Neuropharmacology xxx (xxxx) xxx-xxx

Contents lists available at ScienceDirect Edit Proof PDF

Neuropharmacology
journal homepage: http://ees.elsevier.com

F
OO
Early exposure to environmental enrichment modulates the effects of prenatal ethanol
exposure upon opioid gene expression and adolescent ethanol intake
Aranza Wille-Bille a , Fabio Bellia b , Ana María Jiménez García d , Roberto Sebastián Miranda-Morales a ,c ,

PR
Claudio D'Addario b , , Ricardo Marcos Pautassi a ,c ,
∗∗ ∗

a Instituto de Investigación Médica M. y M. Ferreyra (INIMEC–CONICET-Universidad Nacional de Córdoba), Córdoba, C.P. 5000, Argentina
b Faculty of Bioscience and Technology for Food, Agriculture and Environment, Università degli Studi di Teramo, Teramo, C.P. 64100, Italy
c Facultad de Psicología, Universidad Nacional de Córdoba, Córdoba, C.P. 5000, Argentina
d Facultad de Medicina, Departamento de Farmacología, Universidad de Granada, Granada, C.P. 18071, Spain

ARTICLE INFO

Keywords D
Short-term selective breeding
ABSTRACT

Prenatal ethanol exposure (PEE) promotes ethanol consumption in the adolescent offspring accompanied by the
transcriptional regulation of kappa opioid receptor (KOR) system genes. This study analysed if environmental
TE
Adolescents enrichment (EE, from gestational day 20 to postnatal day 26) exerts protective effects upon PEE-modulation of
Ethanol aversion gene expression, ethanol intake and anxiety responses. Pregnant rats were exposed to PEE (0.0 or 2.0  g/kg
Ethanol intake ethanol, gestational days 17–20) and subsequently the dam and offspring were reared under EE or standard con‐
ditions. PEE upregulated KOR mRNA levels in amygdala (AMY) and prodynorphin (PDYN) mRNA levels in ven‐
tral tegmental area (VTA) with the latter effect associated with lower DNA methylation at the gene promoter.
These effects were normalized by exposure to EE. PEE modulated BDNF mRNA levels in VTA and Nucleus ac‐
cumbens (AcbN), and EE mitigated the changes in AcbN. EE induced a protective effect on ethanol intake and
EC

preference, an effect more noticeable in males than in females, and in prenatal vehicle-treated (PV) than in PEE
rats. The male offspring drank significantly less ethanol than the female offspring. The latter result suggests that
the protective effect of EE on ethanol drinking may only emerge at lower levels of drinking. In the dams, PEE
induced an upregulation of PDYN and KOR in AcbN. PDYN gene expression was normalized by exposure to EE.
These results suggest that EE is a promising treatment to inhibit the effects of PEE. The results confirm that PEE
effects are mediated by alterations in the transcriptional regulation of KOR system genes.
RR

1. Introduction gentina. PEE induces detrimental consequences in the offspring, includ‐

Prenatal alcohol (ethanol) exposure (PEE) is highly prevalent, with
studies reporting that three-quarters of pregnant women consumed al‐
cohol sometime during pregnancy in Argentina (Lopez et al., 2015,
CO
ing fetal alcohol syndrome disorders [FASD (Ri ley et al., 2011),] and
increases the likelihood of problematic ethanol intake at adolescence or
adulthood (Alati et al., 2006; Day et al., 2013).
Some pre-clinical models of PEE induce relatively high doses of

2017), 30% did so during the second trimester in the UK (O' Ke effe et
al., 2015), and 8.4% drank in the last month before delivery, in the US
(Bakhireva et al., 2017, 2019). Most women stop drinking when
they learn they are pregnant. A significant fraction of pregnancies,
however, are unplanned (approximately 50% in the US; Mosher et al.,
2012), which facilitates drinking during the first trimester prior to ac‐
knowledgment of pregnancy. On the other hand, drinking close to the
delivery is most often associated with a diagnosis of alcohol use disor‐
UN
ethanol throughout pregnancy by exposing rat/mice dams to vaporized
ethanol or to liquid diets containing the drug (Cu zon et al., 2008;
De la tour et al., 2019; Eade et al., 2009; Fontaine et al., 2019;
Miller, 2017; Shen oda, 2017). Our lab and others (Bor d ner and
Deak, 2015; Gut tlein et al., 2019; Popoola et al., 2017) have ex‐
plored the effects of moderate exposure to intubations of ethanol at the
end of the rat's pregnancy (gestational days 17–20, GDs 17–20, 1.0–
2.0 g/kg/day). This induces heightened ethanol intake in the infant and

ders. Lopez et al. (2017) reported, using the classification of the In‐ adolescent offspring, heightened ethanol-induced conditioned place
ternational Classification of Diseases, 11.9% harmful alcohol use and preference (CPP), and conditioned responses to stimuli paired with the
2.2% alcohol dependence in a sample of puerperal women from Ar effects of in-utero ethanol (Abate et al., 2014; Chotro et al., 2007;
Spear and Molina, 2005).

