Placenta 60 (2017) 9e20

Contents lists available at ScienceDirect

Placenta
journal homepage: www.elsevier.com/locate/placenta

Mammalian target of rapamycin signaling is a mechanistic link

between increased endoplasmic reticulum stress and autophagy in the
placentas of pregnancies complicated by growth restriction
Tai-Ho Hung a, b, *, 1, T'sang-T'ang Hsieh a, Chung-Pu Wu c, d, Meng-Jen Li a, Yi-Lin Yeh a,
Szu-Fu Chen e, 1
a
Department of Obstetrics and Gynecology, Chang Gung Memorial Hospital, Taipei, Taiwan
b
Department of Chinese Medicine, College of Medicine, Chang Gung University, Taoyuan, Taiwan
c
Graduate Institute of Biomedical Sciences, Department of Physiology and Pharmacology and Molecular Medicine Research Center, College of Medicine,
Chang Gung University, Taoyuan, Taiwan
d
Department of Neurosurgery, Chang Gung Memorial Hospital, Taoyuan, Taiwan
e
Department of Physical Medicine and Rehabilitation, Cheng Hsin General Hospital, Taipei, Taiwan

a r t i c l e i n f o a b s t r a c t

Article history: Introduction: Increased endoplasmic reticulum (ER) stress and autophagy have been noted in the pla-
Received 12 May 2017 centas of pregnancies complicated by idiopathic intrauterine growth restriction (IUGR); however, the
Received in revised form cause of these phenomena remains unclear. We surmised that oxygen-glucose deprivation (OGD) may
1 October 2017
increase ER stress and autophagy and that mammalian target of rapamycin (mTOR) signaling is involved
Accepted 6 October 2017
in regulating placental ER stress and autophagy in pregnancies complicated by IUGR.
Methods: We obtained placentas from women with normal term pregnancies and pregnancies compli-
Keywords:
cated by IUGR to compare ER stress, mTOR signaling, and levels of autophagy-related proteins between
Autophagy
Endoplasmic reticulum stress
the two groups and used primary cytotrophoblast cells treated with or without salubrinal (an ER stress
Intrauterine growth restriction inhibitor), MHY1485 (an mTOR activator), or rapamycin (an mTOR inhibitor) to investigate the effects of
Mammalian target of rapamycin OGD on ER stress, mTOR activity, and autophagy levels in vitro.
Placenta Results: Women with pregnancies complicated by IUGR displayed higher placental ER stress and auto-
phagy levels but lower mTOR activity than women with normal pregnancies. Furthermore, OGD
increased ER stress, regulated in development and DNA damage responses-1 (REDD1), phosphorylated
tuberous sclerosis complex 2 (TSC2), and autophagy levels and decreased mTOR activity compared to the
standard culture condition; however, the salubrinal treatment attenuated these changes. Moreover, the
administration of MHY1485 or rapamycin to OGD-treated cells decreased or increased autophagy levels,
respectively.
Discussion: Based on our results, mTOR is a mechanistic link between OGD-induced ER stress and
autophagy in cytotrophoblast cells; thus, mTOR plays an essential role in the pathogenesis of pregnancies
complicated by IUGR.
© 2017 Elsevier Ltd. All rights reserved.

1. Introduction genetically determined size, is one of the major causes of perinatal

Idiopathic intrauterine growth restriction (IUGR), defined as
suboptimal growth that prevents the fetus from achieving its
* Corresponding author. Department of Obstetrics and Gynecology, Chang Gung
Memorial Hospital at Taipei, 199 Dun-hua North Road, Taipei 105, Taiwan.
E-mail address: thh20@cgmh.org.tw (T.-H. Hung).
1
These authors contributed equally to this work as corresponding authors.
morbidity and mortality [1]. The causes of IUGR are not fully un-
derstood; however, the most widely recognized factor that pre-
disposes pregnancies to this particular complication is deficient
extravillous cytotrophoblast invasion of the endometrium during
the first trimester of pregnancy, which leads to incomplete
transformation of the myometrial segments of the maternal spiral
arteries [2]. The persistence of the contractile state in these ves-
sels causes decreases or fluctuations in the perfusion of the
intervillous space, resulting in profound changes in prevailing

