See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/287798814

Wound healing effect of electrospun Silk fibroin nanomatrix in burn-model

Article  in  International journal of biological macromolecules · December 2015

DOI: 10.1016/j.ijbiomac.2015.12.055

CITATIONS READS

41 612

11 authors, including:

Hyung Woo Ju Ok Joo Lee

Hallym University Medical Center Hallym University
53 PUBLICATIONS   534 CITATIONS    84 PUBLICATIONS   693 CITATIONS   

SEE PROFILE SEE PROFILE

Jung Min Lee B. M. Moon

Hallym University Korea Institute of Industrial Technology
274 PUBLICATIONS   4,422 CITATIONS    77 PUBLICATIONS   453 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Scaffold Fluorescence Imaging, 3D printing View project

Microplasmas for Biomedical Applications View project

All content following this page was uploaded by ChanHum Park on 30 May 2018.

The user has requested enhancement of the downloaded file.

 International Journal of Biological Macromolecules 85 (2016) 29–39

Contents lists available at ScienceDirect

International Journal of Biological Macromolecules

journal homepage: www.elsevier.com/locate/ijbiomac

Research paper

Wound healing effect of electrospun silk fibroin nanomatrix in

burn-model
Hyung Woo Ju a , Ok Joo Lee a , Jung Min Lee a , Bo Mi Moon a , Hyun Jung Park a , Ye Ri Park a ,
Min Chae Lee a , Soo Hyeon Kim a , Janet Ren Chao b , Chang Seok Ki c , Chan Hum Park a,d,∗
a
Nano-Bio Regenerative Medical Institute, Hallym University, 1, Hallymdaehak-gil, Chuncheon, Gangwon-do 200-702, Republic of Korea
b
School of Medicine, George Washington University, Washington, D.C. 20037, USA
c
Department of Biomedical Engineering, Purdue School of Engineering, Indiana-University Purdue-University at Indianapolis, IN 46202, USA
d
Department of Otorhinolaryngology—Head and Neck Surgery, Chuncheon Sacred Heart Hospital, School of Medicine, Hallym University, 77, Sakju-ro,
Chuncheon, Gangwon-do 200-704, Republic of Korea

a r t i c l e i n f o a b s t r a c t

Article history: Silk fibroin has recently become an important biomaterial for tissue engineering application. In this study,
Received 6 October 2015 silk fibroin nanomatrix was fabricated by electrospinning and evaluated as wound dressing material in a
Received in revised form burn rat model. The wound size reduction, histological examination, and the quantification of transform-
15 December 2015
ing growth factor TGF-␤1 and interleukin IL-1␣, 6, and 10 were measured to evaluate the healing effects.
Accepted 16 December 2015
Available online 21 December 2015
The silk fibroin nanomatrix treatment exhibited effective performance in decreasing the wound size and
epithelialization. Histological finding also revealed that the deposition of collagen in the dermis was orga-
nized by covering the wound area in the silk fibroin nanomatrix treated group. The expression level of
Keywords:
Silk fibroin pro-inflammatory cytokine (IL-1␣) was significantly reduced in the injured skin following the silk fibroin
Wound healing nanomatrix treatment compared to the medical gauze (control) at 7 days after burn. Also, the expres-
Electrospinning sion level of TGF-␤1 in the wound treated with silk fibroin nanomatrix peaked 21-days post-treatment
whereas expression level of TGF-␤1 was highest at day 7 in the gauze treated group. In conclusion, this
data demonstrates that silk fibroin nanomatrix enhances the burn wound healing, suggesting it is a good
candidate for burn wound treatment.
© 2015 Elsevier B.V. All rights reserved.

1. Introduction ation as a barrier against dust and microorganisms. Furthermore,

Burn is one of the most widespread injuries in accidents and
remains a global public health issue [1,2]. The burn wound is a
continuous and severe threat against the rest of the body due to
invasion of infectious agents, antigen challenge and repeated addi-
tional trauma caused by wound cleaning [3]. Although remarkable
advances have been made in our understanding and treatment
of burn injuries, most burn healing processes result in extensive
scar formation, resulting in significant aesthetic disfigurement and
dysfunction [4,5]. The healing process can be promoted by using
biocompatible wound dressing material. An ideal wound dressing
should prevent dehydration of the wound and retain a favorable
moist environment at the wound interface allowing gas perme-
∗ Corresponding author at: Nano-Bio Regenerative Medical Institute, Hallym Uni-
versity, 1, Hallymdaehak-gil, Chuncheon, Gangwon-do, 200-702, Republic of Korea.
Fax: +82 33 241 2909.
E-mail address: hlpch@paran.com (C.H. Park).
it should be non-adhesive and easily removed without trauma.
Currently, wound dressings are fabricated with readily available
biomaterials of nontoxic, non-allergenic, antimicrobial and wound
healing properties [6].
Silk fibroin (SF) from Bombyx mori has been highlighted
for diverse applications in the biomedical field due to its
excellent mechanical property, controllable biodegradability,
hemostatic properties, non-cytotoxicity, low antigenicity and non-
inflammatory characteristics [7–10]. SF also exhibits exceptional
compatibility with a variety of cells and tissues [11–13] Due to
its ability to promote adhesion and proliferation of various cells
including keratinocytes and fibroblasts, SF has been considered as
potential biomaterial to fabricate wound dressings with various
formulations [14–19].
SF can be fabricated into various forms through film casting,
salt-leaching, lyophilizing, spinning, gelation, etc. Particularly, elec-
trospinning has recently attracted interest for a wide variety of
biomedical applications. Electrospun SF nanofibrous materials have
thus far been studied with useful properties (i.e., high porosity,

