis@hiroshima-u.ac.jp (T. Shimamoto).
$600 million and $3.5 billion (Busby and Roberts, 1995). In fact, con-
taminated meat and dairy products are probably the most common
cause of human Salmonellosis worldwide (Herikstad et al., 2002).
E. coli O157:H7 is an enterohemorrhagic E. coli (EHEC) strain that is con-
sidered as a subset of Shiga toxigenic E. coli (STEC). STEC are responsible
for severe clinical symptoms, such as hemorrhagic colitis (HC) and the
potentially lethal hemolytic uremic syndrome (HUS) (Karch et al.,
2005). The number of cases of foodborne disease caused by E. coli
O157:H7 has been estimated at between 8000 and 16,000 with 400
deaths and at an estimated cost between $200 and $600 million
(Busby and Roberts, 1995). The major characteristic of EHEC linked to
its virulence is the production of one or two Shiga toxins (Stx1, Stx2)
(Paton and Paton, 1998). Diarrhea caused by Shigella spp. remains a con-
siderable public health problem in the world, especially in developing
countries, where the disease may cause 167 million episodes of diar-
rhea and over a million deaths annually (Kotloff et al., 1999). According
to the Emerging Infection Program (CDC, 2006), Shigella was the third
most reported foodborne bacterial pathogen in 2005. Shigella spp. is
spread by direct contact with an infected person, by eating contaminat-
ed food or by drinking contaminated water (WHO, 2005).
Many nationwide surveys have been conducted in developed coun-
tries to monitor the incidence of foodborne pathogens in meat and dairy
products (Bianchi et al., 2013; De Buyser et al., 2001; Delhalle et al.,

0168-1605/$ – see front matter © 2013 Elsevier B.V. All rights reserved.
http://dx.doi.org/10.1016/j.ijfoodmicro.2013.10.014
58 A.M. Ahmed, T. Shimamoto / International Journal of Food Microbiology 168–169 (2014) 57–62

2009; Jayarao et al., 2006; Little and de Louvois, 1998; Mayrhofer et al., (LIA) and Triple Sugar Iron Agar slopes and sometimes by the API 20E
2004; Rhoades et al., 2009; Thornton et al., 1993; Wang et al., 2004). system (bioMérieux, Marcy-l'Étoile, France). Typical Salmonella isolates
However, little is known about the incidence of foodborne pathogens were further serotyped by using specific Salmonella O and H agglutinat-
on a large scale in developing countries (Favier et al., 2013; Sehgal ing antisera (Difco) following the Kauffman–White serotyping scheme
et al., 2008; Tassew et al., 2010). Therefore, this study was conducted: (Grimont and Weill, 2007). Multiplex PCR was used for confirmation
i) to investigate the incidence of S. enterica, E. coli O157:H7 and Shigella of S. enterica serovars. First, DNA was prepared using boiled lysates, as
spp. in large numbers of meat and dairy products in different cities and previously described (Ahmed et al., 2009). Single colonies were
villages in Egypt, ii) to use PCR assays for S. enterica serotyping and the subcultured in Luria Bertani (LB) broth (Oxoid). An overnight bacterial
detection of verotoxin-encoding genes, stx1 and stx2, of E. coli O157:H7 culture (200 μl) was mixed with 800 μl of distilled water and boiled
and finally, iii) to identify different Shigella spp. for 10 min. The resulting solution was centrifuged and the supernatant
used as the DNA template. The DNA template was stored at −20 °C
2. Materials and methods until used. A multiplex PCR assay was used as described elsewhere
(Alvarez et al., 2004). One primer pair specific for genus Salmonella
2.1. Sample collection with a target PCR amplicon size of 204 bp and two other primer pairs
specific for the most common S. enterica serovars Enteritidis (target
Between January and September 2010, a total of 1600 food samples size 304 bp) and Typhimurium (target size 401 bp) were used. The
(800 meat products and 800 dairy products) were randomly collected primer sequences and expected PCR product sizes are shown in Table 2.
from different street vendors, butchers, retail markets and slaughter-
houses in many cities and villages in four governorates (Dakahlia, 2.2.2. Isolation and identification of E. coli O157:H7 with verotoxins
Gharbia, Damietta and Kafr el-Sheikh) in Egypt. The meat samples in- The method described by ISO 16654 (ISO, 2001) was followed for
cluded: 240 beef products, 240 carcass swabs from slaughterhouses the isolation of E. coli O157:H7. Samples (25 g or ml) were placed in
and 320 chicken products (Table 1). The dairy samples included: 480 stomacher bags containing 225 ml of modified tryptone soy broth
raw milk samples, 240 cheese samples and 80 yogurt samples (Oxoid) supplemented with 20 mg/L novobiocin (Sigma-Aldrich). One
(Table 1). All these meat and dairy products were collected in sterile ml from the pre-enriched homogenate was added to 20 μl of magnetic
bags, labeled and transferred in ice-boxes and investigated immediately beads coated with a specific antibody against O157:H7. Fifty-
after arrival at the laboratory. microliter quantities of the suspension were plated on Cefixime Tellu-
rite–Sorbitol MacConkey agar (Oxoid). The plates were incubated at
2.2. Microbiological and molecular analysis 37 °C for 22 h. Clear and colorless colonies that had the characteristic
E. coli O157:H7 morphology were selected from the plates and were fur-
2.2.1. Isolation and identification of S. enterica ther purified by streaking onto Tryptone Soy Agar (TSA). All isolates
The standard cultivation method for Salmonella isolation was carried with suspected E. coli were biochemically confirmed by using the API
out as recommended by ISO 6579 (ISO, 2002) with some modifications. 20E system (bioMérieux). Isolated colonies from TSA plates were sero-
Samples (25 g or ml) were placed in stomacher bags containing 225 ml logically screened for the presence of the serogroup O157:H7 antigen
of Buffered Peptone Water. After stomacher homogenization for 2 min using a latex agglutination test (E. coli O157 Latex Test Kit, Oxoid) ac-
at 320 rpm and overnight incubation at 37 °C, 0.1 ml aliquots were in- cording to the manufacturer's instructions. Then, specific primers for
oculated into tubes containing 10 ml Rappaport Vassiliadis (RV) broth E. coli O157:H7 and its toxins, STX1, STX2, were used for PCR assays as
and incubated for 48 h at 42 °C. Then, Xylose Lysine Deoxycholate previously described (Paton and Paton, 1998). Two primer pairs were
agar plates were inoculated from each of the RV broths and incubated used for the detection of stx1 and stx2 (including variants of stx2)
for 18–24 h at 37 °C. Suspect colonies with typical Salmonella morphol- genes and generating amplification products of 180 and 255 bp, respec-
ogy were confirmed biochemically by inoculating into Lysine Iron Agar tively and another specific primer pair was used for the detection of the
rfb (O-antigen-encoding) regions of E. coli serotype O157:H7 generating
PCR products of 259 bp. The primer sequences for these three genes and
expected PCR product sizes are shown in Table 2.
Table 1
Numbers and sources of meat and dairy product samples used in this study. 2.2.3. Isolation and identification of Shigella spp.
Products No. of samples Source For isolation of Shigella spp., a conventional culture method de-
scribed by the Food and Drug Administration (FDA) was used
I — Meat products
1 — Beef products
(Andrews and Jacobson, 2000). Samples (25 g or ml) were placed in
a — Frozen meat 160 Street vendors, retail markets stomacher bags containing 225 ml Shigella broth to which novobiocin
b — Fresh meat 80 Butchers (Sigma) was added. After stomacher homogenization for 2 min at
c — Carcass 240 Swabs from slaughterhouses 320 rpm, the samples were anaerobically incubated for 20 h at 44 and
Total 480
42 °C for Shigella sonnei and other Shigella species, respectively. Follow-
2 — Chicken products
a — Breast 160 Street vendors, retail markets ing incubation, a loop from each of the enrichment cultures was
b — Legs 160 Street vendors, retail markets streaked onto MacConkey and Salmonella–Shigella agar plates (SS),
Total 320 then incubated for 20 h at 37 °C. The presumptive Shigella isolates
Total 800 (slightly pink and translucent on MacConkey and colorless, non-
II — Dairy products
lactose fermenting on SS agar) were biochemically confirmed by using
1 — Raw milk
a — Buffalo milk 240 Private farms, animal owners, by the API 20E system (bioMérieux). All bacterial isolates were stored
street vendors, retail markets at −80 °C in LB broth containing 25% glycerol for further analysis.
b — Bovine milk 240 Private farms, animal owners, Shigella isolates were identified, at species level, by using a more recent
street vendors, retail markets
multiplex PCR assays as described by Ojha et al. (2013). This unique PCR
2 — Cheese
a — Kareish cheese 120 Street vendors technique can amplify simultaneously four specific genes to identify
b — Domiati cheese 120 Retail markets invC for Shigella genus, rfc for S. flexneri, wbgZ for S. sonnei and rfpB for
3 — Yogurt 80 Retail markets S. dysenteriae with PCR amplicon sizes of 875 bp, 537 bp, 430 bp
Total 800 and 211 bp, respectively. The primer sequences for the four genes and
Overall total 1600
expected PCR product sizes are shown in Table 2.
 A.M. Ahmed, T. Shimamoto / International Journal of Food Microbiology 168–169 (2014) 57–62 59