https://doi.org/10.1016/j.placenta.2017.10.001
0143-4004/© 2017 Elsevier Ltd. All rights reserved.
10 T.-H. Hung et al. / Placenta 60 (2017) 9e20
tissue oxygen and glucose concentrations and nutrient supply [3].
These changes may induce mitochondrial and rough endoplasmic
reticulum (ER) stress, leading to trophoblast dysfunction and
suboptimal placental performance [4]. Indeed, mitochondrial and
ER stress and apoptosis levels are increased in the syncytio-
trophoblast and underlying cytotrophoblast layers of placentas in
pregnancies complicated by IUGR compared to those in placentas
in normal pregnancies [5e7].
Autophagy is a catabolic process involving the invagination and
degradation of cytoplasmic components, such as misfolded pro-
teins and damaged organelles, through a lysosomal pathway and
the recycling of the constituent elements of these components or
organelles to synthesize macromolecules and generate ATP [8]. In
the human placenta, the ultrastructures of autophagic vacuoles
were clearly observed in the trophoblast layers and autophagy-
related proteins, such as beclin-1, microtubule-associated protein
light chain 3B (LC3B), and damage-regulated autophagy modulator
(DRAM), are consistently transcribed and expressed throughout
gestation, indicating that autophagy is important during placental
development [9]. However, increases in autophagy-related changes
have been noted in the placentas from women with pregnancies
complicated by IUGR compared to placentas from women with
normal pregnancies [10,11]. At present, the relationship between
ER stress and autophagy in the placentas of pregnancies compli-
cated by IUGR remains unclear.
One key component that regulates the balance between cell
growth and autophagy in response to cellular physiological con-
ditions and environmental stress is mammalian target of rapamycin
(mTOR) [12]. Both amino acid transporter and mTOR activity levels
are reduced in the placentas of pregnancies complicated by IUGR
compared to those in the placentas of normal pregnancies [5,13,14].
Furthermore, the exposure of cytotrophoblast cells to rapamycin
(an mTOR inhibitor) plus bafilomycin (an autophagosome inhibi-
tor) resulted in higher LC3B-II levels in these cells compared to cells
exposed to bafilomycin alone, indicating that reductions in mTOR
activity are associated with increases in autophagic flux [15]. Based
on these results, mTOR may play a role in regulating placental
autophagy in pregnancies complicated by IUGR.
We hypothesized that there are differences in ER stress, auto-
phagy, and mTOR activity levels between the placentas of preg-
nancies complicated by IUGR and those of normal pregnancies. We
also surmised that oxygen-glucose deprivation (OGD) causes in-
creases in ER stress and autophagy in the placentas of pregnancies
complicated by IUGR and that mTOR signaling is a mechanistic link
between placental ER stress and autophagy under OGD conditions.
Therefore, the objectives of this study were (1) to compare ER
stress, mTOR activity, and autophagy levels between placentas from
normal pregnancies and placentas from pregnancies complicated
by IUGR and (2) to investigate the effects of in vitro OGD on ER
stress, mTOR activity, and autophagy levels in cultured cyto-
trophoblast cells.
2. Materials and methods
This study was approved by the Institutional Review Board of
Chang Gung Memorial Hospital, Taiwan (102e5860B). All placental
samples were collected after the subjects enrolled herein provided
written informed consent for the use of the samples. Unless
otherwise indicated, the reagents used in the study were purchased
from Sigma-Aldrich (St. Louis, MO, USA).
2.1. Collection of placental tissues from normal pregnancies and
pregnancies complicated by IUGR
We obtained placentas from women with singleton term
pregnancies who underwent elective cesarean deliveries prior to
the onset of labor to compare ER stress, mTOR signaling activity,
and autophagy-related protein levels between women with normal
pregnancies and appropriate for gestational age fetuses (fetuses
with birth weights between the 10th and 90th percentiles for their
gestational ages, n ¼ 15) and women with pregnancies complicated
by IUGR (n ¼ 15), which was diagnosed in cases in which the birth
weight of the fetus was below the 5th percentile when corrected for
gestational age and fetal gender. None of the women had any
medical diseases, such as overt diabetes, preeclampsia or renal or
autoimmune diseases. The characteristics of the women who
participated in this study and their pregnancies are summarized in
Table 1.
We randomly collected villous tissue samples from five distinct
sites on the maternal side of the placenta after it was delivered.
Each site was midway between the cord insertion site and placenta
periphery and midway between the chorionic and basal plates. The
villous samples were quickly washed in ice-cold phosphate-buff-
ered saline to clear the maternal blood and then frozen in liquid
nitrogen before being stored at 70  C for further processing. All
villous samples were collected and processed within 10 min after
delivery.
2.2. Isolation and culture of cytotrophoblast cells from normal term
placentas
We isolated cytotrophoblast cells from 33 normal term pla-
centas, as previously described [16]. The purified cells were plated
in 6-well plates at a minimum density of 4  105 cells/cm2 and
cultured in RPMI 1640 medium (catalog no. 11875; Invitrogen, Life
Technologies, Grand Island, NY, USA) containing 2 mg/ml D-
glucose, 5% fetal bovine serum, antibiotics, and antimycotics in a
humidified atmosphere with 5% CO2 and balanced air. After an
overnight rest, the cells were rinsed twice with pre-warmed me-
dium to remove non-attached cells and then used in individual
experiments. Cell viability was determined by assessing the degree
of MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-
diphenyltetrazoliumbromides) reduction. Characters of the iso-
lated cytotrophoblast cells were verified by immunofluorescent
staining for cytokeratin 7 and measurements of the secretion of
human chorionic gonadotropin (hCG) into the medium (Supple-
mentary data and Supplementary Fig. 1).
2.3. OGD
We cultured cytotrophoblasts in RPMI 1640 media without D-
glucose (catalog no. 11879; Invitrogen) in 2% O2 with 5% CO2/
balanced N2 (OGD group) or media with 2 mg/ml D-glucose with 5%
CO2/balanced air (standard conditions group), as previously
described [9], to study the effects of reduced oxygen and glucose
concentrations on ER stress, mTOR activity, and levels of
autophagy-related proteins. After the cells had been incubated for
24 h, their lysates were collected and stored at 70  C for further
processing.
To determine the role of ER stress in OGD-induced autophagy,
we cultured cytotrophoblast cells under standard or OGD condi-
tions and treated them with or without 50 mM salubrinal (an ER
stress inhibitor) for 24 h. Salubrinal was dissolved in dimethyl
sulfoxide (DMSO) at a final concentration of 50 mM. In addition, we
cultured cytotrophoblast cells under standard or OGD conditions
and treated them with or without 2 mM MHY1485 (CAS no. 326914-
06-1, Merck Ltd., Taipei, Taiwan), an mTOR activator, or 100 nM
rapamycin (an mTOR inhibitor) for 24 h to investigate the inter-
action between mTOR and autophagy under these conditions.
MHY1485 and rapamycin were dissolved in DMSO as 1000 stock
 T.-H. Hung et al. / Placenta 60 (2017) 9e20 11

Table 1
Characteristics of the study population.

Normal pregnancy (n ¼ 15) IUGR (n ¼ 15) P

Age (y) 34.1 ± 4.1 36.5 ± 5.1 0.17

Primiparity 9 (60%) 10 (67%) 0.44
Pre-pregnancy BMI (kg/m2) 22.6 ± 2.9 21.5 ± 2.9 0.31
Blood pressure before delivery
Systolic (mmHg) 124 ± 10 125 ± 12 0.86
Diastolic (mmHg) 74 ± 8 77 ± 10 0.39
Hemoglobin (mg/dl) 12.6 ± 0.6 12.5 ± 1.2 0.73
Platelet count (103/ml) 221 ± 46 214 ± 39 0.70
Gestational age (wk) 38.8 ± 1.5 38.3 ± 1.4 0.33
Birth weight (g) 3121 ± 265 2213 ± 490 <0.001
Placental weight (g) 623 ± 119 481 ± 88 0.001
One-minute Apgar score 9 (8e9) 9 (7e9) 0.50
Five-minute Apgar score 10 (9e10) 10 (9e10) 0.47
Male fetus 8 (53%) 8 (53%) 1.00

BMI ¼ body mass index; IUGR ¼ intrauterine growth restriction.

Data presented as the mean ± S.D, median (range), or n (%).
P values based on the Mann-Whitney U test or Student's t-test.

solutions. The stock solutions and working concentrations of
salubrinal, MHY1485, and rapamycin were determined based on
the results of preliminary experiments. After the cells had been
incubated for 24 h, their lysates were collected and stored at 70  C
for further processing.
and working concentration of each primary antibody are listed in
Table 2.
2.5. Reverse transcription-polymerase chain reaction (RT-PCR)
analysis of X-box binding protein-1 (XBP-1) mRNA splicing