http://dx.doi.org/10.1016/j.ijbiomac.2015.12.055
0141-8130/© 2015 Elsevier B.V. All rights reserved.
30 H.W. Ju et al. / International Journal of Biological Macromolecules 85 (2016) 29–39
cytocompatibility, and less inflammation) for wound healing treat-
ment. In a number of studies it has been shown that degradation of
electrospun silk materials as an excellent wound dressing material
[20,21]. It has also been reported that the incorporation of growth
factors into electrospun silk mats accelerate wound healing pro-
cess [22]. In spite of such advantages, conventional electrospun
SF nanosheet has limitations for a wound dressing application.
It is difficult to increase electrospun mat thickness (i.e., <1 mm)
of SF nanosheet due to electric resistance and the inability to
achieve a large pore structure. These structural limitations result
in lower water absorbability and rapid drying of wound spot. Thus,
SF nanosheet fabricated with a general electrospinning process has
limitations for application in wound treatment compared to foam
type dressings (e.g., alginate sponge, and polyurethane foam) used
in clinical treatments.
In this study, we fabricated SF nanomatrix of bulk volume and
large pores by using a modified electrospinning method combined
with porogens (i.e., sodium chloride crystal) dispensing apparatus
and evaluated burn wound healing effect using deep second-degree
burn animal model in rats. The wound healing process was investi-
gated by histological observations and RT-PCR assay was performed
to elucidate the healing mechanism compared to a commercially
available dressing (i.e., polyurethane foam and Medifoam® ).
2. Materials and methods
2.1. Preparation of silk fibroin (SF) aqueous solution
Cocoons of B. mori silkworm were degummed by boiling in aque-
ous solution of 0.02 M Na2 CO3 for 30 min and subsequently rinsed
with distilled water to extract the sericin. The extracted SF was
dried and dissolved in CaCl2 solution in ethanol and water with
molar ratio of (1:2:8) at 15 w/v%. The solution was then filtered
through a miracloth (Calbiochem, San Diego, CA, USA) to remove
the small aggregates present in solution. This solution was then dia-
lyzed against de-ionized water using dialysis tubing with molecular
weight cutoff 12,000–14,000 Daltons (spectra/Por® , Spectrum Lab-
oratories, Inc CA, USA) for 3 days, and water was exchanged one a
day.
Overall, the yield of aqueous SF solution was calculated to be
6 wt%, which was determined by weighing the remaining solid
weight after drying. To fabricate the SF electrospun solution, 200 mL
of SF solution was concentrated to 8 wt% by adding in dialysis
tubing with a molecular weight cutoff of 6000–8000 Daltons, and
the tubing was sprinkled with 40 g of poly(ethylene glycol) (PEG,
MW 20,000) powder covering the tubing membrane and stored
in refrigerator for overnight resulting in concentrated 100 mL vis-
cous solution that equaled 12 wt% aqueous SF solution. Finally, this
12 wt% aqueous SF solution was diluted to 10 wt% solution and used
for fabricating scaffolds (Fig. 1). The aqueous SF solutions were
stored at 4 ◦ C and used within 15 days of time, to avoid denaturation
and precipitation.
2.2. SF nanosheet and SF nanomatrix fabrication
SF solution was blended with poly(ethylene oxide) (PEO) to
obtain desirable viscosity and spinnability. Silk/PEO (mixture ratio:
4:1) aqueous solution was prepared by adding PEO (200,000 MW)
directly into the SF aqueous solution of 10 wt.%. For electrospin-
ning, the silk/PEO solution was placed in a 10 mL plastic syringe
with a 22 needle gauge (0.7 mm OD × 0.4 mm ID) at a constant
flow rate of 1.2 mL/h, maintained using a syringe pump to keep
the solution drop at the tip of the needle without dripping [23].
The positive electrode was used to apply a voltage of 20 kV to the
needle tip through an alligator clip, while the negative electrode
was set to an applied voltage of 2 kV to the collector. Four syringes
were mounted in parallel to produce nanofibers. The needle tip-
to-collector distance was 15 cm. Such processing parameters were
accurately adjusted so that stable jets could be obtained.
To achieve a highly porous structure in the nanosheet, sodium
chloride crystals (with a diameter of <180 ␮m) were dispensed
onto a rotating drum above the collector during the electrospinning
(Fig. 2). The dispensing rate was approximately 35 g/h [24].
After the electrospinning, the silk nanosheet and sodium chlo-
ride crystal embedding SF nanomatrix was dried and subsequently
immersed in ethanol 100% for 1 h for re-crystallization of SF. Then,
the embedded sodium chloride particles and PEO were leached
out by soaking the nanomatrix in distilled water for one day; the
water was changed three times. The SF electrospun nanomatrix was
lyophilized for 48 h (Fig. 2).
2.3. Characterizations
Scanning electron microscopy (SEM) (SUPRA55 V VP-FESEM,
Carl Zeiss) was performed to investigate SF nanosheet and SF
nanomatrix morphology. The samples were coated with a thin
10 nm layer of gold/palladium for 120 s at 15 mA discharge current
(Ion Sputter 1010, Hitachi, Japan). After coating, the micrographs
were taken at an accelerating voltage of 1.2–1.3 KV. The average
pore sizes were determined by using software (INNERVIEW 2.0)
after measuring the average size of random pores (50 individual
pores per sample) from SEM images (Fig. 3).
Water uptake of swollen SF nanosheet and SF nanomatrix,
Medifoam® were measured by immersing them in distilled water
for 24 h at room temperature and determined by following Equa-
tion [25]: (Fig. 4A).
Ws − Wd
Water uptake (%) = × 100 (1)
Ws
whereas Ws and Wd are wet and dry weight of sample, respec-
tively. The dry weight was measured after drying in vacuum oven
of 60 ◦ C. Porosity of sample was measured by a liquid displacement
method. Ethanol was used as displacement liquid as it permeates
through sample without swelling or shrinking the matrix. Sample
(dry weight, W) was immersed in a known volume (V1 ) of ethanol
in a graduated cylinder for 5 min. The total volume of ethanol and
the ethanol-impregnated sample was recorded as V2 . The ethanol-
impregnated sample was then taken from the cylinder and the
residual ethanol volume was recorded as V3 . The porosity of sample
(P) was determined by following Equation [26]. (Fig. 4B).
V1 − V3
Porosity (%) = × 100 (2)
V2 − V3
2.4. Animal model
The animal studies were carried out in accordance with guide-
lines and approval of the Institutional Animal Care and Use
committees (IACUC) of Hallym University in Korea. Thirty male
Sprague-Dawley rats (obtained at 250–270 g) were housed in sep-
arate cages with free access to laboratory rodent food and water
under standardized air and light conditions at a constant tempera-
ture of 25 ◦ C ± 1 ◦ C with a 12 h light/day cycle.
2.5. Measurement of burn wound healing
To examine the effects of SF nanomatrix on the burned wound-
healing process, burn wounds were created on the back of rat
under anesthesia with single intraperitoneal dose of 0.15 mL of Tile-
tamine/Zolazepam HCl (Zoletil, Virbac, France) and 0.1 mL Xylazine
HCl (Rompun, Bayer, Korea). After anesthetizing rats, fur on the
back skin was removed. The back of the rat was exposed for 30 s
 H.W. Ju et al. / International Journal of Biological Macromolecules 85 (2016) 29–39 31