∗
Corresponding author. Instituto de Investigación Médica M. y M. Ferreyra (INIMEC – CONICET-UNC), Friuli 2434, Córdoba, C.P. 5016, Argentina.
∗∗
Corresponding author. Faculty of Bioscience and Technology for Food, Agriculture and Environment, University of Teramo, via R. Balzarini 1 64100, Teramo.
E-mail addresses: cdaddario@unite.it (C. D'Addario); rpautassi@gmail.com (R.M. Pautassi)

https://doi.org/10.1016/j.neuropharm.2019.107917
Received 6 September 2019; Received in revised form 10 December 2019; Accepted 18 December 2019
Available online xxx
0028-3908/© 2019.
Edit Proof PDF
A. Wille-Bille et al.
Early work showed that morphine-induced analgesia is potentiated
after PEE (Nel son et al., 1986) and, more recently, Chotro and
Arias (2003) found that the opioid antagonist naloxone (at doses
likely to act on all opioid receptor types) blocked the increased palata‐
bility of ethanol found after PEE. Among opioid systems, the kappa opi‐
oid system is well suited to be impacted by ethanol, since it exhibits a
normative developmental switch by the end of the first week of life
(Nizh nikov et al., 2012), from mediating appetitive to aversively mo‐
tivated behaviors (Petrov et al., 2006). It has been reported that
kappa opioid receptor (KOR) activation induced conditioned place
aversion in control rats, but not in those exposed to PEE, which also
had lower synaptosomal KOR expression (Nizh nikov et al., 2014).
Alterations of the KOR system should facilitate ethanol drinking by
modulating its aversive (Mitchell et al., 2005) or appetitive motiva‐
tional effects (Lo grip et al., 2009) or, when KOR is upregulated, by
rendering the subject more sensitive to stress-induced drinking
(Walker and Koob, 2008).
Prenatal ethanol exposure (1.0 or 2.0  g/kg/day on GDs 17–20)
modulates opioid mRNA expression in infant rats (Gut tlein et al.,
2019) and reduced opioid-related proteins within the nucleus accum‐
bens (Bor d ner and Deak, 2015). Of note, we have reported an in‐
crease in mRNA levels of KOR and prodynorphin (PDYN) -- the gene
coding for the preprotein that yields dynorphins, the endogenous lig‐
ands of KOR -- in the VTA of infant and adolescent rats exposed to pre‐
D
natal ethanol [GDs 17–20, 2.0  g/kg/day]. These effects were consis‐
tently associated with a reduction of DNA methylation at PDYN and
KOR gene promoters (Wille-Bille et al., 2018). Moreover, in agree‐
ment with the key role of KOR on sensitivity to stress and aversive
TE
stimulation, the changes in transcriptional regulation were associated
with an anxiety-prone phenotype (Wille-Bille et al., 2018).
There have been several attempts to develop non-pharmacological
treatments to reduce the impact of PEE. For instance, supplementation
with choline improved working memory and reversal learning deficits
caused by PEE in rats (Wad dell and Mooney, 2017), and the effec‐
EC
tiveness of choline to improve cognitive function in children diagnosed
with FASD is under investigation [for review and references see (Ak i ‐
son et al., 2018)]. In the present study we attempted to mitigate some
of the behavioral and molecular effects of PEE by exposing dams and
offspring to environmental enrichment (EE; Stairs et al., 2006).
It has been found that rodents reared under EE have altered
RR
ethanol-related phenotypes (Pau tassi et al., 2017; Rae et al., 2018).
CPP by ethanol (de Car valho et al., 2010) or cocaine (Soli nas et
al., 2009) is inhibited by EE, and mice reared under EE are insensitive
to ethanol-induced behavioral sensitization (Rueda et al., 2012). Rats
exposed to EE also exhibit lower ethanol intake (de Car valho et al.,
2010) and anxiety (Ya m aguchi et al., 2017) than peers reared under
standard conditions. Gene expression is sensitive to changes in the rear‐
CO
ing environment (Munet suna et al., 2011), and thus it is possible
that EE could also suppress ethanol's actions on gene transcription. EE
affects multiple biological signaling pathways, yet it has been suggested
that it promotes proliferation and architecture of neurons via alter‐
ations in the levels of brain-derived neurotrophic factor (BDNF) in the
hippocampus (Falken berg et al., 1992; Ramirez-Ro driguez et al.,
2014) and PFC, where it also induces changes in the dopaminergic sys‐
UN