2.4. Western blotting
Western blotting was performed as previously described [9].
Briefly, villous samples or cytotrophoblast cells were homogenized
and lysed in ice-cold protein extraction reagents (T-PER reagent
and M-PER reagent; Pierce Biotechnology, Rockford, IL, USA) sup-
plemented with a complete miniprotease inhibitor cocktail (Roche
Diagnostics, Mannheim, Germany). Tissue homogenates or cell ly-
sates were centrifuged at 10,000 g for 20 min at 4  C, after which
the supernatants were decanted off and protein concentrations
were determined. Fifty to one hundred micrograms of cytosolic
protein sample per lane were separated by 10%, 12%, or 16% sodium
dodecyl sulfate polyacrylamide gel electrophoresis, depending on
the molecular weights of the proteins of interest, transferred to
nitrocellulose membranes, and probed with primary antibodies
overnight at 4  C. The relative intensities of the protein signals were
normalized to the intensities of the b-actin (clone AC-15, 1:10,000
dilution; Sigma) signals, and the band densities were quantified by
densitometric analysis using ImageJ software (National Institutes of
Health, Bethesda, MD, USA; http://rsb.info.nih.gov/ij/). The source
The XBP-1 mRNA splicing assay was performed as previously
described [7]. Briefly, total RNA was isolated from villous tissue
homogenates immediately after delivery or cytotrophoblast cells
after completion of the above experiments using RNeasy Mini kits
(Qiagen, Valencia, CA, USA). One microgram of total RNA was first
treated with DNase I and then subjected to reverse transcription
using SuperScript II RNase H reverse transcriptase (Invitrogen),
according to the manufacturer's protocol. The sequences of the
forward and reverse primers for XBP-1 were 50 -CTGGAA-
CAGCAAGTGGTAGA-30 and 50 -CTGGGTCCTTCTGGGTAGAC-30 ,
respectively. GAPDH (forward 50 GGATGATGTTCTGGAGAGCC30 ,
reverse 50 CATCACCATCTTCCAGGAGC30 ) was used as a loading
control. The PCR products were resolved by 2% agarose gel elec-
trophoresis with ethidium bromide, photographed under UV illu-
mination, and quantified by densitometric analysis using ImageJ
software.
2.6. Statistical analysis
The data are presented as means±standard errors of the means

Table 2
Primary antibodies used in the western blotting analysis.

Antibody Source Type Catalog no. Dilution

BiP (C50B12) Rabbit Monoclonal IgG #3177 1:500

GADD153/CHOP (L63F7) Mouse Monoclonal IgG2a #2895 1:100
REDD1 Rabbit Polyclonal #2516 1:200
tuberin/TSC2 (28A7) Rabbit Monoclonal IgG #3635 1:400
phospho-tuberin/TSC2 (Thr1462) (5B12) Rabbit Monoclonal IgG #3617 1:200
phospho-tuberin/TSC2 (Tyr1571) Rabbit Polyclonal #3614 1:200
mTOR Rabbit Polyclonal #2972 1:500
phospho-mTOR (Ser2448) Rabbit Polyclonal #2971 1:500
phospho-mTOR (Ser2481) Rabbit Polyclonal #2974 1:500
p70S6 kinase Rabbit Polyclonal #9202 1:200
phospho-p70S6 kinase (Thr389) Rabbit Polyclonal #9205 1:200
4E-BP1 Rabbit Polyclonal #9452 1:2000
phospho-4E-BP1 (Thr37/46) Rabbit Polyclonal #9459 1:2000
phospho-4E-BP1 (Thr70) Rabbit Polyclonal #9455 1:1000
LC3B Rabbit Polyclonal #2775 1:1000
p62/SQSTM1 Rabbit Polyclonal #5114 1:500

All antibodies were obtained from Cell Signaling Technology, Danvers, MA, USA.
12 T.-H. Hung et al. / Placenta 60 (2017) 9e20

(S.E.M.) or as medians and interquartile ranges in cases in which
the data were not normally distributed. The data were analyzed
and plotted using Prism 7 for Mac OS X (GraphPad Software, Inc.,
La Jolla, CA, USA). The differences between the two groups were
computed with the Mann-Whitney U test or Student's t-test, and
P < 0.05 was considered statistically significant for all
comparisons.
3. Results
3.1. Clinical characteristics of the study population
Women with pregnancies complicated by IUGR had a signifi-
cantly lower birth weight and placental weight than women with
normal pregnancies (Table 1). No differences in the mean gesta-
tional age at delivery and other characteristics, such as maternal
age, prepregnancy body mass index, blood pressure and hemogram
before delivery, and Apgar scores, were observed.
3.2. Differences in ER stress, mTOR activity, and autophagy levels
between placentas from normal pregnancies and placentas from
pregnancies complicated by IUGR
The spliced XBP-1 mRNA, binding of immunoglobulin protein
(BiP, also known as 78 kDa glucose-regulated protein [GRP-78]),
and growth arrest- and DNA damage-inducible gene 153
(GADD153, also known as C/EBP homologous protein [CHOP])
were used as markers of ER stress. These factors were selected
because they each represent different functional aspects of the
unfolded protein response to ER stress [17]. Levels of the spliced
XBP-1 mRNA, BiP, and GADD153 were increased in placental
samples from women with pregnancies complicated by IUGR
compared to placental samples from women with normal preg-
nancies (Fig. 1a and d). Furthermore, the levels of total and
phosphorylated (Tyr1571) tuberous sclerosis complex 2 (TSC2), an
important protein that mediates the effect of ER stress on mTOR
activity, were significantly higher in IUGR placentas than in
normal placentas (Fig. 1e and f). No difference in the levels of
phospho-TSC2 (Thr1462) was observed between the two groups
of placentas.
In contrast, placental samples from women with pregnancies
complicated by IUGR displayed lower total and phospho-mTOR
(Ser2448) levels than placental samples from women with
normal pregnancies (Fig. 2a and c). The difference in placental
phospho-mTOR (Ser2481) levels between the two groups was
not statistically significant (Fig. 2d). Moreover, phosphorylation
of mTOR complex 1 (mTORC1) target proteins, including
eukaryotic translation initiation factor 4E-binding protein 1 (4E-
BP1) and ribosomal protein S6 kinase beta-1 (p70S6K), was
decreased in the placentas of pregnancies complicated by IUGR
compared with that in the placentas of normal pregnancies
(Fig. 2f, g, and 2i).
LC3B-II and p62 are markers of autophagy-related changes [18].
LC3B is synthesized as pro-LC3B and converted to LC3B-I by
autophagy-related proteases. Upon the induction of autophagy,
LC3B-I is further processed into LC3B-II and integrates into mem-
branes of autophagosomes. The p62 protein (also known as
sequestosome 1 [SQSTM1]) and p62-bound polyubiquitinated
proteins become incorporated into the completed autophagosome
and are degraded in autolysosomes. Decreased p62 levels are
associated with autophagy activation. We compared the levels of
these two molecules in placentas from women with normal preg-
nancies to placentas from women with pregnancies complicated by
IUGR. As shown in Fig. 2j and k, LC3B-II was expressed at higher
levels and p62 was expressed at lower levels in placentas from
pregnancies complicated by IUGR than in placentas from normal
pregnancies.