Fig. 1. Fabrication of the SF electrospun solution.

Fig. 2. Fabrication of the SF electrospun nanomatrix. A schematic depiction of the NaCl addition during electrospinning and crystallization.
32 H.W. Ju et al. / International Journal of Biological Macromolecules 85 (2016) 29–39

Fig. 3. SEM micrographs of the SF electrospun. (A) and (D) represent the surface and cross-section view for SF nanosheet; (B) and (E) represent the surface and cross-section
view for SF nanomatrix after pouring salt particles during electrospinning, (C) and (F) represent the surface and cross-section view for Medifoam® . (G) Histograms showing
the size distribution of fibers and pore size distribution for all three groups.

to device heated at 60 ◦ C to cause a deep second-degree burn
of 1.0 × 1.5 cm size and confirmed by gross pathological change
(Fig. 5). The SF nanomatrix and Medifoam® (polyurethane hydro-
celluar dressing foam, Genewel, Korea) were subsequently covered
with film dressing (3 M TegadermTM Film, 3 MTM Health Care, MN,
USA). Medical gauze was applied as a control group following
same procedure. The SF nanomatrix, Medifoam® and medical gauze
wound dressings were exchanged every 2 days for the first week
and then once a week for next 3 weeks. During this period, the
burned wound site was photographed every other day and mea-
sured using INNERVIEW 2.0 software (INNERVIEW, Korea). The rats
were sacrificed at (6 h, 1, 3, 7, 14, 21, and 28 days) with a lethal
dose of thiopental urethane and the wounded skin was collected
for analysis.
 H.W. Ju et al. / International Journal of Biological Macromolecules 85 (2016) 29–39 33

Fig. 4. Graphs of (A) porosity, (B) water up-take properties, And (C) Surface-, (D) Cross section-pore size of SF electrospun and Medifoam® . Bars represents mean standard
deviation and values are average standard derivation (N = 3).

Fig. 5. (A) Burn wound area on rat skin right after the creation. (B) Residual wound area change with healing time (28 days). (C) Gross findings of wound area treated with
different wound dressing materials (C: medical gauze, S: SF nanomatrix, and M: Medifoam® ).

2.6. Histological examination at 5 ␮m thickness, de-paraffinized, and stained with hematoxylin

The collected skin tissue specimen were fixed in 4% buffered
paraformaldehyde for at least 24 h, progressively dehydrated in
solutions containing an increasing percentage of ethanol (70, 80, 90,
and 100% (v/v)), cleared in Xylene, embedded in paraffin, sectioned
and eosin (H&E), or Masson’s trichrome (MT). After embedding the
skin tissue in paraffin, tissue slices were de-paraffinized for expres-
sion of proliferating cell nuclear antigen (PCNA). The positive cells
in the burn wound area were examined by an immunoperoxidase
technique using anti-mouse PCNA (Bioworld technology, Louis
34 H.W. Ju et al. / International Journal of Biological Macromolecules 85 (2016) 29–39

Fig. 6. Hematoxylin and eosin staining images of bund wound tissues (C: medical gauze, S: SF nanomatrix, and M: Medifoam® , scale: 100 ␮m).