Table 2
Primers used in this study.

Bacterial identification Primer sequence (5′ to 3′) Target Amplicon size (bp) Reference

Salmonella spp.
Salmonella spp. ATCGCTGACTTATGCAATCG Genus Salmonella 204 Alvarez et al. (2004)
CGGGTTGCGTTATAGGTCTG
S. Enteritidis TGTGTTTTATCTGATGCAAGAGG Serovar Enteritidis 304 Alvarez et al. (2004)
TGAACTACGTTCGTTCTTCTGG
S. Typhimurium TTGTTCACTTTTTACCCCTGA A Serovar Typhimurium 401 Alvarez et al. (2004)
CCCTGACAGCCGTTAGATATT

E. coli O157:H7
E. coli O157:H7 CGGACATCCATGTGATATGG rfbO157:H7 259 Paton and Paton (1998)
TTGCCTATGTACAGCTAATCC
E. coli O157:H7 ATAAATCGCCATTCGTTGACTAC stx1 180 Paton and Paton (1998)
AGAACGCCCACTGAGATCATC
E. coli O157:H7 GGCACTGTCTGAAACTGCTCC stx2 255 Paton and Paton (1998)
TCGCCAGTTATCTGACATTCTG

Shigella spp.
Shigella spp. TGCCCAGTTTCTTCATACGC invC 875 Ojha et al. (2013)
GAAAGTAGCTCCCGAAATGC
S. flexneri TTTATGGCTTCTTTGTCGGC rfc 537 Ojha et al. (2013)
CTGCGTGATCCGACCATG
S. sonnei TCTGAATATGCCCTCTACGCT wbgZ 430 Ojha et al. (2013)
GACAGAGCCCGAAGAACCG
S. dysenteriae TCTCAATAATAGGGAACACAGC rfpB 211 Ojha et al. (2013)
CATAAATCACCAGCAAGGTT