tem (Zhu et al., 2005). Of relevance, BDNF has been connected with
dynorphin (DYN) regulation in ethanol intake (Lo grip et al., 2008);
and we have already documented, in preclinical (D'Ad dario et al.,
2013) and clinical studies (D'Ad dario et al., 2017), alterations in the
transcriptional regulation of the PDYN gene after ethanol exposure.
The present study measured PEE-induced alterations in brain tran‐
scriptional regulation of KOR system genes as well as BDNF and the
possible role of EE in modulating these effects. Pregnant rats were ex‐
posed to vehicle or PEE (2.0  g/kg, i.g.; GDs 17–20) and thereafter
2
Neuropharmacology xxx (xxxx) xxx-xxx
dams as well as offspring were exposed to EE or non-enriched (NE)
conditions up to postnatal day 14 (infancy) or 26 (early adolescence),
when the offspring was assessed for anxiety-like behavior or chronic
free-choice ethanol intake,
Edit the latter in ado
Proof lescent rats only. Transcrip‐
PDF
tional regulation of PDYN, KOR and BDNF genes in brain areas that are
key for the processing of ethanol's motivational effects [VTA, AcbN,
F
amygdala (AMY) and prefrontal cortex (PFC; Koob, 2013)], as well as
DNA methylation at the promoter of genes which expression resulted
altered, was also evaluated. Gene expression of PDYN, KOR and BDNF
OO
was measured in the dams.
Several groups have identified postnatal days 7–14 [PDs 7–14] and
PDs 21–27 of the rat as corresponding to the infancy or juvenile-early
adolescence period in humans (Bal aszczuk et al., 2019; Gaz tanaga
et al., 2017; Pau tassi et al., 2007), and the subsequent week as
mid-adolescence (Burke and Miczek, 2014; Dore mus-Fitzwa ter
and Spear, 2016; Karanikas et al., 2013; Spear, 2000). The use of
PR
alcohol during late childhood and early adolescence has been well doc‐
umented (Dono van, 2013), with several studies indicating that drink‐
ing behavior during these stages is a risk factor for subsequent develop‐
ment of problematic alcohol use (Morean et al., 2014).
2. Material and methods
2.1. Experimental design, subjects and prenatal administration procedures
A 2 (prenatal treatment: ethanol [PEE] vs. prenatal vehicle
[PV]) × 2 (age of testing: infancy vs. adolescence) × 2 (sex: male vs.
female) x 2 (rearing condition: standard or non-enriched vs. environ‐
mental enrichment, NE vs. EE, respectively) factorial was employed in
Experiment 1 (n = 7–9 per group, except PV-NE-infant males, in which
n = 6). Separate groups of rats were assessed on postnatal day PD14 or
PD26 for anxiety response in the light-dark box (LDB) test. One day af‐
ter the LDB test, 4 animals of each group were randomly selected for
brain extraction and assessment of gene expression or epigenetic regu‐
lation of such expression.
Experiment 2a (7–9 animals in each PV group; 7–12 animals in each
PEE group) and 2b (6–8 animals in each PV group, except PV-NE fe‐
males which had 5; 7–9 animals in each PEE group) were 2 (prenatal
treatment: PEE vs. PV) × 2 (sex: male vs. female) x 2 (rearing condi‐
tion: NE vs. EE) factorials and assessed free-choice ethanol or water in‐
take, respectively.
The offspring, 257 outbred Wistar rats (140 PEE, 117 PV) born and
reared at the Instituto de Investigación Médica Mercedes y Martín Fer‐
reyra (Córdoba, Argentina), were derived from 32  dams (15  PV, 17
PEE). The dams were given, on GDs 17–20, one daily i.g. administra‐
tion of 0.015 ml/g of a 16.8% v/v ethanol solution (vehicle: tap water;
ethanol dose: 2.0 g/kg) or a similar volume of vehicle. Blood ethanol
concentrations were not measured. Yet, previous studies that employed
this protocol reported that, 20  min post-administration, dams and fe‐
tuses exhibit blood ethanol concentration of 160 and 120  mg/dl, re‐
spectively (Dominguez et al., 1996).
One male and one female from a given litter were assigned to each
group. The mean number of pups yielded by PEE and PV dams was
8.76 ± 0.49 and 8.93 ± 0.56 pups (t30 = 0.23, p > 0.80), and there
were no significant differences in body weight between PV and PEE
dams during the alcohol exposure period. Mean ± SEM body weights
(g) during GDs 17–20 were 354.13  ±  4.85 and 369.59  ±  8.18,
367.67  ±  4.95 and 388.35  ±  9.25, 380.20  ±  5.34 and
396.27 ± 5.77, in PEE and PV dams, respectively.