Fig. 7. H&E staining images of bund wound tissues at 7, 14 days. (A) medical gauze (14 days), (B) SF nanomatrix (7 days), (C) Medifoam® (7 days). (NT: necrosis tissue, nt:
normal tissue, circle: Keratinocytes, scale: 50 ␮m).

Park, MN, USA). Histological observation was performed under a
light microscope (Eclipse 80i, Nikon, Tokyo, Japan) (Figs. 6–9 ).
2.7. RNA extraction and real time reverse transcription
polymerase chain reaction (RT-PCR)
The midpoints of the wounds were bisected, snap frozen in
liquid nitrogen, and stored at –80 ◦ C until analysis. Total RNA
was extracted from wound tissues using RNA-Bee (TEL-TEST,
USA) and single-stranded cDNA was synthesized from the total
RNA using Maxime RT Premix (oligo dT primer) kit (Intron
Biotechnology, Korea) following the manufacturer’s instruction.
The quantitative polymerase chain reaction (qPCR) was per-
formed using Roter-Gene SYBR Green PCR reagent system (Qiagen,
Germany). The primer sequences of Interleukin 1 alpa (IL-1␣)
 H.W. Ju et al. / International Journal of Biological Macromolecules 85 (2016) 29–39 35

Fig. 8. Collagen deposition in burn wound. Collagen was stained with MT (blue). C: medical gauze, S: SF nanomatrix, and M: Medifoam® (scale: 100 ␮m). (For interpretation
of the references to color in this figure legend, the reader is referred to the web version of this article.)