Fig. 1. Differences in ER stress and TSC2 levels between placentas from normal pregnancies and placentas from pregnancies complicated by IUGR. ER stress levels were
increased in placental samples from women with pregnancies complicated by IUGR compared to those in placentas from women with normal pregnancies. These findings were
supported by the observation that levels of the spliced XBP-1 mRNA, BiP, and GADD153 were increased in the former group compared with the latter group (bed). Furthermore, the
levels of total and phosphorylated (Tyr1571) TSC2, an important protein that mediates the effect of ER stress on mTOR activity, were significantly increased in IUGR placentas
compared with those in normal placentas (e and f). Fifteen placentas from normal pregnancies and 15 placentas from pregnancies complicated by IUGR were used for the analysis.
GAPDH and b-actin were used to normalize loading variability. Lanes 1e3, villous tissues from normal pregnancies; and lanes 4e7, villous tissues from pregnancies complicated by
IUGR. Data are presented as medians and interquartile ranges and are displayed as box and whisker plots (box: interquartile range, whiskers: 90th and 10th percentiles). *, P < 0.05;
**, P < 0.01, compared to villous tissues from normal pregnancies.
 T.-H. Hung et al. / Placenta 60 (2017) 9e20 13

Fig. 2. Differences in mTOR activity and autophagy levels between placentas from normal pregnancies and placentas from pregnancies complicated by IUGR. Placentas from
pregnancies complicated by IUGR expressed lower levels of total and phospho-mTOR (Ser2448) levels than placentas from normal pregnancies (b and c). No differences in phospho-
mTOR (Ser2481) levels were observed between these two groups (d). The levels of mTOR complex 1 (mTORC1) target proteins, including total and phosphorylated 4E-BP1 (Thr37/46
and Thr70) and phosphorylated p70S6K (Thr389), were also decreased in the placentas of pregnancies complicated by IUGR compared with those in the placentas of normal
pregnancies (e-g and i). Moreover, higher LC3B-II levels (j) and lower p62 levels (k) were observed in placentas from pregnancies complicated by IUGR than in placentas from
normal pregnancies. Fifteen placentas from normal pregnancies and 15 placentas from pregnancies complicated by IUGR were used for the analysis. b-actin was used to normalize
loading variability. Lanes 1e3, villous tissues from normal pregnancies; and lanes 4e7, villous tissues from pregnancies complicated by IUGR. Data are presented as medians and
interquartile ranges and are displayed as box and whisker plots (box: interquartile range, whiskers: 90th and 10th percentiles). *, P < 0.05; **, P < 0.01, compared to villous tissues
from normal pregnancies.

3.3. Effects of OGD on ER stress, mTOR activity, and autophagy
levels in cytotrophoblast cells
Cytotrophoblast cells subjected to OGD displayed higher levels
of the spliced XBP-1 mRNA and BiP, and GADD153 proteins than
cells cultured under standard conditions (Fig. 3a and c). Similarly,
the levels of ER stress target proteins, such as regulated in devel-
opment and DNA damage responses 1 (REDD1) and total and
phosphorylated (Tyr1571 and Thr1462) TSC2 were significantly
increased in cells subjected to OGD compared with those in cells
cultured under standard conditions (Fig. 3d and g). In contrast,
lower levels of total and phosphorylated (Ser2448 and Ser2481)
mTOR were observed in cytotrophoblast cells treated with OGD
than in cells cultured under standard conditions (Fig. 3h and j).
These changes were associated with significant decreases in the
levels of total and phosphorylated 4E-BP1 (Thr37/46 and Thr70)
and p70S6K (Thr389) (Fig. 3k, l, 3m, and 3o). Moreover, OGD caused
an increase in the level of LC3B-II and a decrease in the level of p62
in the corresponding group of cytotrophoblast cells compared to
those in the group of cells cultured under standard conditions
(Fig. 3p and q).
Cytotrophoblast cells were cultured under one of the following
conditions to further confirm that the changes observed in cells
subjected to OGD were not caused by a change in osmolality
induced by glucose deprivation: (1) in RPMI 1640 medium sup-
plemented with 2 mg/ml of D-glucose at 5% CO2/balanced air as the
standard culture condition; (2) in RPMI 1640 medium without D-
glucose but supplemented with 2 mg/ml of L-glucose at 2%O2/5%
CO2/balanced N2 as the osmolality control; and (3) in RPMI 1640
medium without D- or L-glucose in 2% O2/5% CO2/balanced N2 as
the OGD condition. After a 24-h incubation, the levels of ER stress,
total and phosphorylated mTOR, and autophagy were assessed. As
shown in Supplementary Fig. 2, cells in the osmolality control and
OGD groups displayed higher levels of ER stress (spliced XBP-1
mRNA, BiP, and GADD15 levels), lower levels of total and phos-
phorylated mTOR, and a greater number of autophagic changes
than the cells cultured under standard conditions. No difference in
the levels of ER stress, total and phosphorylated mTOR, and auto-
phagy were observed between cells in the osmolality control and
OGD groups, suggesting that, in this study, a change in osmolality is
not a significant cause of the differences between cells cultured
under standard conditions and under OGD conditions.
14 T.-H. Hung et al. / Placenta 60 (2017) 9e20