The procedures were certified by the Institutional Animal Care and
Use Committee at INIMEC-CONICET-UNC, complied with the Declara‐
tion of Helsinki, the ARRIVE guidelines, and the Guide for the Care and
Use of Laboratory Animals (Na tional Re search Coun cil, 1996).
A. Wille-Bille et al.
2.2. Environmental enrichment procedures (Experiments 1 and 2)
Two hours after the last vehicle or ethanol administration on GD
20, the dams were transferred to standard individual housing (60  cm
length x 40 cm width x 20 cm height) lined with corn bedding (stan‐
dard housing group or non-enriched, NE) or to cages also lined with
corn bedding, yet larger than the standard (60  cm length x 40  cm
width x 40 cm height) and equipped with a set of novel objects: a run‐
ning wheel, tunnels made of PVC pipes, house-like plastic structures,
cords and a wire mesh structure that connected the floor with an upper
deck in which a rounded feeder was located (environmental enrich‐
ment housing, EE). The objects were provided in sets of 3–4 that were
rotated twice a week to prevent habituation. Parturition took place in
these cages and the dam with the offspring remained in the correspond‐
ing cages (i.e., standard or enriched) up to PD26, although the dam
was removed from the cage at the standard weaning day of our vivar‐
ium (PD 21). This protocol of EE was based in that reported by Be ‐
rardo et al. (2016).
2.3. Light-dark box (LDB) test (Experiment 1)
On PD14 (infancy) or PD26 (adolescence) the rats were assessed for
anxiety response in a 5-min light-dark box test. Briefly, the apparatus
had a white (24.5 cm × 25 cm × 25 cm, 400 lux illumination) and a
D
black compartment (17.5 cm × 25 cm × 25  cm, 0 lux illumination)
connected by an opening at floor level. The rats were placed in the
white section and latency (s) to first exit the white compartment, num‐
ber of transfers between compartments and time spent (in seconds) in
TE
the white compartment were measured.
EC
RR
CO
UN
Fig. 1. Diagram of the brain areas, representing the antero-posterior levels (relative to Bregma) and based on (Pax i nos, 2007), where the analysed areas were taken. The location is in‐
dicated by the shaded region: Prefrontal Cortex (PFC), Nucleus Accumbens core (AcbN), Amygdala (AMY) and Ventral Tegmental Area (VTA).
3
Neuropharmacology xxx (xxxx) xxx-xxx
2.4. Gene expression measurements (Experiment 1)
One day after the light dark box test, the brain of four males and
four females from each prenatalProof
Edit treatment,PDF
rearing condition and age
group (randomly selected) were obtained by punches under RNase-free
conditions, after decapitation. Similar procedure was conducted on the
F
dams, the day after weaning of their offspring (PD21). Microdissection,
RNA isolation, and real-time quantitative polymerase chain reaction
(RT-PCR) procedures closely followed those of our previous study
OO
(Wille-Bille et al., 2018). Briefly, the brains were frozen in dry ice
and stored in a −70 °C freezer until we performed the procedures to
measure the relative levels of PDYN, KOR, and BDNF. The brain re‐
gions of interest were dissected coronally and the slices began at
3.20  mm anterior to bregma (PFC), 1.68  mm anterior to bregma
(AcbN), −5.28 mm anterior to bregma (VTA) and −2.16 mm anterior to
bregma (AMY; Fig. 1). We used TRIzol Reagent (Thermo Scientific,
PR
Waltham, MA, USA) to extract the total RNA from the punches, whose
integrity was established by electrophoresis using 1% agarose gel. RNA
concentration was assessed spectrophotometrically. One μg of total
RNA was converted to cDNA by means of the RevertAid H Minus First
Strand cDNA Synthesis kit (Thermo Scientific, Waltham, MA, USA) in
presence of random hexamer and oligo (dT)18 primers. RT-qPCR was
used to assess the relative abundance of mRNA of the genes of interest,
using SensiMix SYBR Low-ROX Kit (Bioline Reagents, London, UK), on
a DNA Engine Opticon 2 Continuous Fluorescence Detection System
(MJ Research, Waltham, MA, USA). We defined the relative amount of
each mRNA as the threshold cycle number (Ct) in which the fluores‐
cence was above background levels in the early log phase of product
accumulation in the PCR. Gene expression was normalized using the
A. Wille-Bille et al. Neuropharmacology xxx (xxxx) xxx-xxx