Fig. 9. PCNA expression in the tissue surrounding the affected area at 7 days. A: medical gauze, B: SF nanomatrix, and C: Medifoam® (scale: 50 ␮m).
36 H.W. Ju et al. / International Journal of Biological Macromolecules 85 (2016) 29–39
Fig. 10. Relative mRNA expressions of inflammatory or wound healing markers from the burn wounds with healing time. (A) IL-1␣, (B) IL-6, (C) IL-10, and (D) TGF-␤1 (n = 3,
mean ± SD, * P < 0.05, ** P < 0.01). C: medical gauze, S: SF nanomatrix, and M: Medifoam® .
were forward GAAGATGACCTGGAGGCCATAGC and reverse GAT-
GAACTCCTGCTTGACGATCC. The primer sequences of Interleukin
6 (IL-6) were forward TCTGGTCTTCTGGAGTTCCGTT and reverse
GCCACTCCTTCTGTGACTCTAAC. The primer sequences of Inter-
leukin 10 (IL-10) were forward GGTTGCCAAGCCTTGTCAGA and
reverse GCGTCGCAGCTGTATCCAGA. The primer sequences of
Transforming growth factor beta 1 (TGF-␤1) were forward TGCGC-
CTGCAGAGATTCAAGT and reverse TTCAGCCACTGCCGGACAACT.
The expression levels were normalized to the expression of the
housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase
(GAPDH). PCR conditions were set for 5 min at 95 ◦ C, and then 40
cycled at 95 ◦ C for 5 s, and at 60 ◦ C for 10 s (Fig. 10).
2.8. Statistics
Statistical calculations were performed with Origin software
(OriginLab, MA, USA). Statistical analysis was performed with the
Student’s t-test. * p < 0.05, ** p < 0.01. All experiments were inde-
pendently repeated three times.
3. Results
3.1. Physical properties of SF nanomatrix
We obtained an electrospun SF nanomatrix of highly porous
structure and 2 mm in thickness. SEM images of the SF nanosheet,
SF nanomatrix and Medifoam® are presented in Fig. 3. The SF
nanomatrix contained larger pores than conventional electrospun
fibers. With the addition of NaCl, the average pore diameter of
the SF nanosheet (4.7 ± 0.7 ␮m) was increased to 11.6 ± 1.8 ␮m (SF
nanomatrix) at the surface. Additionally, SF nanomatrix has a rel-
atively small surface pore size when compared with Medifoam® .
Cross sectional images resulted in an average pore diameter
of 53.1 ± 12.7 ␮m (SF-nanosheet), which increased to a size of
164.0 ± 114.9 ␮m (SF nanomatrix). In contrast, relatively small
pores in the pore size of 71.5 ± 26.0 ␮m were observed in cross
sectional images of Medifoam® (Figs. 3B and 4). Water content
and porosity were 93.5 ± 0.4% and 80.3 ± 0.5% for SF nanosheet,
95.7 ± 0.3% and 85.0 ± 0.4% for SF nanomatrix, respectively while
92.7 ± 0.2% and 90.7 ± 0.3% for Medifoam® (Fig. 4).
3.2. Effect of SF nanomatrix on burn wound healing
To determine the effect of SF nanomatrix on the wound healing
process, samples were applied on top of the wound immediately
after the burn was made (Fig. 5A). After the first burn and subse-
quent dressing, the wound sizes were measured at 6 h, and at 1,
3, 7, 21, and 28 days. In this regard, Fig. 5B and C show residual
wound area change with healing time. In all treated wounds, we
observed an initial increase in wound area at day 3; thereafter, the
wound area decreased progressively in all cases. Wound closure
progressed more rapidly in SF nanomatrix and Medifoam® treated
sites than in medical gauze-treated sites (control group). Moreover,
after day 7, the wound sizes of the SF nanomatrix treated group
became much smaller compared with those of the Medifoam®
treated group (Fig. 5C). We confirmed these observations by mea-
suring the residual wound area and the rates of wound closure and
wound healing for all three groups. At day 28, the areas of wounds
 H.W. Ju et al. / International Journal of Biological Macromolecules 85 (2016) 29–39
treated with SF nanomatrix and Medifoam® decreased to 4% and 8%,
respectively. Comparatively, the wound size of the medical gauze-
treated group was 18% (Fig. 5B).
3.3. Histological observation of wound healing process
To observe the wound healing effect of SF nanomatrix treat-
ment, we examined histological changes in burned skin (Fig. 6).
A second-degree burn was confirmed by the appearance of a blis-
ter and edema without any tissue damage of underlying fascia and
muscle tissue at day 1. The superficial cellularity loss of hair folli-
cles and epithelial blistering were also observed. In all the groups,
re-epithelialization process began 7-days post-treatment. Particu-
larly, the SF nanomatrix group showed faster tissue regeneration
in the burn wound (S) while fibrin clots still remained on the sur-
face of wound area in the medical gauze treated group (C). During
the whole healing period, SF nanomatrix and Medifoam® -treated
groups (S and M) showed relatively faster re-epithelialization pro-
cesses compared with that of medical gauze-treated group (C)
(Fig. 7). After 14 days, the wounds treated with SF nanomatrix
exhibited similar morphology and histology to normal skin and
the wound area was completely regenerated without formation of
edema or granulation tissue. By contrast, severe infiltration of neu-
trophils and lymphocytes were still observed in the medical gauze
group. Fig. 8 shows the collagen deposition at the wound site at
day 28. Collagen array in the SF nanomatrix and Medifoam® -treated
groups were relatively denser and more continuous compared with
that of the medical gauze-treated group.
3.4. PCNA expression in the burn skin
PCNA expression was observed after staining the tissue sur-
rounding the affected area. Fig. 9 shows PCNA-immunoreactive
cells at 7 days after treatment. SF nanomatrix and Medifoam®
groups were shown more PCNA-positive cells and re-
epithelialization than the medical gauze group.