3. Results
3.1. General incidence of S. enterica, E. coli O157:H7 and Shigella spp. in
meat and dairy products
In this study, S. enterica were detected in 4.3% of the 1600 meat
and dairy products analyzed (Table 3). The incidence of S. enterica was
6.6% in meat products and 2.0% in dairy products. S. enterica serovars,
S. enterica serovar Typhimurium, S. enterica serovar Enteritidis,
S. enterica serovar Infantis and non-typable serovars were detected
in 1.8%, 1.4%, 1.0% and 0.1% of food samples, respectively. All
S. enterica isolates and serovars Typhimurium and Enteritidis were
confirmed by PCR. E. coli O157:H7 were detected in 3.4% of 1600
food samples analyzed. Of these, 1.6% contained only stx1, 0.5%
contained only stx2 and 1.3% contained stx1 and stx2. In contrast to
Salmonella, the incidence of E. coli O157:H7 was higher in dairy prod-
ucts (3.6%) than in meat products (3.1%). Shigella spp. were detected
in 1.7% of 1600 food samples analyzed. S. flexneri, S. sonnei and
S. dysenteriae were detected in 1.2%, 0.4% and 0.1% of samples respec-
tively. The incidence of Shigella spp. was higher in meat products
(2.0%) than in dairy products (1.4%) (Table 3).
3.2. Incidence of S. enterica, E. coli O157:H7 and Shigella spp. in
meat products
3.2.1. Incidence of S. enterica, E. coli O157:H7 and Shigella spp. in
beef meats
S. enterica were detected in 4.9% of beef samples. S. enterica serovar
Typhimurium, S. enterica serovar Enteritidis, S. enterica serovar Infantis
and non-typable serovars were detected in 2.5%, 1.5%, 0.6% and 0.25%

Table 3
Incidence of Salmonella enterica, E. coli O157:H7 and Shigella spp. in meat and dairy products.

Bacteria Meat products (800) Total Dairy products (800) Total Overall
(800) (800) total
Beef samples Chicken samples Raw milk Cheese Yogurt
(480) (320) (480) (240) (80)

Frozen Fresh Carcasses Breasts Legs Buffalo Cow Kareish Domiati

(160) (80) (240) (160) (160) (240) (240) (120) (120)

Salmonella enterica
S. Typhimurium 1 (0.13%) 7 (0.9%) 12 (1.5%) 0 (0.0%) 2 (0.25%) 22 (2.7%) 3 (0.4%) 1 (0.13%) 2 (0.25%) 0 (0.0%) 0 (0.0%) 6 (0.8%) 28 (1.7%)
S. Enteriditis 2 (0.25%) 6 (0.75%) 4 (0.5%) 0 (0.0%) 5 (0.63%) 17 (2.1%) 2 (0.25%) 1 (0.13%) 1 (0.13%) 1 (0.13%) 0 (0.0%) 5 (0.6%) 22 (1.4%)
S. Infantis 1 (0.13%) 1 (0.13%) 3 (0.4%) 2 (0.25%) 4 (0.5%) 11 (1.4%) 3 (0.4%) 2 (0.25%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 5 (0.6%) 16 (1.0%)
S. non-typable 0 (0.0%) 1 (0.13%) 1 (0.13%) 0 (0.0%) 1 (0.13%) 3 (0.4%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 3 (0.2%)
Total 4 (0.5%) 15 (1.9%) 20 (2.5%) 2 (0.25%) 12 (1.5%) 53 (6.6%) 8 (1.0%) 4 (0.5%) 3 (0.4%) 1 (0.13%) 0 (0.0%) 16 (2.0%) 69 (4.3%)

E. coli O157:H7
E. coli O157 (stx1) 0 (0.0%) 7 (0.9%) 5 (0.63%) 0 (0.0%) 1 (0.13%) 13 (1.6%) 5 (0.6%) 2 (0.25%) 4 (0.5%) 1 (0.13%) 0 (0.0%) 12 (1.5%) 25 (1.6%)
E. coli O157 (stx2) 0 (0.0%) 2 (0.25%) 1 (0.13%) 0 (0.0%) 2 (0.25%) 5 (0.6%) 2 (0.25%) 0 (0.0%) 1 (0.13%) 0 (0.0%) 0 (0.0%) 3 (0.4%) 8 (0.5%)
E. coli O157 0 (0.0%) 4 (0.5%) 2 (0.25%) 0 (0.0%) 1 (0.13%) 7 (0.9%) 9 (1.1%) 2 (0.25%) 3 (0.4%) 0 (0.0%) 0 (0.0%) 14 (1.8%) 21 (1.3%)
(stx1 + stx2)
Total 0 (0.0%) 13 (1.6%) 8 (1.0%) 0 (0.0%) 4 (0.5%) 25 (3.1%) 16 (2.0%) 4 (0.5%) 8 (1.0%) 1 (0.13%) 0 (0.0%) 29 (3.6%) 54 (3.4%)