ΔΔ Ct method [i.e., against the β-actin and glyceraldehyde-3-phosphate the VTA of infant and adolescents; and methylation of KOR was mea‐
dehydrogenase (Gapdh) genes] and then converted to the relative ex‐ sured in the AMY of infants. The rationale for measuring only certain
Ct
pression ratio (2 ). The primers used for RT-PCR amplification are
−ΔΔ
genes in certain brain areas in infants or adolescents followed the sig‐
reported in Table 1. nificant differences found
Editin theProof
gene expression assays. Broadly speak‐
PDF
ing, PEE heightened PDYN gene expression in VTA regardless age, and
2.5. Analysis of DNA methylation by methylation-specific primer real-time significant differences in KOR gene expression as a function of prenatal

F
polymerase chain reaction (Experiment 1) treatment and rearing were observed in AMY, in infants but not in ado‐
lescents.
Genomic DNA was extracted from the PFC, AMY, VTA and AcbN of The level of methylation of promoter regions was assessed using py‐

the 64 offspring rats (four males and four females from each prenatal
treatment, age group and rearing condition) in which we assessed the
relative levels of PDYN, KOR, and BDNF, using a TRI Reagent solution
(Thermo Scientific, USA). Methylation of PDYN was measured in
Table 1
Primers employed to measure relative gene expression, during the real time PCR.
OO
rosequencing of bisulfite converted DNA, as described in Wille-Bille et
al. (2018). After DNA extraction, 0.5 μg of DNA from each sample was
treated with bisulfite, using a DNA methylation kit (Zymo Research,
Orange, CA, USA). Bisulfite-treated DNA was amplified by PyroMark
PCR Kit (Qiagen) in accordance with the manufacturer's protocol. PCR
conditions were as follows: 95 °C for 15 min, followed by 45 cycles of
94 °C for 30 s, 56 °C for 30  s, 72  °C for 30  s and, finally, 72  °C for

PR
10 min. The level of methylation was analysed using PyroMark Q24
Gene Sense 5' - 3′ software (Qiagen), which calculates the methylation percentage for
each CpG site, allowing quantitative comparisons (Pucci et al., 2016).
GAPDH Sense AGACAGCCGCATCTTCTTGT
Five and three cytosine-guanine dinucleotide (CpG) sites were consid‐
  Antisense CTTGCCGTGGGTAGAGTCAT
β -Actina Sense AGATCAAGATCATTGCTCCTCCT
ered, within the KOR and PDYN gene promoter's CpG islands, respec‐
  Antisense ACGCAGCTCAGTAACAGTCC tively. The sequence of the primers used for amplification and pyrose‐
Prodinorfin (PDYN) Sense CCTGTCCTTGTGTTCCCTGT quencing are reported in Table 2. Fig. 2 depicts the rat's PDYN and
  Antisense AGAGGCAGTCAGGGTGAGAA KOR genes.

D
Receptor opioide kappa (KOR) Sense AGCTCTTGGTTCCCCAACTG
  Antisense CACCACAGAGTAGACAGCGG 2.6. Intake assessments (Experiments 2a and 2b)
Brain-derived neurotrophic factor Sense CGAGTGGGTCACAGCGGCAG
(BDNF) Ethanol and water intake assessments closely followed those de‐
TE
  Antisense GCCCCTGCAGCCTTCCTTCG
scribed by Fabio et al. (2015). The rats, males and females represen

Table 2
Primers employed to measure DNA methylation. Primers forward (Fwd) and reverse (Rev) were used for the amplification on the genes. Sequence primer (Seq) was used during the py‐
rosequencing of the CpG island.
EC

Gen Primers Secuencia amplificada

PDYN Foward: ctgtagcattgcttttctgaggatacggtgaaacaagcggcaatgtctgtgacg

atgtggttatttggtgagtatttg
  Reverse (biot):  
acaaacctactataacattacttttctaaa
  Secuenciamiento:  
RR

gttatttggtgagtatttggta
KOR Foward: acatcagggacgtggacccatcgaggctgaacagctaccccggagccgaagtgGTGACCTGGAAAACTGACGCTGAT
gagttttttttagttttggaaggtataag
  Reverse (biot):  
aaaaccccaaactcacct
  Secuenciamiento:  
agttttggaaggtataagtt
CO
UN

Fig. 2. Representation of the KOR (A) and PDYN (B) gene, in the rat. The exons are indicated by the white or black squares, whereas the arrows and the black line represent the primers
used for gene expression. The sequence of the promoter regions of the genes in which DNA methylation was measured is described under the inverted Y sign. The specific CpG sites in
which methylation was measured are indicated in bold.