Fig. 3. Effects of OGD on ER stress, mTOR activity, and autophagy levels in cultured cytotrophoblast cells. Cytotrophoblast cells subjected to OGD treatment expressed higher
levels of the spliced XBP-1 mRNA, BiP, GADD153, REDD1 and total and phosphorylated TSC2 than cells cultured under standard conditions (aeg). In contrast, cytotrophoblast cells
subjected to OGD expressed lower levels of total and phosphorylated (Ser2448 and Ser2481) mTOR than cells cultured under standard conditions (hej). Furthermore, OGD
significantly decreased total and phosphorylated 4E-BP1 (Thr37/46 and Thr70) and phosphorylated p70S6K (Thr389) levels in the corresponding group of cells compared to the
group of cells cultured under standard conditions (k-m and o). However, total p70S6K levels were similar between the two groups (n). The OGD treatment also increased LC3B-II
levels (p), but decreased p62 levels (q) in the corresponding group of cytotrophoblast cells compared to the group of cells cultured under standard conditions. Data are presented as
means ± S.E.M. Eight individual experiments were performed. *, P < 0.05; **, P < 0.01; ***, P < 0.001, compared to cells cultured under standard conditions. Standard, standard
culture conditions; OGD, oxygen-glucose deprivation condition.
 T.-H. Hung et al. / Placenta 60 (2017) 9e20
3.4. Effects of salubrinal on OGD-induced changes in ER stress,
mTOR activity, and autophagy levels in cytotrophoblast cells
We subjected the indicated cells to OGD and treated them with
or without salubrinal, after which we measured ER stress, REDD1,
and TSC2 levels to confirm that ER stress plays a role in the OGD-
induced changes in the autophagy of cytotrophoblast cells. As
shown in Fig. 4a and c, treatment with salubrinal attenuated OGD-
induced changes in XBP-1 mRNA, BiP, and GADD153 levels in the
corresponding group compared to the OGD-treated group. These
results indicated that salubrinal has inhibitory effects on ER stress.
Although total TSC2 levels did not differ significantly between the
two groups, cells treated simultaneously with OGD and salubrinal
had lower REDD1 and phosphorylated TSC2 (Tyr1571 and Thr1462)
levels than cells treated with OGD alone (Fig. 4d, f, and 4g).
The effects of salubrinal on OGD-induced changes in mTOR ac-
tivity are shown in Fig. 4h to o. Treatment with salubrinal led to
increases in total and phosphorylated mTOR (Ser2448 and
Ser2481) levels compared to treatment with vehicle controls. These
alterations were associated with increased phosphorylation of the
mTOR targets 4E-BP1 (Fig. 4l and m) and p70S6K (Fig. 4o) and re-
ductions in autophagy levels in the corresponding cytotrophoblast
cells compared to vehicle control-treated cells (Fig. 4p and q).
3.5. Effects of MHY1485 or rapamycin on OGD-induced changes in
ER stress, mTOR activity, and autophagy levels in cytotrophoblast
cells
We subjected cytotrophoblast cells to OGD and treated them
with or without MHY1485, after which we assessed the changes in
ER stress markers, REDD1, TSC2, mTOR, 4E-BP1, p70S6K, and
autophagy levels elicited by these treatments to determine the role
of mTOR in OGD-induced autophagy. As shown in Fig. 5a and c,
MHY1485 had no effects on the ER stress induced by OGD. The
REDD1 and total and phosphorylated TSC2 levels did not display
differences between cells treated with MHY1485 and the vehicle
controls (Fig. 5d and g). However, cells cultured with OGD and
MHY1485 expressed higher total and phosphorylated mTOR
(Ser2448 and Ser2481) levels and exhibited increased phosphory-
lation of 4E-BP1 (Thr37/46 and Thr70) and p70S6K (Thr389) than
cells treated with OGD alone (Fig. 5h and j, 5l, 5m, and 5o).
Furthermore, the addition of MHY1485 to the culture medium
reduced LC3B-II levels but increased p62 levels (Fig. 5p and q),
suggesting that treatment with the mTOR activator attenuated
OGD-induced autophagy in cytotrophoblast cells.
In a parallel study, we investigated the effects of rapamycin on
OGD-induced changes in ER stress, mTOR activity, and autophagy
levels. As shown in Fig. 6a and c, significant differences in XBP-1
mRNA, BiP, and GADD153 levels were not observed between cells
treated with or without rapamycin, suggesting that rapamycin had
no effects on OGD-induced ER stress. The levels of REDD1 and total
and phosphorylated forms of TSC2 did not differ between the two
groups of cells (Fig. 6d and g). Cells treated with OGD and rapa-
mycin expressed lower levels of phosphorylated mTOR (Ser2448
and Ser2481), 4E-BP1 (Thr37/46 and Thr70), and p70S6K (Thr389)
than cells treated with OGD alone (Fig. 6i and j, 6l, 6m, and 6o),
although the difference in total mTOR, 4E-BP1 and p70S6K levels
between the two groups was not significant (Fig. 6h and k, and 6n).
Moreover, the rapamycin treatment increased OGD-induced auto-
phagy in the corresponding cytotrophoblast cells compared to
OGD-treated cells, as reflected by increases in LC3B-II levels and
decreases in p62 levels (Fig. 6p and q).
15
3.6. Effects of salubrinal, MHY1485, and rapamycin on the changes
in ER stress, mTOR activity, and autophagy levels in cytotrophoblast
cells cultured under standard conditions
The effects of salubrinal, MHY1485, and rapamycin on the
changes in ER stress, mTOR activity, and autophagy levels in cyto-
trophoblast cells cultured under standard conditions are shown in
the Supplementary data (Supplementary Figs. 3e8).
4. Discussion
Based on our results, women with pregnancies complicated by
IUGR exhibited higher placental ER stress and autophagy levels but
lower mTOR activity than women with normal pregnancies. We
studied cytotrophoblast cells isolated from normal term placentas
and found that (1) in vitro OGD increased ER stress, REDD1, total
and phospho-TSC2, and autophagy levels; (2) OGD decreased the
levels of total and phosphorylated mTOR, which was associated
with decreases in phosphorylation of the mTOR target proteins 4E-
BP1 and p70S6K; (3) the administration of salubrinal (an ER stress
inhibitor) to cells subjected to OGD reduced ER stress, REDD1,
phosphorylated TSC2, and autophagy levels but increased mTOR
activity; (4) the administration of MHY1485 (an mTOR activator) to
cells treated with OGD had no effects on OGD-induced increases in
ER stress, but increased mTOR activity and decreased autophagy
levels; and (5) the administration of rapamycin (an mTOR inhibitor)
to cells subjected to OGD had no effects on OGD-induced increases
in ER stress but decreased mTOR activity and increased autophagy
levels.
Consistent with the findings of previous reports [5,19], our
findings indicated that placentas from pregnancies complicated by
IUGR had higher ER stress levels than placentas from normal
pregnancies. The results of recent studies also indicate that the
levels of autophagy-related changes in the trophoblast layers of
placentas from pregnancies complicated by IUGR are increased
compared to those in the trophoblast layers of placentas from
normal pregnancies [10,11]. Although increasing numbers of
studies regarding the mechanistic link between ER stress and
autophagy have been performed [20], the relationship between
placental ER stress and autophagy in the pathogenesis of IUGR has
not been addressed. In this study, we found that OGD-induced ER
stress caused increases in REDD1 levels and TSC2 phosphorylation,
increases that reduced mTOR activity and led to subsequent auto-
phagic changes in cytotrophoblast cells. However, administering
salubrinal attenuated these changes. The biological significance of
ER stress-induced autophagy remains unclear. We speculate that
the increase in autophagy, a process whereby aggregates of mis-
folded proteins are degraded, and their constituent elements are
recycled to maintain energy homeostasis, synthesize macromole-
cules, and create a nutritional reserve, protects cells against ER
stress and apoptosis caused by abnormal placental perfusion in
pregnancies complicated by IUGR. ER stress-induced autophagy
actively participates in reducing ER stress by degrading unfolded or
misfolded proteins [21] or blocking apoptosis [22]. ER stress-
induced autophagy also protects the cell from hypoxia and oxida-
tive stress in vitro [23] and ischemia-reperfusion injury in vivo [24].
mTOR is a serine/threonine protein kinase responsible for
mediating the effects of many signaling molecules, including
growth factors, amino acids, glucose, and energy status-related
signaling molecules. mTOR is mainly expressed in the syncytio-
trophoblast layer of the human placenta [13]. Through interactions
with different accessory proteins, namely, raptor or rictor, mTOR
exists as one of two complexes (mTORC1 and mTORC2) that are
regulated by distinct mechanisms and have distinct functions [12].
Based on accumulating evidence, mTORC1 exerts general effects on
16 T.-H. Hung et al. / Placenta 60 (2017) 9e20