Shigella spp.
S. flexneri 1 (0.13%) 6 (0.75%) 2 (0.25%) 0 (0.0%) 2 (0.25%) 11 (1.4%) 2 (0.25%) 1 (0.13%) 4 (0.5%) 0 (0.0%) 0 (0.0%) 7 (0.9%) 18 (1.2%)
S. sonnei 0 (0.0%) 2 (0.25%) 1 (0.13%) 0 (0.0%) 0 (0.0%) 3 (0.4%) 1 (0.13%) 0 (0.0%) 3 (0.4%) 0 (0.0%) 0 (0.0%) 4 (0.5%) 7 (0.4%)
S. dysenteriae 0 (0.0%) 1 (0.13%) 1 (0.13%) 0 (0.0%) 0 (0.0%) 2 (0.25%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 2 (0.1%)
Total 1 (0.13%) 9 (1.1%) 4 (0.5%) 0 (0.0%) 2 (0.25%) 16 (2.0%) 3 (0.4%) 1 (0.13%) 7 (0.9%) 0 (0.0%) 0 (0.0%) 11 (1.4%) 27 (1.7%)
Overall total 5 (0.6%) 37 (4.6%) 32 (4.0%) 2 (0.25%) 18 (2.2%) 94 (11.7%) 27 (2.6%) 9 (1.1%) 18 (2.2%) 2 (0.25%) 0 (0.0%) 56 (7.0%) 150 (9.4%)
60 A.M. Ahmed, T. Shimamoto / International Journal of Food Microbiology 168–169 (2014) 57–62
of beef samples respectively. E. coli O157:H7 was detected in 2.6% of
beef samples. Shigella spp. were detected in 1.8% of beef samples
(Table 3).
3.2.2. Incidence of S. enterica, E. coli O157:H7 and Shigella spp. in chicken
meats
S. enterica were detected in 1.8% of chicken meat samples. S. enterica
serovar Infantis, S. enterica serovar Enteritidis, S. enterica serovar
Typhimurium and non-typable serovars were detected in 0.75%,
0.63%, 0.25% and 0.13% of chicken meat samples respectively. E. coli
O157:H7 was detected in 0.5% of chicken meat samples. Finally,
Shigella spp. were detected in 0.25% of chicken meat samples
(Table 3).
3.3. Incidence of S. enterica, E. coli O157:H7 and Shigella spp. in
dairy products
3.3.1. Incidence of S. enterica, E. coli O157:H7 and Shigella spp. in raw
milk samples
S. enterica was detected in 1.5% of raw milk samples. S. enterica
serovar Infantis, S. enterica serovar Typhimurium, S. enterica serovar
Enteritidis and non-typable serovars were detected in 0.63%, 0.5% and
0.4% of raw milk samples respectively. E. coli O157:H7 was detected in
2.5% of raw milk samples. Finally, Shigella spp. were detected in 0.5%
of raw milk samples (Table 3).
3.3.2. Incidence of S. enterica, E. coli O157:H7 and Shigella spp. in cheeses
S. enterica was detected in 0.5% of cheese samples. S. enterica serovar
Typhimurium was detected in 0.25% of samples and also, S. enterica
serovar Enteritidis was detected in 0.25% of samples. E. coli O157:H7
was detected in 1.1% of cheese samples. Finally, Shigella spp. were
detected in 0.9% of cheese samples (Table 3).
3.3.3. Incidence of S. enterica, E. coli O157:H7 and Shigella spp. in Yogurt
All 80 yogurt samples examined in this study were negative for S.
enterica, E. coli O157:H7 and Shigella spp. (Table 3).
4. Discussion
Food of animal origin has been identified as the main vehicle for the
transmission of foodborne pathogens to humans (EFSA, 2013). Three
major foodborne pathogens affecting people worldwide are S. enterica,
E. coli O157:H7 and Shigella spp. (CDC, 2010). The purpose of this
study was to monitor, on a large scale, the prevalence of these important
pathogens in meat and dairy products in Egypt by using the convention-
al culturing methods and PCR assays. S. enterica has been the leading
foodborne illness-causing bacterium. In the United States, analysis of
epidemiological data on foodborne disease outbreaks indicated that
Salmonella is the most common bacterial etiologic agent, accounting
for 52% of outbreaks attributed to bacteria (CDC, 2009). In this study,
S. enterica was detected in 4.3% of all meat and dairy product samples
analyzed. S. enterica serovar Typhimurium was the most common
serovar (1.8%), followed by S. enterica serovar Enteritidis (1.4%). Our re-
sults are higher than those recorded in China, where the prevalence
of Salmonella in food products was 3.32% in 2001 and 3.55% in 2002
(Wang et al., 2004) and lower than those recently recorded in
Argentina, where Salmonella strains were detected in 6.3% of sam-
ples from foods of animal origin (Favier et al., 2013). Among more
than 2500 Salmonella serotypes, S. Typhimurium and S. Enteriditis
accounted for 46 and 24% of outbreaks respectively (CDC, 2009).
Additionally, S. Enteritidis and S. Typhimurium have been the serovars
most frequently isolated from humans worldwide (Hendriksen et al.,
2011). S. enterica prevalence in retail meat also varies from one country
to another. In our study, S. enterica was detected in 6.6% of meat
products; in the United Kingdom, only 1.8% of beef samples
were positive for S. enterica (Mayrhofer et al., 2004). Also in the
United Kingdom, a widespread outbreak of Salmonellosis due to
S. enterica Typhimurium implicated butchers retailing raw and cooked
meats where cross-contamination and/or inadequate cooking of the
meat had occurred (Thornton et al., 1993). In contrast, a study from
Vietnam found a higher prevalence (N 60% positive) of S. enterica on
retail beef samples (Van et al., 2007). In Japan, S. enterica were detected
in 14.5% of retail chicken meat samples (Ahmed et al., 2009). In Belgium,
S. enterica Typhimurium was the most frequently isolated serotype in
minced meat at retail level ranging from 0.3 to 4.3% of samples
(Delhalle et al., 2009). In our study, S. enterica serovar Infantis was de-
tected in 0.75% of chicken meat samples. This is similar to the incidence
of S. enterica serovar Infantis (0.6%) in chicken portions in Turkey
(Centinkaya et al., 2008).
An overview of foodborne disease reports from seven countries has
indicated that milk and milk products were implicated in between 1
and 5% of the total number of bacterial outbreaks (De Buyser et al.,
2001). Several large outbreaks of foodborne disease due to the con-
sumption of raw milk cheese have been reported (West, 2008; FDA,