4
A. Wille-Bille et al.
tative of PEE and PV litters reared under EE or NE conditions, were ex‐
posed to two-bottle choice tests between 5% ethanol (Porta Hnos, Cor‐
doba, Argentina) and tap water (Experiment 2a) or to two vehicle-con‐
taining bottles (Experiment 2b). On PD26, four days before the begin‐
ning of the tests, the rats were transferred, in same-sex pairs, to stan‐
dard cages. The rationale was to provide an acclimation period be‐
tween the enriched conditions (that defined rearing for EE groups) and
the social isolation in standard cages, that characterized the intake
tests.
The intake tests began on PD30 and lasted 3 weeks. Each week, the
tests began at 3:00 p.m. on Monday, Wednesday, and Friday and lasted
until 9:00 a.m. the next day. During the tests, the adolescents were in‐
dividually housed in half of their home cage, separated from their con‐
specific by a Plexiglas divider. The ethanol or water bottles were
equipped via a special lid. The Plexiglas divider was removed after
each intake session and the animals had ad-libitum access to water and
food. The bottles were weighed before and after each session and
ethanol intake is reported as grams per kilogram (g/kg) ingested and
percentage of ethanol intake preference (ethanol intake/overall liquid in‐
take) × 100]. Overall fluid intake (ml/100 g of body weight) was also
calculated.
2.7. Statistical analysis
D
The variables measured in the LDB test were analysed by separate
factorial (prenatal treatment x age x sex x rearing condition) Analysis
of Variance (ANOVAs). Similar ANOVAs, yet not considering sex,
analysed the relative expression of the gene of interest, in the offspring
TE
or in the dams, in each brain structure (VTA, AcbN, PFC). The decision
to collapse data across sex, for the sake of the analysis of gene expres‐
sion in the offspring, was due to the relatively low “n” associated with
these neurobiological assays (i.e., only four per sex). Six and five data
points were lost in the offspring's and in the dams' databases, respec‐
tively, due to technical problems. Specifically, transcriptional regula‐
EC
tion of PDYN, KOR and BDNF in VTA could not be calculated in a PEE
female and in a PEE male – both adolescents -- rat. In the dams, KOR
and BDNF in VTA could not be calculated in two PV-NE dams, and
PDYN gene expression data in the AcbN of a PE-NE and a PV-NE dam
was lost. Similarly, data of relative expression of BDNF in AcbN of a
PV-NE dam was lost. These data were not replaced. DNA methylation
RR
patterns at the promotor region of the PDYN gene were analysed using
factorial ANOVAs, with age, prenatal treatment, sex and rearing as
comparative factors between groups.
Ethanol intake (g/kg and % preference), vehicle intake scores and
overall fluid intake (ml/100 of body weight) were separately analysed
via repeated measures mixed ANOVAs that considered prenatal treat‐
ment, age, and rearing condition as between-group factors and day of
CO
assessment (ethanol intake sessions 1–9) as the within-measure. The
significant main effects and significant interactions found were further
explored via Tukey's post hoc or planned comparisons. Effect sizes are
reported through the partial eta squared (η2p) and the α level was set at
≤0.05. The post hoc tests analysed significant effects involving between-
subject factors, whereas planned comparisons analysed significant main
effects, interactions involving between-by-within factors, and a few spe‐
UN
cific comparisons based on a-priori hypotheses. There is no consensus of
the best error term for post hoc comparisons in significant effects in‐
volving within-subject factors. In these situations, the planned compar‐
isons provide a satisfactory compromise between conservativeness and
sensitivity (Winer et al., 1991). Data is informed as mean ± SE.
In rats given PEE or PV we conducted, separately for each rearing
condition, Pearson correlations between the measures registered in the
LDB test and the gene expression scores in VTA, PFC and AMY. Pearson
correlations were also conducted between the measures registered
5
Neuropharmacology xxx (xxxx) xxx-xxx
in the LDB test and methylation patterns at the PDYN promotor region
in VTA, or at the promotor region of KOR in AMY.
3. Results Edit Proof PDF
3.1. Behavioral testing for anxiety responses
F
Latency to enter into the dark section of the LDB apparatus was, in
infants but not in adolescents, significantly lower in PEE
OO
(17.11 ± 2.26 s) than in PV rats (24.95 ± 3.81 s) (significant Prenatal
treatment × Age interaction: F1,106 = 4.62, p = 0.0338; η2p = 0.04;
Fig. 3). No significant main effects or significant interactions were ob‐
served in the other variables (data not shown).
3.2. Gene expression and methylation patterns in the offspring
PR
3.2.1. PDYN/KOR systems
The ANOVA of PDYN mRNA transcript levels in the VTA (descrip‐
tive data in Fig. 4 and Table 3) yielded a significant main effect of
Age (F1,54 = 7,65, p = 0.0077; η2p = 0.12), with adolescents exhibit‐
ing greater relative gene expression than infants. The interactions be‐
tween Prenatal treatment and Age, and between Prenatal treatment and
Rearing conditions also achieved significance, (F1,54  =  7.64,
p = 0.0078, η2p = 0.13 and F1,54 = 5.63, p = 0.0211, η2p = 0.09; re‐
spectively). Given the significant differences in the baseline level of
gene expression between infants and adolescents, we decided to sepa‐
rately analyze relative gene expression scores at each age. The execu‐
tion of separate statistical analyses after finding differences in baseline
level of response (i.e., infant vs. adolescent, adolescent vs. adult or
male vs. female) is a common analytical choice [see (Morales and
Spear, 2014; Pau tassi et al., 2015; Var lin skaya et al., 2018)]
when assessing ethanol-induced responses across ontogeny.
The analysis of mRNA transcript levels in the VTA of infants did not
reveal significant main effects or significant interactions. In adoles‐
cents, in turn, the ANOVA revealed a significant main effect of Prenatal
treatment (F1,26 = 5.37, p = 0.0286; η2p = 0.17), and a significant in‐
teraction between Prenatal treatment and Rearing conditions
(F1,26 = 4.96, p = 0.0347; η2p = 0.16). As shown in Fig. 4 and con‐
firmed by the post-hoc analyses, transcript levels for PDYN were signifi‐
cantly greater in PEE-NE than in PV-NE adolescents. This PEE-induced
upregulation of PDYN gene expression was normalized (i.e., no signifi‐
cant difference was observed between PEE and conditions) among rats
exposed to EE.
Fig. 3. Latency (s) to enter into the dark section of the Light-Dark Box (LDB) apparatus,
in infant or adolescent rats exposed to prenatal ethanol (PEE) or prenatal vehicle (PV) ex‐
posure and subsequently reared under environmental enrichment (EE) or standard rear‐
ing conditions (NE). The statistical analysis indicated that latency to enter into the dark
section was, in infants but not in adolescents, significantly lower in PEE than in PV rats,
an effect that is indicated by the asterisk. Data is shown as mean ± SEM.
A. Wille-Bille et al. Neuropharmacology xxx (xxxx) xxx-xxx