Fig. 4. Effect of salubrinal on OGD-induced changes in ER stress, mTOR activity, and autophagy levels in cultured cytotrophoblast cells. We subjected cytotrophoblast cells to
OGD and treated them with or without 50 mM salubrinal to determine the role of ER stress in the OGD-induced changes in mTOR activity and autophagy levels. The salubrinal
treatment attenuated OGD-induced changes in the XBP-1 mRNA, BiP, and GADD153 levels, confirming that the agent exerts inhibitory effects on ER stress (aec). Total TSC2 levels did
not exhibit significant changes between the two groups (e); however, cells subjected to OGD and the salubrinal treatment expressed lower levels of REDD1 (d) and phosphorylated
TSC2 (Tyr1571 and Thr1462) than cells treated with OGD alone (f and g). In contrast, the salubrinal treatment increased total and phosphorylated mTOR (Ser2448 and Ser2481),
phospho-4E-BP1 (Thr37/46 and Thr70), and phospho-p70S6K (Thr389) levels compared to treatment with the vehicle control (h-j, l, m, and o). Furthermore, the salubrinal
treatment attenuated OGD-induced changes in cytotrophoblast cell autophagy, an attenuation signified by decreases in LC3B-II levels (p) and increases in p62 levels (q). Data are
presented as means ± S.E.M. Eight individual experiments were performed. *, P < 0.05; **, P < 0.01; ***, P < 0.001, compared to cells treated with OGD alone. OGD, oxygen-glucose
deprivation condition; SAL, salubrinal.
 T.-H. Hung et al. / Placenta 60 (2017) 9e20 17

Fig. 5. Effects of MHY1485 on OGD-induced changes in ER stress, mTOR activity, and autophagy levels in cultured cytotrophoblast cells. We subjected cytotrophoblast cells to
OGD and treated them with or without 2 mM MHY1485, an mTOR activator, after which we assessed the changes in ER stress, mTOR activity, and autophagy levels elicited by these
treatments to investigate the role of mTOR in OGD-induced autophagy. No significant differences in the XBP-1 mRNA, BiP, and GADD153 levels were observed between vehicle
control-treated cells and MHY1485-treated cells, suggesting that MHY1485 had no effects on OGD-induced ER stress (aec). The levels of the ER stress targets REDD1 and TSC2 were
also similar between the two groups of cells (deg). Cells cultured with MHY1485 expressed higher levels of total and phosphorylated mTOR (Ser2448 and Ser2481), phospho-4E-
BP1 (Thr37/46 and Thr70), and phospho-p70S6K (Thr389) than cells treated with OGD alone (h-j, l, m, and o). Furthermore, the addition of MHY1485 to the culture medium reduced
LC3B-II levels (p), but increased p62 levels (q). Data are presented as means ± S.E.M. Eight individual experiments were performed. *, P < 0.05; **, P < 0.01, compared to cells treated
with OGD alone. OGD, oxygen-glucose deprivation condition; MHY, MHY1485.
18 T.-H. Hung et al. / Placenta 60 (2017) 9e20