2010). To assess the microbiological safety of dairy products, we exam-
ined 800 different dairy products from sources and locations in Egypt. In
this study, S. enterica was detected in 2.0% of dairy product samples
(1.5% raw milk and 0.5% cheese) with S. enterica serovar Typhimurium
the most commonly isolated. Milk and dairy products are at risk of con-
tamination with Salmonella before leaving the farm, usually as a result of
inadvertent fecal contamination during the milking process (Edrington
et al., 2008). Previous reports also suggested that milk and its products
accounted for less than 5% of all food poisoning related outbreaks of
S. enterica infections in China (Chen et al., 2008). In the United States,
S. enterica was detected in 6% of raw milk samples and the most com-
mon serovar was S. enterica serovar Typhimurium (Jayarao et al.,
2006). In England and Wales, S. enterica is the pathogen most commonly
associated with milk and milk product-borne outbreaks usually in
a household, of which 85% were associated with S. Typhimurium
(De Buyser et al., 2001). More recently in Italy, 0.3% of the raw milk
samples tested were positive for S. enterica (Bianchi et al., 2013).
Soft cheeses made from unpasteurized or insufficiently pasteurized
milk may also be contaminated with Salmonella and cause large out-
breaks of Salmonellosis in humans (De Valk et al., 2000). In our study,
S. enterica was detected in 0.5% of cheese samples including S. enterica
serovar Typhimurium and S. enterica serovar Enteritidis. In France,
a community-wide outbreak of S. enterica serovar Typhimurium
infection was associated with eating a raw milk soft cheese. In the
Netherlands, S. enterica Typhimurium was associated with hard
cheese produced from unpasteurized cow's milk (van Duynhoven
et al., 2009). The primary method for serotyping members of the
genus Salmonella is to use a combination of surface antigens O, H,
and VI according to the Kaufmann–White scheme (Popoff, 2001).
However, Salmonella antisera are expensive and are also not avail-
able in most laboratories. In this study, initially we performed
serotyping by using the conventional methods using polyvalent
and monovalent specific antisera for S. enterica. Then, multiplex
PCR results showed that all S. enterica isolates, at genus level, and
all S. enterica serovar Typhimurium and S. enterica serovar Enteritidis
results at serovar level were positive with 100% sensitivity. PCR as-
says were previously used for serotyping S. enterica (Alvarez et al.,
2004; Ahmed and Shimamoto, 2012). Therefore, PCR has become a
valuable tool for investigating foodborne outbreaks and identifying
the responsible etiological agents.
E. coli O157:H7 can potentially enter the human food chain from a
number of animal sources, most commonly by contamination of meat
with feces or intestinal contents after slaughter (Paton and Paton,
1998). Ground beef may pose a particular risk because of the prevalence
of highly pathogenic STEC strains such as O157:H7 (Paton and Paton,
1998). In this study, E. coli O157:H7 was detected in 3.1% of meat prod-
ucts. In the United Kingdom, E. coli O157:H7 was isolated from 0 to 4% of
raw meat products (Little and de Louvois, 1998). However, in our study,
 A.M. Ahmed, T. Shimamoto / International Journal of Food Microbiology 168–169 (2014) 57–62
E. coli O157:H7 was detected at a higher rate in fresh beef (1.6%) than on
carcasses (1.0%). For chicken meat products in Argentina, a low number
of carcasses were contaminated with STEC (3.3%) in comparison with
retail chicken products from different shops (5%) (Alonso et al., 2012).
Additionally, Etcheverría et al. (2010) found that the proportion
of E. coli O157:H7-contaminated bovine meat increased between
the slaughterhouse and the butchery, increasing the risk of cross-
contamination during handling at the butchery. Moreover, cross-
contamination from raw meat and undercooking of contaminated
meat or meat products has been reported from butchers producing
ready-to-eat cooked foods that were implicated in cases of infection
due to E. coli O157:H7 (Davis and Brogan, 1995). In general, the preva-
lence of STEC has been found to decline during processing at the abattoir
after the hides are removed, so that the final prevalence on chilled car-
cass sides is around 0.4% (Rhoades et al., 2009). Shiga toxins (Stx1 and
Stx2) are highly potent cytotoxins considered as the critical virulence
factor for E. coli O157:H7. In this study, E. coli O157:H7 containing only
stx1 was detected at a higher rate (1.6% of samples) than those contain-
ing only stx2 (0.5%), while samples containing both stx1 and stx2 were
detected at a 1.3% rate. These results are in contrast to those recorded
in Argentina where stx2 was the predominant gene over stx1 (Alonso
et al., 2012). This is important because stx2-producing strains are
more connected with HUS than stx1-producing strains (Paton and
Paton, 1998). Other proven food sources of E. coli O157:H7 infections in-
clude raw or inadequately pasteurized dairy products (Paton and Paton,
1998). In our study, E. coli O157:H7 was detected in 2.5% of raw milk
samples and 1.1% of cheese samples. In India, E. coli O157 were isolated
from 1.8% of milk and milk product samples (Sehgal et al., 2008). In
Ireland, E. coli O157:H7 was detected in 3.1% of Irish dairy farm herds
and their milk (Lynch et al., 2012). More recently, in Italy, 0.2% of the
raw milk samples tested were positive for E. coli O157:H7 (Bianchi
et al., 2013). The incidence of E. coli O157:H7 carrying stx–rfbE O157
was 0.3% in raw-milk cheeses screened in France (Madic et al., 2011).