F
OO
Fig. 4. Prenatal ethanol exposure (PEE) and rearing condition affect mRNA levels of prodynorphin (PDYN, Panel A) and affect DNA methylation levels (% of methylated sites) at the pro‐
motor region of PDYN (Panel B). These variables were measured in the ventral tegmental area (VTA) of male and female -- infant and adolescent -- rats. The data were collapsed across

PR
sex. In panel A, the asterisk sign indicates that adolescent PEE rats reared in non-enriched conditions (NE) showed significantly higher levels of mRNA coding for PDYN than PEE rats
reared under environmental enrichment (EE), or than control rats exposed to vehicle in-utero (Prenatal Vehicle, PV, raised or not under EE). The asterisk in panel B indicates that PEE
rats reared in non-enriched conditions (PEE-NE group) showed significantly lower levels of DNA methylation (%) in site 1 than PEE rats reared under environmental enrichment (PEE-EE
group). The ampersand sign indicates that, at site 3, PEE rats exhibited significantly less DNA methylation than PV rats, an effect that was not significantly altered by environmental en‐
richment. Please refer to the text for a full account of the significant effects and significant interactions found. Gene expression data are expressed as relative expression (2-ΔΔCt) of the
gene of interest as a function of the calibrator (i.e., normalized to β-Actin and GADPH), whereas DNA methylation data are expressed as methylation percentage [mc/(mc  +  c)], mc:
methylated cytosine, c: unmethylated cytosine, and described as mean ± SEM.

D
Table 3
Relative gene expression of PDYN, KOR and BDNF, in the VTA, AMY, AcbN or PFC of infant or adolescent rats exposed to prenatal ethanol (PEE) or prenatal vehicle (PV) exposure, and
subsequently reared under environmental enrichment (EE) or standard rearing conditions (NE). of the infant and adolescent groups. The data are presented as mean  ±  SEM. Bold indi‐
cates significant age-related differences in a given variable. The asterisk sign indicates that the PEE-NE group exhibits significant differences, in a given variable, when compared to the
other groups. The # sign indicates that PEE rats exhibit significant differences, in a given variable, when compared to PV rats. The ampersand sign indicates that the PEE-adolescent
TE
group exhibits significant differences, in a given variable, when compared to the other groups. The α level was set at ≤0.05. VTA: Ventral tegmental Area, AcbN: Nucleus Accumbens
Core, PFC: Prefrontal Cortex, AMY: Amygdala. PDYN: prodynorphin, KOR: Kappa Opioid Receptor, BDNF: Brain-derived Neurotrophic factor.

PV group PEE group

Infant rats NE EE NE EE

VTA PDYN 1.04 ± 0.11 1.25 ± 0.09 0.96 ± 0.15* 0.95 ± 0.17

EC

KOR 1.04 ± 0.11 1.08 ± 0.16 0.94 ± 0.20 0.82 ± 0.22

BDNF 1.06 ± 0.14 1.18 ± 0.11 0.83 ± 0.14 0.69 ± 0.10
AcbN PDYN 1.07 ± 0.15 1.39 ± 0.31 1.30 ± 0.24 0.75 ± 0.25
KOR 1.26 ± 0.32 0.95 ± 0.16 0.91 ± 0.17 # 0.47 ± 0.08 #
BDNF 1.01 ± 0.06 0.89 ± 0.08 1.54 ± 0.32 # 1.17 ± 0.14 #
PFC PDYN 1.15 ± 0.21 1.40 ± 0.54 0.90 ± 0.17 1.10 ± 0.14
KOR 1.04 ± 0.11 1.15 ± 0.15 1.11 ± 0.26 1.25 ± 0.19
RR

BDNF 1.01 ± 0.05 1.01 ± 0.09 1.13 ± 0.08 1.12 ± 0.12

AMY PDYN 1.02 ± 0.08 0.82 ± 0.09 0.79 ± 0.16 0.84 ± 0.15
KOR 1.05 ± 0.13 1.16 ± 0.15 1.32 ± 0.13* 0.94 ± 0.08
BDNF 1.03 ± 0.10 1.00 ± 0.11 0.93 ± 0.15 0.85 ± 0.14
Adolescent rats
VTA PDYN 1.07 ± 0.14 1.22 ± 0.16 2.11 ± 0.35* & 1.25 ± 0.16 &
KOR 1.01 ± 0.05 0.94 ± 0.06 0.95 ± 0.14 1.02 ± 0.23
CO