3.5. Cytokine and growth factor gene expressions in burn wound
We examined expression of burn-induced cytokines and growth
factors related to wound healing processes by using RT-PCR. In
medical gauze, expression of Interleukin 1 alpa (IL-1␣), Interleukin
6 (IL-6) and Interleukin 10 (IL-10) were up-regulated at day 7
(Fig. 10). By contrast, the expression levels of IL-1␣ and 6 were rela-
tively lower in the SF nanomatrix treated group than in the medical
gauze and Medifoam® groups. However, at day 21, the expres-
sion level of cytokines IL-1␣ and 6 in the SF nanomatrix treated
group increased more rapidly compared with those of the medical
gauze group (Fig. 10A and B). The expression of IL-10, an anti-
inflammatory cytokine, maintained a consistently elevated level
from 7 to 21 days in SF nanomatrix treated group (Fig. 10C). The
expression of TGF-␤1 was significantly up-regulated until day 7
then decreased in the medical gauze group while the SF nanoma-
trix group showed, the highest expression level of TGF-␤1 at day
21 (Fig. 10D).
4. Discussions
The primary goal of wound treatment is rapid wound clo-
sure with functional and satisfactory scar formation. In this study,
a SF nanomatrix was fabricated as wound dressing material
and evaluated for burn wound healing compared with clinically
used conventional wound dressings (i.e., Medifoam® and medical
gauze).
37
Electrospinning is one of the widely used techniques to fabri-
cate 3D open porous structures by applying high voltage to draw a
small jet from polymer solution, resulting in a formation of small
interconnected fibers of diameters ranging from sub-micrometer to
nanometer [27]. The structure of electrospun fibrous scaffold is very
similar to that of the natural extracellular matrix (ECM) [28,29].
In our previous report, electrospun SF fibers showed wound heal-
ing effect in full thickness skin defect of rat [30]. In this study, it
was discovered that SF nanomatrix fabricated by electrospinning
process had a larger pore size and was more interconnected com-
pared with conventional electrospun mat (Fig. 3). Also, the addition
of porogens (sodium chloride particles) in electrospinning pro-
cess increased the thickness of SF nanomatrix as well as the pore
size. Although Medifoam® has a higher porosity, the SF nanoma-
trix showed higher water absorption than Medifoam® due to its 3D
fibrous structure. SF nanomatrix has more open pores compared to
Medifoam® resulting in its greater water absorption. Such a phys-
ical property is beneficial for wound treatment since it can absorb
a large amount of wound exudate and metabolic waste, maintain-
ing a wet condition during the healing process. It also allows useful
proteins and bioactive molecules, which are necessary for activ-
ity of cells, to be retained from body fluid [31]. The SF nanomatrix
could accelerate the healing of burn wounds in rats, as confirmed by
the wound size reduction, collagen, and epithelialization, and PCNA
expression (Figs. 6–9). The wound size measurement showed that
the wounds treated with SF nanomatrix underwent accelerated
healing processes and cell accumulation compared with wounds
treated with medical gauze within 14 days after surgery (Fig. 5).
There are several possible reasons to explain the accelerated wound
healing by SF nanomatrix. It was reported that SF promotes the
proliferation of human fibroblasts and keratinocytes [32]: and the
deposition of collagen [33].
Epithelialization or epidermal recovery is induced by migration
and growth of keratinocytes on neodermis followed by the forma-
tion of a complete basement membrane that ensures the structural
and mechanical stability of the dermo-epidermal junction. The
epithelialization process depends on self-renewal, proliferation,
and migration of keratinocytes residing at the basal cell layer. In
this study, SF nanomatrix showed to induce a higher rate of epithe-
lialization which allowed for accelerating wound healing (Fig. 7).
Furthermore, the formation of a new epithelial layer over the
wound treated with SF nanomatrix was clearly seen.
Collagen is a main component of skin that plays an important
role in tissue healing by providing tissue strength and an extracellu-
lar matrix framework for cell adhesion and migration [34]. Collagen
is also one of the key factors in scar formation. A cutaneous scar
caused by excessive inflammation and immature collagen has a
distinctly different collagen pattern compared to normal skin col-
lagen [35,36]. Our results showed that SF nanomatrix induced the
rapid production of collagen with a similar pattern to normal skin
(Fig. 8).
At molecular level, this study showed that SF nanomatrix mod-
ulated the pro-inflammatory cytokines involved in wound healing
(Fig. 10). Burn wound is associated with a large amount of inflam-
mation, which can lead to worsening of the tissue damage caused
by the initial thermal injury [37]. Furthermore, it has been reported
that excessive expression of pro-inflammatory cytokines within
burn wounds impairs the wound healing process [38]. SF has been
reported to inhibit inflammation when applied to dural injury
[39]. IL-10 is an anti-inflammatory cytokine antagonistic to those
of pro-inflammatory cytokines such as IL-1␣, IL–6 as suggested
in the literature [40,41]. However, many pro-inflammatory stim-
uli induce IL-10 expression concurrently with pro-inflammatory
cytokines in monocytes [42]. It has also been shown that IL-10 may
even inhibit its own production. Taken together, IL-10 and pro-
inflammatory cytokine expression profiles are not exclusive, but