In Canada, E. coli O157 was isolated from unpasteurized gouda cheese
made from cow's milk despite all on-farm milk tests being negative
for E. coli O157:H7, thus indicating post-manufacturing contamination
(Hall and French, 2011).
Shigellosis is endemic in most developing countries and is estimated
to cause at least 80 million cases of bloody diarrhea and 700,000
deaths each year (WHO, 2005). Ninety-nine percent of infections
caused by Shigella spp. occur in developing countries; Egypt was listed
as the most often reported destination for travel-associated Shigella
spp. in England, Wales and Northern Ireland between 2007 and 2009
(Anonymous, 2011). Each year, significant numbers of shigellosis out-
breaks result from the consumption of contaminated foods (Mead
et al., 1999). Food contamination usually results from an infected person
using improper preparation techniques after the food has been proc-
essed (Lampel et al., 2000). A review of 816 foodborne outbreaks asso-
ciated with infected food workers showed that 4% involved Shigella
(Greig et al., 2007). In our study, Shigella spp. were detected in 1.7%
of the 1600 food samples analyzed. The incidence of Shigella spp. was
higher in meat products (2.0%) than in dairy products (1.4%). S. flexneri
was the most common spp. (1.2%), followed by S. sonnei (0.4%) and
finally, S. dysenteriae (0.1%). In Egypt, a community-based study involv-
ing 2566 persons showed that S. flexneri was the most common
serogroup identified, found in 55% of cases, followed by S. sonnei
(22%), S. dysenteriae (19%), and S. boydii (2%) (Abu-Elyazeed et al.,
2004). This indicates a correlation between the incidence of different
species of Shigella in humans and in food products in Egypt. Shigella
spp. was detected in 0.6% of meat products in Ethiopia (Tassew et al.,
2010), although a study in Turkey showed that Shigella was not isolated
from any meat or dairy products (Centinkaya et al., 2008). Because
animals are not considered a common reservoir for Shigella spp., it
was believed that during retail meat processing, Shigella spp. present
on the surface of the food animal tissue may have been transferred to
meat surfaces via workers' hands and knives (Jackson et al., 2001).
61
Conversely, in our study, Shigella spp. were detected in 0.5% of raw
milk samples and 0.9% of Kareish cheese samples. Few publications
were found to have documented outbreaks of shigellosis in humans
due to dairy products. In Europe, two large outbreaks of gastroenteritis
occurring due to S. sonnei were linked to milk products of bovine
origin. In one study, this occurred after the consumption of fresh
pasteurized milk cheese because of cross-contamination after pas-
teurization (García-Fulgueiras et al., 2001). In another study, un-
pasteurized cheese was reported as the likely vehicle of Shigella
infection (Zagrebneviene et al., 2005).
5. Conclusions
The incidence of S. enterica, E. coli O157:H7 and Shigella spp. in meat
and dairy products in Africa was determined in a large-scale survey. Our
work has demonstrated that the incidence of these three pathogens is
more common in meat products than in dairy products. The presence
of these pathogens can be due to contamination taking place during
meat processing at the slaughterhouse, during milking at dairy farms
or because of poor handling of meat, milk and cheese by retailers.
In Egypt, domestically-produced raw milk cheeses are popular with
consumers, so their availability is considerably higher than cheeses
made from pasteurized milk. Consequently, educating employees, re-
tailers and consumers on the appropriate handling and storage of
meat and dairy products is essential to effectively prevent contamina-
tion. Simple intervention strategies, such as promoting hand washing
with soap and good hygienic practices at the slaughterhouses, process-
ing plants and retailer shops, can have a sound practical impact on pub-
lic health. Health education for the general population is required by
regulatory authorities where the sale of raw milk and raw milk products
is permitted. A strong science-based approach that addresses all the
issues involved in continuing to improve food safety and public health
is necessary to prevent foodborne illnesses. The strengthening of food
control systems including foodborne disease surveillance and food
monitoring is required, especially in developing countries for the pre-
vention, detection and control of foodborne illnesses.
Acknowledgments
This work was supported by a young researcher grant to A.M.A. from
the Science and Technology Development Fund (STDF), Ministry of
Scientific Research Egypt.
Transparency declarations
None to declare.
References
Abu-Elyazeed, R.R., Wierzba, T.F., Frenck, R.W., Rao, M.R., Savarino, S.J., Kamal, K.A.,
Peruski, L.F., Abdel-Messih, I.A., El-Alkamy, S.A., Naficy, A.B., Clemens, J.D., 2004.
Epidemiology of Shigella-associated diarrhea in rural Egyptian children. Am. J. Trop.
Med. Hyg. 71, 367–372.
Ahmed, A.M., Shimamoto, T., 2012. Genetic analysis of multiple antimicrobial resistance
in Salmonella isolated from diseased broilers in Egypt. Microbiol. Immunol. 56,
254–261.
Ahmed, A.M., Shimabukuro, H., Shimamoto, T., 2009. Isolation and molecular characteri-
zation of multidrug-resistant strains of Escherichia coli and Salmonella from retail
chicken meat in Japan. J. Food Sci. 74, M405–M410.
Alonso, M.Z., Lucchesi, P.M.A., Rodríguez, E.M., Parma, A.E., Padola, N.L., 2012. Entero-
pathogenic (EPEC) and Shigatoxigenic Escherichia coli (STEC) in broiler chickens
and derived products at different retail stores. Food Control 23, 351–355.