Fig. 6. Effects of rapamycin on OGD-induced changes in ER stress, mTOR activity, and autophagy levels in cultured cytotrophoblast cells. In a parallel study, we investigated
the effects of the mTOR inhibitor rapamycin on OGD-induced changes in ER stress, mTOR activity, and autophagy levels. No significant differences in XBP-1 mRNA, BiP, GADD153,
REDD1, and TSC2 levels were observed between vehicle control-treated cells and rapamycin-treated cells (aeg), suggesting that rapamycin had no effects on OGD-induced ER stress.
Cells cultured with rapamycin expressed lower levels of phosphorylated mTOR (Ser2448 and Ser2481), phospho-4E-BP1 (Thr37/46 and Thr70), and phospho-p70S6K (Thr389) than
cells cultured with vehicle controls (i, j, l, m, and o); however, no differences in total mTOR, 4E-BP1, and p70S6K levels were observed between the two groups (h, k, and n). The
addition of rapamycin to the culture medium increased OGD-induced autophagy in cytotrophoblast cells, as signified by increases in LC3B-II levels (p) and decreases in p62 levels
(q). Data are presented as means ± S.E.M. Eight individual experiments were performed. *, P < 0.05; **, P < 0.01, compared to cells treated with OGD alone. OGD, oxygen-glucose
deprivation condition; RAPA, rapamycin.
 T.-H. Hung et al. / Placenta 60 (2017) 9e20
protein synthesis, namely, the overall translation rates [25], and
plays a primary role in regulating autophagy [12]. Emerging evi-
dence also indicates that placental mTORC1 signaling serves as a
key mechanism linking maternal nutrient availability to fetal
growth by regulating placental nutrient transporters [26]. De-
creases in placental mTOR activity have been noted in hyperther-
mia- or hypoxia-induced IUGR in sheep and rats [27,28] and after
maternal nutrient restriction in baboons [29]. However, the
changes in the expression levels of total and phosphorylated mTOR
and their downstream target proteins in human placentas from
pregnancies complicated by IUGR noted by previous studies are
inconsistent. Some studies noted increases in total mTOR levels
[13,30] and decreases in mTOR activity (signified by changes in the
ratio of phosphorylated to total mTOR or the levels of some of
mTOR target proteins, such as phosphorylated p70S6K) in placentas
from women with pregnancies complicated by IUGR compared to
placentas from women with normal pregnancies [5,13], whereas
other studies did not observe significant differences in the levels of
these factors between the two groups [31]. Several methods have
been used to reveal changes in mTOR activation, including mea-
surements of the levels of total and phosphorylated mTOR, the
ratios of phosphorylated to total mTOR, and the phosphorylation of
the mTOR downstream targets 4E-BP1 and p70S6K. Although
phosphorylation sites may provide some information about the
upstream signals impinging on mTOR, they have no bearing on
mTOR activity. Indeed, mutations of Ser2448 in mTOR do not affect
the ability of mTOR to activate downstream targets such as p70S6K
[32]. Therefore, mTOR activation is more conventionally reported
as 4E-BP1 and p70S6K phosphorylation. In the present study, we
noted decreases in total and phospho-mTOR (Ser2448) levels in
placentas from pregnancies complicated by IUGR compared to
placentas from normal pregnancies. These changes were associated
with a decrease in the phosphorylation of the mTORC1 target
proteins 4E-BP1 and p70S6K, indicating decreased activation of
mTORC1. These results support the hypothesis that placental
mTORC1 plays an important role in pregnancies complicated by
IUGR.
OGD induced a significant decrease in the level of phospho-
mTOR (Ser2481) compared with that in the cells cultured under
standard conditions. However, the levels of phospho-mTOR
(Ser2481) were not different between the placentas of IUGR preg-
nancies and the placentas of normal pregnancies. There are several
possible explanations for the discrepancy between our in vivo and
in vitro findings. First, although we have tried our best to collect as
many IUGR placentas as possible and performed villous sampling in
an objective and systematic manner, considerable individual vari-
ations always exist between different people and different
placental lobules. We observed a lower level of phospho-mTOR
(Ser2481) in the IUGR placentas than in the normal placentas;
nevertheless, the difference did not reach statistical significance. An
analysis of more placental samples may reveal a difference. Second,
we subjected the cytotrophoblast cells to OGD for 24 h, a condition
with a sufficiently strong impact to induce a substantial cellular
response, allowing us to investigate the changes of ER stress, mTOR
activity, and autophagy in a short period. This in vitro model is
undoubtedly over-simplistic, as the placental changes in IUGR
pregnancies most likely evolve in a slower and subtler way and are
sustained throughout gestation.
The administration of either MHY1485 or rapamycin to cyto-
trophoblast cells treated with OGD had no effects on OGD-induced
increases in ER stress. In contrast, MHY1485 administration
increased mTOR activation and decreased autophagy levels,
whereas rapamycin decreased mTOR activation and increased
autophagy levels. Based on these results, at the concentrations of
MHY1485 and rapamycin used in this study, the inhibitory and
19
stimulatory effects of MHY1485 and rapamycin, respectively, on
autophagy were mainly mediated by the regulation of mTOR ac-
tivity. Moreover, ER stress functions upstream of mTOR activation
in this in vitro OGD model.
The method of isolation and culture of cytotrophoblast cells
used in this study is well established and has been used in many
previous studies [33]. We did not administer agents such as
extracellular signal-regulated kinase1/2 (ERK1/2) and p38 in-
hibitors (SB203580 and PD98059) to block the differentiation of the
cytotrophoblast cells [34]. Therefore, gradual syncytialization was
noted by immunofluorescence of cytokeratin 7 and secretion of
hCG into the medium and the effect became more significant after
24 h of incubation. Like all in vitro data the results from this study
should be interpreted carefully as both cytotrophoblast cells and
syncytiotrophoblast were present at the end of experiment.
Attributing the molecular changes to a particular cell type is
therefore difficult, but our cultures were limited to 24 h and only a
small portion of cytotrophoblast cells, usually less than 10%,
aggregated and fused by that time. Most of the cytotrophoblast
cells still remained isolated. Furthermore, in term human placenta,
the cytotrophoblasts continuously fuse to form the syncytio-
trophoblast. Thus, we consider our model reflects the in vivo
situation.
In addition to ER stress and REDD1, several additional upstream
signaling molecules may regulate mTORC1 activity and, conse-
quently, autophagy during OGD, including p53, AMP-activated
protein kinase (AMPK) and phosphoinositide 3-kinase class I
(PtdIns3K)-protein kinase B (PKB) [35e37]. Additional studies are
needed to clarify the roles of these signaling pathways in the re-
sponses of cytotrophoblast cells to oxygen, glucose, or nutrient
deprivation, in placental function and in fetal wellbeing.
Conflict of interest statement
The authors have no conflicts of interests to declare.
Acknowledgements
This work was supported by grants from the Ministry of Science
and Technology, Taiwan (MOST 103-2314-B-182A-099-MY1 and
103-2314-B-182A-099-MY2 to THH) and Chang Gung Memorial
Hospital (NMRPG1D6011-NMRPG1D6012 and BMRP688 to THH,
and CMRPD190651-CMRPD190653 and BMRPC17 to CPW). The
authors are grateful to the staff of the Delivery Unit of Chang Gung
Memorial Hospital at Taipei for their assistance in obtaining the
placental material and to the Genomic Medicine Research Core