38 H.W. Ju et al. / International Journal of Biological Macromolecules 85 (2016) 29–39
expressed concurrently to modulate the balance between pro- and
anti-inflammatory reactions during the course of wound healing in
vivo.
Previously, it is known that TGF-␤1 participates in a number
of wound healing processes: inflammation, stimulating angiogen-
esis, fibroblast proliferation, collagen synthesis, and remodeling of
new ECM [43,44]. Also, TGF-␤1 plays a possible role in hypertrophic
scar formation [45]. In this study, we investigated the expression
pattern of TGF-␤1 during burn wound healing. The expression of
TGF-␤1 in SF nanomatrix treatment group peaked at 21 days after
injury, then declined (Fig. 10D). Thus, these results suggest that SF
nanomatrix leads to accelerate wound healing and consequently
scarless wound healing by regulating TGF-␤1 expression. However,
the mechanism by which SF nanomatrix treatment regulates the
TGF-␤1 expression is currently unknown and a subject for future
investigations.
Taken together, the results of this study indicated that the SF
nanomatrix was found to bioactive and effective for the healing of
burn wounds in rats, compared with the medical gauze control. The
accelerated wound healing can be attributed to the effects of fibroin
and its 3D nano structure resulting in expression of growth factor
gene in the burn wounds. Therefore, SF nanomatrix is a promising
candidate for burn wound healing.
5. Conclusion
In conclusion, we demonstrated that SF nanomatrix acceler-
ates re-epithelialization and wound closure in burn wound. Also,
we analyzed expression patterns of burn-induced cytokines and
growth factor related to wound healing process. With regard to
that, this study suggests that SF nanomatrix shows a good healing
efficiency which can be utilized in therapeutics for treating injured
skin by suppressing inflammation, stimulating re-epithelialization,
and subsequently reducing the wound healing period and scar for-
mation.
Acknowledgments
This work was supported by Hallym university research fund
and the National Research Foundation of Korea(NRF) grant funded
by the Korea government(MSIP) (NRF-2015R1A4A1041631),
Republic of Korea.
References
[1] N.K. Upadhyay, R. Kumar, S.K. Mandotra, R.N. Meena, M.S. Siddiqui, R.C.
Sawhney, A. Gupta, Safety and healing efficacy of Sea Buckthorn (Hippophae
rhamnoides L.) seed oil on burn wounds in rats, Food. Chem. Toxicol. 47 (2009)
1146–1153.
[2] A.J. Singer, L. Berruti, H.C. Thode Jr., S.A. McClain, Standardized burn model
using a multiparametric histologic analysis of burn depth, Acad. Emerg. Med.
7 (2000) 1–6.
[3] G. Arturson, Pathophysiology of the burn wound and pharmacological
treatment, Burns 22 (1996) 255–274.
[4] R. Gurfinkel, A.J. Singer, E. Cagnano, L. Rosenberg, Development of a novel
animal burn model using radiant heat in rats and swine, Acad. Emerg. Med. 17
(2010) 514–520.
[5] A.J. Singer, S.A. McClain, A. Romanov, J. Rooney, T. Zimmerman, Curcumin
reduces burn progression in rats, Acad. Emerg. Med. 14 (2007) 1125–1129.
[6] R. Jayakumar, M. Prabaharan, P.T. Sudheesh Kumar, S.V. Nair, H. Tamura,
Biomaterials based on chitin and chitosan in wound dressing applications,
Biotechnol. Adv. 29 (2011) 322–337.
[7] H. Mori, M. Tsukada, New silk protein: modification of silk protein by gene
engineering for production of biomaterials, Rev. Mol. Biotechnol. 74 (2000)
95–103.
[8] R.L. Horan, K. Antle, A.L. Collette, Y. Wang, J. Huang, J.E. Moreau, V. Volloch,
D.L. Kaplan, G.H. Altman, In vitro degradation of silk fibroin, Biomaterials 26
(2005) 3385–3393.
[9] L. Meinel, S. Hofmann, V. Karageorgiou, L. Meinel, S. Hofmann, V.
Karageorgiou, C. Kirker-Head, J. McCool, G. Gronowicz, L. Zichner, R. Langer, G.
Vunjak-Novakovic, D.L. Kaplan, The inflammatory responses to Silk films
in vitro and in vivo, Biomaterials 26 (2005) 147–155.
[10] J.R. Mauney, T. Nguyen, K. Gillen, C. Kirker-Head, J.M. Gimble, D.L. Kaplan,
Engineering adipose-like tissue in vitro and in vivo utilizing human bone
marrow and adipose-derived mesenchymal stem cells with silk fibroin 3D
scaffolds, Biomaterials 28 (2007) 5280–5290.
[11] G.H. Altman, F. Diaz, C. Jakuba, T. Calabro, R.L. Horan, J. Chen, H. Lu, J.
Richmond, D.L. Kaplan, Silk-based biomaterials, Biomaterials 24 (2003)
401–416.
[12] I.C. Um, H.Y. Kweon, Y.H. Park, S. Hudson, Structural characteristics and
properties of the regenerated silk fibroin prepared from formic acid, Int. J.
Biol. Macromol. 29 (2001) 91–97.
[13] M. Li, S. Lu, Z. Wu, K. Tan, N. Minoura, S. Kuga, Structure and properties of silk
fibroin-poly (vinyl alcohol) gel, Int. J. Biol. Macromol. 30 (2002) 89–94.
[14] L. Baoyong, Z. Jian, C. Denglong, L. Min, Evaluation of a new type of wound
dressing made from recombinant spider silk protein using rat models, Burns
36 (2010) 891–896.
[15] A. Chiarini, P. Petrini, S. Bozzini, I. Dal Pra, U. Armato, Silk
fibroin/poly(carbonate) urethane as a substrate for cell growth: in vivo
interactions with human cells, Biomaterials. 24 (2003) 789–799.
[16] N. Minoura, S. Aiba, Y. Gotoh, M. Tsukada, Y. Imai, Attachment and growth of
cultured fibroblast cells on silk protein matrices, J. Biomed. Mater. Res. 6
(1995) 1215–1221.
[17] A. Sugihara, K. Sugiura, H. Morita, T. Ninagawa, K. Tubouchi, R. Tobe, M.
Izumiya, T. Horio, N.G. Abraham, S. Ikehara, Promotive effects of a silk film on
epidermal recovery from full-thickness skin wounds, Proc. Soc. Exp. Biol.
Med. 6 (2000) 58–64.
[18] J.H. Yeo, K.G. Lee, H.C. Kim, H.Y.L. Oh, A.J. Kim, S.Y. Kim, The effects of