Alvarez, J., Sota, M., Vivanco, A.B., Perales, I., Cisterna, R., Rementeria, A., Garaizar, J., 2004.
Development of a multiplex PCR technique for detection and epidemiological typing
of Salmonella in human clinical samples. J. Clin. Microbiol. 42, 1734–1738.
Andrews, W.H., Jacobson, A., 2000. Shigella, Food and Drug Administration, Bacteriological
Analytical Manual, 8th ed. AOAC International, Gaithersburg, MD, USA (Revision A).
Anonymous, 2011. Shigella — 2009. Travel and Migrant Health Section, Health Protection
Agency, Colindale, UK (Published November 2011 Available at http://www.hpa.org.
uk/webc/HPAwebFile/HPAweb_C/1317131651978 (Accessed 11th April 2013)).
Bianchi, D.M., Barbaro, A., Gallina, S., Vitale, N., Chiavacci, L., Lucia, M.C., 2013. Monitoring
of foodborne pathogenic bacteria in vending machine raw milk in Piedmont, Italy.
Food Control 32, 435–439.
62 A.M. Ahmed, T. Shimamoto / International Journal of Food Microbiology 168–169 (2014) 57–62
Busby, J.C., Roberts, T., 1995. ERS estimates U.S. foodborne disease costs. J. Food Rev. 18,
37–42.
CDC, 2006. Preliminary FoodNet data on the incidence of infection with pathogens
transmitted commonly through food—10 states, United States, 2005. Morb. Mortal.
Wkly Rep. 55, 392–395.
CDC, 2009. Surveillance for foodborne disease outbreaks—United States, 2006. Morb.
Mortal. Wkly Rep. 58, 609–615.
CDC, 2010. Preliminary FoodNet data on the incidence of infection with pathogens
transmitted commonly through food—10 states, 2009. Morb. Mortal. Wkly Rep.
59, 418–422.
CDC, 2013. Incidence and trends of infection with pathogens transmitted commonly
through food — foodborne diseases active surveillance network, 10 U.S. sites,
1996–2012. Wkly Rep. 62 (15), 283–287.
Centinkaya, F., Cibik, G., Soyuteniz, E., Ozkin, C., Kayali, R., Levent, B., 2008. Shigella
and Salmonella contamination in various foodstuffs in Turkey. Food Control 19,
1059–1063.
Chen, Y., Liu, X.M., Fan, Y.X., Wang, M.Q., 2008. Foodborne diseases outbreaks in 2004—
report of National Foodborne Diseases Surveillance Network in China. Chin. J. Food
Hyg. 20, 503–506.
Davis, B.S., Brogan, R.T., 1995. A widespread community outbreak of E. coli O157 infection
in Scotland. Public Health 109, 381–388.
de Buyser, M.L., Dufour, B., Maire, M., Lafarge, V., 2001. Implication of milk and milk prod-
ucts in food-borne diseases in France and in different industrialised countries. Int.
J. Food Microbiol. 67, 1–17.
De Valk, H., Delarocque-Astagneau, E., Colomb, G., Ple, S., Godard, E., Vaillant, V.,
Haeghebaert, S., Bouvet, P., Grimont, F., Grimont, P., Desenclos, J.C., 2000. A
community-wide outbreak of Salmonella enterica serotype Typhimurium infection
associated with eating a raw milk soft cheese in France. Epidemiol. Infect. 124, 1–7.
Delhalle, L., Saegerman, C., Farnir, F., Korsak, N., Maes, D., Messens, W., Sadeleer, L.D.,
Zutter, L.D., Daube, G., 2009. Salmonella surveillance and control at post-harvest in
the Belgian pork meat chain. Food Microbiol. 26, 265–271.
Edrington, T.S., Ross, T.T., Callaway, T.R., Martinez, C.H., Hume, M.E., Genovese, K.J., Poole,
T.L., Anderson, R.C., Nisbet, D.J., 2008. Investigation into the seasonal Salmonellosis in
lactating dairy cattle. Epidemiol. Infect. 136, 381–390.
EFSA (European Food Safety Authority), European Centre for Disease Prevention and
Control (ECDC), 2013. The European Union summary report on trends and
sources of zoonoses, zoonotic agents and food-borne outbreaks in 2011. EFSA J. 11
(4), 3129. http://dx.doi.org/10.2903/j.efsa.2013.3129 (250 pp.).
Etcheverría, A.I., Padola, N.L., Sanz, M.E., Polifroni, R., Krüger, A., Passucci, J., 2010.
Occurrence of Shiga toxin-producing E. coli (STEC) on carcasses and retail beef
cuts in the marketing chain of beef in Argentina. Meat Sci. 86, 418–421.
Favier, G.I., Cecilia, S.M., Estrada, L., Otero, V.L., Escudero, M.E., 2013. Prevalence, antimi-
crobial susceptibility, and molecular characterization by PCR and pulsed field gel
electrophoresis (PFGE) of Salmonella spp. isolated from foods of animal origin in
San Luis, Argentina. Food Control 29, 49–54.
FDA (Food and Drug Administration), 2010. FDA: Consumers Should Not Eat Sally
Jackson Cheese Due to risk of Escherichia coli O157:H7. Available at http://
www.fda.gov/NewsEvents/Newsroom/PressAnnouncements/2010/ucm237381.
htm (Accessed 12th April 2013).
García-Fulgueiras, A., Sánchez, S., Guillén, J.J., Marsilla, B., Aladueña, A., Navarro, C., 2001.
A large outbreak of Shigella sonnei gastroenteritis associated with consumption of
fresh pasteurised milk cheese. Eur. J. Epidemiol. 17, 533–538.
Greig, J.D., Todd, E.C., Bartleson, C.A., Michaels, B.S., 2007. Outbreaks where food workers
have been implicated in the spread of foodborne disease. Part 1. Description of the
problem, methods, and agents involved. J. Food Prot. 70, 1752–1761.
Grimont, P.A.D., Weill, F.-X., 2007. Antigenic Formulae of the Salmonella Serovars, 9th ed.
Institut Pasteur, Paris, France.
Hall, W.F., French, N., 2011. An assessment of available information on raw milk cheeses
and human disease 2000–2010. Technical Paper No: 2011/58. Ministry of Agriculture
and Forestry, New Zealand (Available at http://www.foodsafety.govt.nz/elibrary/
industry/raw-cheese/ (Accessed 12th April 2013)).
Hendriksen, R.S., Vieira, A.R., Karlsmose, S., Lo Fo Wong, D.M., Jensen, A.B., Wegener, H.C.,
Aarestrup, F.M., 2011. Global monitoring of Salmonella serovar distribution from the
world health organization global foodborne infections network country data bank:
results of quality assured laboratories from 2001 to 2007. Foodborne Pathogens
and Disease 8, 887–900.