Laboratory, the Microscope Core Laboratory, and the Tissue Bank of
Chang Gung Memorial Hospital at Linkou for providing technical
support.
Appendix A. Supplementary data
Supplementary data related to this article can be found at
https://doi.org/10.1016/j.placenta.2017.10.001.
References
[1] T.H. Hung, T.T. Hsieh, L.M. Lo, T.H. Chiu, C.C. Hsieh, J.J. Hsu, Risk factors and
perinatal outcomes associated with idiopathic small for gestational age
Taiwanese newborns, Int. J. Gynaecol. Obstet. 122 (2013) 212e215.
[2] I. Brosens, R. Pijnenborg, L. Vercruysse, R. Romero, The “Great Obstetrical
Syndromes” are associated with disorders of deep placentation, Am. J. Obstet.
Gynecol. 204 (2011) 193e201.
[3] T.H. Hung, G.J. Burton, Hypoxia and reoxygenation: a possible mechanism for
placental oxidative stress in preeclampsia, Taiwan J. Obstet. Gynecol. 45
(2006) 189e200.
[4] G.J. Burton, E. Jauniaux, D.S. Charnock-Jones, The influence of the intrauterine
20 T.-H. Hung et al. / Placenta 60 (2017) 9e20
environment on human placental development, Int. J. Dev. Biol. 54 (2010)
303e312.
[5] H.W. Yung, S. Calabrese, D. Hynx, B.A. Hemmings, I. Cetin, D.S. Charnock-Jones,
et al., Evidence of placental translation inhibition and endoplasmic reticulum
stress in the etiology of human intrauterine growth restriction, Am. J. Pathol.
173 (2008) 451e462.
[6] H.W. Yung, M. Hemberger, E.D. Watson, C.E. Senner, C.P. Jones, R.J. Kaufman,
et al., Endoplasmic reticulum stress disrupts placental morphogenesis: im-
plications for human intrauterine growth restriction, J. Pathol. 228 (2012)
554e564.
[7] H.W. Yung, S. Korolchuk, A.M. Tolkovsky, D.S. Charnock-Jones, G.J. Burton,
Endoplasmic reticulum stress exacerbates ischemia-reperfusion-induced
apoptosis through attenuation of Akt protein synthesis in human choriocar-
cinoma cells, FASEB J. 21 (2007) 872e884.
[8] M.C. Maiuri, E. Zalckvar, A. Kimchi, G. Kroemer, Self-eating and self-killing:
crosstalk between autophagy and apoptosis, Nat. Rev. Mol. Cell Biol. 8
(2007) 741e752.
[9] T.H. Hung, T.T. Hsieh, S.F. Chen, M.J. Li, Y.L. Yeh, Autophagy in the human
placenta throughout gestation, PLoS One 8 (2013) e83475.
[10] S. Curtis, C.J. Jones, A. Garrod, C.H. Hulme, A.E. Heazell, Identification of
autophagic vacuoles and regulators of autophagy in villous trophoblast from
normal term pregnancies and in fetal growth restriction, J. Matern. Fetal
Neonatal Med. 26 (2013) 339e346.
[11] T.H. Hung, S.F. Chen, L.M. Lo, M.J. Li, Y.L. Yeh, T.T. Hsieh, Increased autophagy
in placentas of intrauterine growth-restricted pregnancies, PLoS One 7 (2012)
e40957.
[12] Y.C. Kim, K.L. Guan, mTOR: a pharmacologic target for autophagy regulation,
J. Clin. Invest. 125 (2015) 25e32.
[13] S. Roos, N. Jansson, I. Palmberg, K. Saljo, T.L. Powell, T. Jansson, Mammalian
target of rapamycin in the human placenta regulates leucine transport and is
down-regulated in restricted fetal growth, J. Physiol. 582 (2007) 449e459.
[14] S. Roos, O. Lagerlof, M. Wennergren, T.L. Powell, T. Jansson, Regulation of
amino acid transporters by glucose and growth factors in cultured primary
human trophoblast cells is mediated by mTOR signaling, Am. J. Physiol. Cell
Physiol. 297 (2009) C723eC731.
[15] B. Chen, M.S. Longtine, D.M. Nelson, Hypoxia induces autophagy in primary
human trophoblasts, Endocrinology 153 (2012) 4946e4954.
[16] T.H. Hung, S.F. Chen, C.C. Hsieh, J.J. Hsu, M.J. Li, Y.L. Yeh, et al., Tumor necrosis
factor-alpha converting enzyme in the human placenta throughout gestation,
Reprod. Sci. 15 (2008) 195e209.
[17] C.M. Oslowski, F. Urano, Measuring ER stress and the unfolded protein
response using mammalian tissue culture system, Methods Enzymol. 490
(2011) 71e92.
[18] D.J. Klionsky, K. Abdelmohsen, A. Abe, M.J. Abedin, H. Abeliovich, A. Acevedo
Arozena, et al., Guidelines for the use and interpretation of assays for moni-
toring autophagy (3rd edition), Autophagy 12 (2016) 1e222.
[19] J. Fu, L. Zhao, L. Wang, X. Zhu, Expression of markers of endoplasmic reticulum
stress-induced apoptosis in the placenta of women with early and late onset
severe pre-eclampsia, Taiwan J. Obstet. Gynecol. 54 (2015) 19e23.
[20] M. Hoyer-Hansen, M. Jaattela, Connecting endoplasmic reticulum stress to
autophagy by unfolded protein response and calcium, Cell Death Differ. 14
(2007) 1576e1582.
[21] Y. Ishida, K. Nagata, Autophagy eliminates a specific species of misfolded
procollagen and plays a protective role in cell survival against ER stress,
Autophagy 5 (2009) 1217e1219.
[22] M. Ogata, S. Hino, A. Saito, K. Morikawa, S. Kondo, S. Kanemoto, et al., Auto-
phagy is activated for cell survival after endoplasmic reticulum stress, Mol.
Cell Biol. 26 (2006) 9220e9231.
[23] T. Fan, L. Chen, Z. Huang, Z. Mao, W. Wang, B. Zhang, et al., Autophagy de-
creases alveolar macrophage apoptosis by attenuating endoplasmic reticulum
stress and oxidative stress, Oncotarget 7 (2016) 87206e87218.
[24] B.B. Chandrika, C. Yang, Y. Ou, X. Feng, D. Muhoza, A.F. Holmes, et al., Endo-
plasmic reticulum stress-induced autophagy provides cytoprotection from
chemical hypoxia and oxidant injury and ameliorates renal ischemia-
reperfusion injury, PLoS One 10 (2015) e0140025.
[25] X.M. Ma, J. Blenis, Molecular mechanisms of mTOR-mediated translational
control, Nat. Rev. Mol. Cell Biol. 10 (2009) 307e318.
[26] T. Jansson, I.L. Aye, D.C. Goberdhan, The emerging role of mTORC1 signaling in
placental nutrient-sensing, Placenta 33 (Suppl 2) (2012) e23ee29.
[27] J.A. Arroyo, L.D. Brown, H.L. Galan, Placental mammalian target of rapamycin
and related signaling pathways in an ovine model of intrauterine growth
restriction, Am. J. Obstet. Gynecol. 201 (616) (2009) e1e7.
[28] R. Kimball, M. Wayment, D. Merrill, T. Wahlquist, P.R. Reynolds, J.A. Arroyo,
Hypoxia reduces placental mTOR activation in a hypoxia-induced model of
intrauterine growth restriction (IUGR), Physiol. Rep. (2015) 3.
[29] J.V. Kavitha, F.J. Rosario, M.J. Nijland, T.J. McDonald, G. Wu, Y. Kanai, et al.,
Down-regulation of placental mTOR, insulin/IGF-I signaling, and nutrient
transporters in response to maternal nutrient restriction in the baboon, FASEB
J. 28 (2014) 1294e1305.
[30] Y. Aiko, D.J. Askew, S. Aramaki, M. Myoga, C. Tomonaga, T. Hachisuga, et al.,
Differential levels of amino acid transporters System L and ASCT2, and the
mTOR protein in placenta of preeclampsia and IUGR, BMC Pregnancy Child-
birth 14 (2014) 181.
[31] F.B. Fahlbusch, A. Hartner, C. Menendez-Castro, S.C. Nogel, I. Marek,
M.W. Beckmann, et al., The placental mTOR-pathway: correlation with early
growth trajectories following intrauterine growth restriction? J. Dev. Orig.
Health Dis. 6 (2015) 317e326.
[32] A. Sekulic, C.C. Hudson, J.L. Homme, P. Yin, D.M. Otterness, L.M. Karnitz, et al.,
A direct linkage between the phosphoinositide 3-kinase-AKT signaling
pathway and the mammalian target of rapamycin in mitogen-stimulated and
transformed cells, Cancer Res. 60 (2000) 3504e3513.
[33] M.G. Petroff, T.A. Phillips, H. Ka, J.L. Pace, J.S. Hunt, Isolation and culture of
term human trophoblast cells, Methods Mol. Med. 121 (2006) 203e217.
[34] G. Daoud, M. Amyot, E. Rassart, A. Masse, L. Simoneau, J. Lafond, ERK1/2 and
p38 regulate trophoblasts differentiation in human term placenta, J. Physiol.
566 (2005) 409e423.
[35] Z. Feng, H. Zhang, A.J. Levine, S. Jin, The coordinate regulation of the p53 and
mTOR pathways in cells, Proc. Natl. Acad. Sci. U S A. 102 (2005) 8204e8209.
[36] D.M. Gwinn, D.B. Shackelford, D.F. Egan, M.M. Mihaylova, A. Mery,
D.S. Vasquez, et al., AMPK phosphorylation of raptor mediates a metabolic
checkpoint, Mol. Cell 30 (2008) 214e226.
[37] K. Inoki, Y. Li, T. Zhu, J. Wu, K.L. Guan, TSC2 is phosphorylated and inhibited by
Akt and suppresses mTOR signalling, Nat. Cell Biol. 4 (2002) 648e657.