PVA/chitosan/fibroin (PCF)-blended spongy sheets on wound healing in rats,
Biol. Pharm. Bull. 3 (2000) 1220–1223.
[19] S. Guang, Y. An, F. Ke, D. Zhao, Y. Shen, H. Xu, Chitosan/silk fibroin composite
scaffolds for wound dressing, J. Appl. Polym. Sci. 132 (2015), 42503.
[20] S.E. Wharram, X. Zhang, D.L. Kaplan, S.P. McCarthy, Electrospun silk material
systems for wound healing, Macromol. Biosci. 11 (2010) 246–257.
[21] C.M. Srivastava, R.R. Purwar, D. Kannaujia, Flexible silk fibroin films for
wound dressing, Fibers Polym. 16 (2015) 1020–1030.
[22] A. Schneider, X.Y. Wang, D.L. Kaplan, J.A. Garlick, C. Egles, Biofunctionalized
electrospun silk mats as a topical bioactive dressing for accelerated wound
healing, Acta Biomater. 8 (2009) 2570–2578.
[23] Y.M. Shin, M.M. Hohman, M.P. Brenner, G.C. Rutledged, Experimental
characterization of electrospinning: the electrically forced jet and
instabilities, Polymer 12 (2001) 9955–9967.
[24] O.J. Lee, H.W. Ju, J.H. Kim, J.M. Lee, C.S. Ki, J.H. Kim, B.M. Moon, H.J. Park, A.
Sheikh Faheem, C.H. Park, Development of artificial dermis using 3D
electrospun silk fibroin nanofiber matrix, J. Biomed. Nanotechnol. 10 (2014)
1294–1303.
[25] X. Zhang, C. Cao, X. Ma, Y. Li, Optimization of macroporous 3-D silk fibroin
scaffolds by salt-leaching procedure in organic solvent-free conditions, J.
Mater. Sci. Mater Med. 9 (2012) 315–324.
[26] M. Santin, A. Motta, G. Freddi, M. Cannas, In vitro evaluation of the
inflammatory potential of the silk fibroin, J. Biomed. Mater. Res. 7 (1999)
382–389.
[27] C. Veparia, D.L. Kaplan, Silk as a biomaterial, Polym. Sci. 16 (2007) 991–1007.
[28] H.S. Baek, Y.H. Park, C.S. Ki, J.C. Park, D.K. Rah, Enhanced chondrogenic
responses of articular chondrocytes onto porous silk fibroin scaffolds treated
with microwave-induced argon plasma, Surf. Coat. Technol. 3 (2008)
5794–5797.
[29] Y.Q. Zhang, W.L. Zhou, W.D. Shen, Y.H. Chen, X.M. Zha, K. Shirai, K. Kiguchi,
Synthesis, characterization and immunogenicity of silk fibroin-l-asparaginase
bioconjugates, J. Biotechnol. 11 (2005) 315–326.
[30] O.J. Lee, J.M. Lee, H.J. Jin, C.H. Park, The pilot study for the development of the
artificial dermis using silk fibroin, Int. J. Tiss. Regen. 1 (2010) 68–73.
[31] D.W. Hutmacher, Scaffold design and fabrication technologies for engineering
tissues state of the art and future perspectives, J. Biomater. Sci. Polym. Ed. 17
(2001) 107–124.
[32] B.M. Min, G. Lee, S.H. Kim, Y.S. Nam, T.S. Lee, W.H. Park, Electrospinning of silk
fibroin nanofibers and its effect on the adhesion and spreading of normal
human keratinocytes and fibroblasts in vitro, Biomaterials 8 (2004)
1289–1297.
[33] D.H. Roh, S.Y. Kang, J.Y. Kim, Y.B. Kwon, H. Young Kweon, K.G. Lee, Y.H. Park,
R.M. Baek, C.Y. Heo, J. Choe, J.H. Lee, Wound healing effect of silk
fibroin/alginate-blended sponge in full thickness skin defect of rat, J. Mater.
Sci. -Mater. Med. 17 (2006) 547–552.
[34] I. Aukhil, Biology of wound healing, Periodontology 22 (2000) 44–50.
[35] Y.S. Kim, D.H. Lew, K.C. Tark, D.K. Rah, J.P. Hong, Effect of recombinant human
epidermal growth factor against cutaneous scar formation in murine
full-thickness wound healing, J. Korean Med. Sci. 25 (2010) 589–596.
[36] Y.H. Shan, L.H. Peng, X. Liu, X. Chen, J. Xiong, J.Q. Gao, Silk fibroin/gelatin
electrospun nanofibrous dressing functionalized with astragaloside IV
induces healing and anti-scar effects on burn wound, Int. J. Pharm. 479 (2015)
291–301.
[37] P.C. Molan, Re-introducing honey in the management of wounds and
ulcers—theory and practice, Ostomy. Wound. Manage. 48 (2002) 28–40.
[38] N. Pejnović, D. Lilić, G. Zunić, M. Colić, M. Kataranovski, A. Dujić, Aberrant
levels of cytokines within the healing wound after burn injury, Arch. Surg.
130 (1995) 999–1016.
[39] D.W. Kim, W.S. Eum, S.H. Jang, J. Park, D.H. Heo, S.H. Sheen, H.R. Lee, H.
Kweon, S.W. Kang, K.G. Lee, S.Y. Cho, H.J. Jin, Y.J. Cho, S.Y. Choi, A transparent
 H.W. Ju et al. / International Journal of Biological Macromolecules 85 (2016) 29–39
artificial dura mater made of silk fibroin as an inhibitor of inflammation in
craniotomized rats, J. Neurosurg. 114 (2011) 485–490.
[40] L.H. Sigal, Basic science for the clinician 33: interleukins of current clinical
relevance (part 1), J. Clin. Rheumatol. 10 (2004) 353–359.
[41] K.W. Moore, R. de Waal Malefyt, R.L. Coffman, A. O’Garra, Interleukin-10 and
the interleukin-10 receptor, Annu. Rev. Immunol. 19 (2001) 683–765.
[42] R. de Waal Malefyt, J. Abrams, B. Bennett, C.G. Figdor, J.E. de Vries, Interleukin
10 (IL-10) inhibits cytokine synthesis by human monocytes: an
autoregulatory role of IL-10 produced by monocytes, J. Exp. Med. 174 (1991)
1209–1220.
[43] A.B. Roberts, M.B. Sporn, R.K. Assoian, J.M. Smith, N.S. Roche, L.M. Wakefield,
U.I. Heine, L.A. Liotta, V. Falanga, J.H. Kehrl, Transforming growth factor-␤1:
View publication stats
39
rapid induction of fibrosis and angiogenesis in vivo and stimulation of
collagen formation in vitro, Proc. Natl. Acad. Sci. U.S.A. 83 (1986) 4167–4171.
[44] A.V. Nall, R.E. Brownlee, C.P. Colvin, A.V. Nall, R.E. Brownlee, C.P. Colvin, G.
Schultz, D. Fein, N.J. Cassisi, T. Nguyen, A. Kalra, Transforming growth factor
beta 1 improves wound healing and random flap survival in normal and
irradiated rats Arch, Otolaryngology 122 (1996) 171–177.
[45] R. Wang, A. Ghahary, Q. Shen, P.G. Scott, K. Roy, E.E. Tredget, Hypertrophic
scar tissues and fibroblasts produce more transforming growth factor—␤1
mRNA and protein than normal skin and cells wound, Repair. Regen. 8 (2000)
128–137.