Herikstad, H., Motarjemi, Y., Tauxe, R.V., 2002. Salmonella surveillance, a global survey of
public health serotyping. Epidemiol. Infect. 129, 1–8.
ISO, 2002. ISO 6579: 2002 Microbiology of Food and Animal Feeding Stuffs — Horizontal
Method for the Detection of Salmonella spp. ISO, Geneva, Switzerland.
ISO (International Organization for Standardization), 2001. ISO 16654: 2001 Microbiology
of Food and Animal Feeding Stuff — Horizontal Method for the Detection of
Escherichia coli O157. ISO, Geneva, Switzerland.
Jackson, T.C., Marshall, D.L., Acuff, G.R., Dickson, J.S., 2001. Meat, poultry, and seafood, In:
Doyle, M.P., Beuchat, L.R., Montville, T.J. (Eds.), Food Microbiology: Fundamentals and
Frontiers, 2nd ed. ASM Press, Washington DC, USA, pp. 91–109.
Jayarao, B.M., Donaldson, S.C., Straley, B.A., Sawant, A.A., Hegde, N.V., Brown, J.L., 2006.
A survey of foodborne pathogens in bulk tank milk and raw milk consumption
among farm families in Pennsylvania. J. Dairy Sci. 89, 2451–2458.
Karch, H., Tarr, P.I., Bielaszewska, M., 2005. Enterohaemorrhagic Escherichia coli in human
medicine. Int. J. Med. Microbiol. 295, 405–418.
Kotloff, K.L., Winickoff, J.P., Ivanoff, B., Clemens, J.D., Swerdlow, D.L., Sansonetti, P.J., Adak,
G.K., Levine, M.M., 1999. Global burden of Shigella infections: implications for vaccine
development and implementation of control strategies. Bull. World Health Organ. 77,
651–666.
Lampel, K.A., Sandlin, R.C., Formal, S., 2000. Shigella. In: Robinson, R.K., Batt, C.A.,
Patel, P.D. (Eds.), Encyclopedia of Food Microbiology. Academic Press, London,
pp. 2015–2020.
Little, C.L., de Louvois, J., 1998. The microbiological examination of butchery products and
butchers' premises in the United Kingdom. J. Appl. Microbiol. 85, 177–186.
Lynch, M.J., Fox, E.M., O'Connor, L., Jordan, K., Murphy, M., 2012. Surveillance of
verocytotoxigenic Escherichia coli in Irish bovine dairy herds. Zoonoses Public
Health 59, 264–271.
Madic, J., Vingadassalon, N., de Garam, C.P., Marault, M., Scheutz, F., Brugère, H., Jamet, E.,
Auvray, F., 2011. Detection of Shiga toxin-producing Escherichia coli serotypes O26:
H11, O103:H2, O111:H8, O145:H28, and O157:H7 in raw-milk cheeses by using
multiplex real-time PCR. Appl. Environ. Microbiol. 77, 2035–2041.
Mayrhofer, S., Paulsen, P., Smulders, F.J.M., Hilbert, F., 2004. Antimicrobial resistance
profile of five major food-borne pathogens isolated from beef, pork and poultry. Int.
J. Food Microbiol. 97, 23–29.
Mead, P.S., Slutsker, L., Dietz, V., Mccaig, L.F., Bresee, J.S., Shapiro, C., 1999. Food-related
illness and death in the United States. Emerg. Infect. Dis. 5, 607–625.
Ojha, S.C., Yean Yean, C., Ismail, A., Banga Singh, K.K., 2013. A pentaplex PCR assay for the
detection and differentiation of Shigella species. Biomed. Res. Int. http://dx.doi.org/
10.1155/2013/412370.
Oliver, S.P., Jayarao, B.M., Almeida, R.A., 2005. Foodborne pathogens in milk and the dairy
farm environment: food safety and public health implications. Foodborne Pathog. Dis.
2, 115–129.
Paton, A.W., Paton, J.C., 1998. Detection and characterization of Shiga toxigenic Escherichia
coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA,
rfbO111, and rfbO157. J. Clin. Microbiol. 36, 598–602.
Popoff, M.Y., 2001. Antigenic formulas of the Salmonella serovars, WHO Collaborating
Centre for Reference and Research on Salmonella8th ed. Institut Pasteur, Paris.
Rhoades, J.R., Duffy, G., Koutsoumanis, K., 2009. Prevalence and concentration of
verocytotoxigenic Escherichia coli, Salmonella enterica and Listeria monocytogenes
in the beef production chain: a review. Food Microbiol. 26, 357–376.
Sehgal, R., Kumar, Y., Kumar, S., 2008. Prevalence and geographical distribution of
Escherichia coli O157 in India 10 year survey. Trans. R. Soc. Trop. Med. Hyg. 102,
380–383.
Tassew, H., Abdissa, A., Beyene, G., Gere-Selassie, S., 2010. Microbial flora and foodborne
pathogens on mince meat and their susceptibility to antimicrobial agents. Ethiop.
J. Health Sci. 20, 137–143.
Thornton, L., Gray, S., Bingham, P., 1993. The problems of tracing a geographically
widespread outbreak of Salmonellosis from a commonly eaten food: Salmonella
typhimurium DT193 in North West England and North Wales in 1991. Epidemiol.
Infect. 111, 465–471.
Van Duynhoven, Y.T., Isken, L.D., Borgen, K., Besselse, M., Soethoudt, K., Haitsma, O.,
Mulder, B., Notermans, D.W., De Jonge, R., Kock, P., Van Pelt, W., Stenvers, O., Van
Steenbergen, J., 2009. A prolonged outbreak of Salmonella Typhimurium infection
related to an uncommon vehicle: hard cheese made from raw milk. Epidemiol. Infect.
137, 1548–1557.
Van, T.T.H., Moutafis, G., Istivan, T., Tran, L.T., Coloe, P.J., 2007. Detection of Salmonella spp.
in retail raw food samples from Vietnam and characterization of their antibiotic resis-
tance. Appl. Environ. Microbiol. 73, 6885–6889.
Wang, M., Ran, L., Wang, Z., Li, Z., 2004. Study on national active monitoring for food
borne pathogens and antimicrobial resistance in China 2001. J. Hyg. Res. 33,
49–54.
West, H.G., 2008. Food fears and raw-milk cheese. Appetite 51, 25–29.
WHO, 2010. Sixty-third World Health Assembly. Document WHA63/A63/11.
Available at http://apps.who.int/gb/ebwha/pdf_files/WHA63/A63_11-en.pdf
(Accessed 12th April 2013).
WHO (World Health Organization), 2005. Shigellosis: disease burden, epidemiology and
case management. Wkly Epidemiol. Rec. 80, 94–99.
Zagrebneviene, G., Jasulaitiene, V., Morkunas, B., Tarbunas, S., Ladygaite, J., 2005.
Shigella sonnei outbreak due to consumption of unpasteurised milk curds in
Vilnius, Lithuania, 2004. Euro Surveill. 10 (48).