BDNF 1.04 ± 0.11 1.15 ± 0.08 1.05 ± 0.12 # 1.16 ± 0.07 #

AcbN PDYN 1.11 ± 0.20 0.94 ± 0.27 1.10 ± 0.17 1.04 ± 0.23
KOR 1.14 ± 0.27 1.11 ± 0.31 0.65 ± 0.07 # 0.69 ± 0.08 #
BDNF 1.01 ± 0.07 1.10 ± 0.12 1.49 ± 0.08 # 1.08 ± 0.12 #
PFC PDYN 1.02 ± 0.08 1.21 ± 0.20 1.18 ± 0.14 1.02 ± 0.12
KOR 1.12 ± 0.22 0.87 ± 0.18 0.87 ± 0.21 0.92 ± 0.27
BDNF 1.04 ± 0.12 0.95 ± 0.11 0.75 ± 0.05 & 0.78 ± 0.18 &
AMY PDYN 1.02 ± 0.07 1.02 ± 0.20 1.27 ± 0.19 1.11 ± 0.13
UN

KOR 1.03 ± 0.10 0.78 ± 0.05 0.93 ± 0.07 0.98 ± 0.08

BDNF 1.03 ± 0.09 1.07 ± 0.13 0.13 ± 0.09 1.30 ± 0.06

PEE significantly diminished mRNA KOR levels in AcbN
(means  ±  SEM in Table 3; significant main effect of Prenatal treat‐
ment: F1,56 = 8.95, p = 0.0041; η2p = 0.16). Levels of mRNA coding
for KOR in VTA or PFC, and PDYN transcript levels in
PFC (means ± SEM in Table 3), were similar across prenatal and rear‐
ing conditions.
At AMY, PDYN mRNA transcript levels were greater in adolescents
than in infants (F1,56 = 5.61, p = 0.0213; η2p = 0.09), yet not altered
by the other factors. The ANOVA for KOR transcript levels revealed

6
A. Wille-Bille et al. Neuropharmacology xxx (xxxx) xxx-xxx

Table 4 fants. On adolescents the ANOVA for methylation scores at site 1

Relative gene expression of PDYN, KOR and BDNF of the dams given prenatal ethanol
(PEE) or prenatal vehicle (PV) exposure and reared under environmental enrichment (EE)
or non-enriched (NE) conditions, at VTA, AcbN and PFC. The data are presented as
mean  ±  SEM. VTA: Ventral tegmental Area, AcbN: Nucleus Accumbens Core, PFC: Pre
frontal Cortex, AMY: Amygdala. PDYN: prodynorphin, KOR: Kappa Opioid Receptor,
BDNF: Brain-derived Neurotrophic factor.
yielded a significant interaction between Prenatal treatment and Rear‐
ing conditions (F1,26 = 4.55, p = 0.0425; η2p =  0.15). As shown in
Fig. 4, PDYN methylation scores at site 1 were significantly lower in
PEE-NE than in PV-NE adolescents. No significant difference was ob‐
served between PEE and PV exposed to EE. At CpG sites 2 and 3 methy‐

F
PV group PEE group lation was not affected by rearing or prenatal conditions, not was the
interaction between these factors significant.
    NE EE NE EE
The EE-induced normalization of the PEE-mediated alteration of

OO
VTA PDYN 1.06 ± 0.18 1.33 ± 0.26 1.32 ± 0.27 1.41 ± 0.44 KOR transcriptional regulation in AMY led us to analyze methylation
KOR 1.02 ± 0.10 2.59 ± 0.45 1.07 ± 0.37 0.81 ± 0.11 patterns at the promotor region of KOR, in infants. The ANOVA for
BDNF 1.06 ± 0.19 1.16 ± 0.14 1.58 ± 0.21 1.44 ± 0.52 methylation scores did not reveal significant main effects or significant
AcbN PDYN 1.01 ± 0.08 0.53 ± 0.13 0.31 ± 0.06 0.58 ± 0.09 interactions (data not shown).
KOR 1.12 ± 0.25 0.25 ± 0.05 0.33 ± 0.12 0.31 ± 0.09
BDNF 1.05 ± 0.17 4.00 ± 1.38 2.15 ± 0.23 2.74 ± 0.77 3.2.2. BDNF system (descriptive data at Table 3)
PFC PDYN 1.02 ± 0.10 1.60 ± 0.27 1.65 ± 0.68 1.34 ± 0.50 Transcriptional regulation of BDNF in VTA was, in infant but not in

PR
KOR 1.18 ± 0.37 0.99 ± 0.47 2.28 ± 1.04 1.63 ± 1.05
adolescent rats, significantly reduced by PEE (significant Prenatal treat‐
BDNF 1.15 ± 0.27 2.77 ± 0.44 6.07 ± 1.85 3.45 ± 0.80
ment × Age interaction: F1,54 = 5.70, p = 0.0205; η2p = 0.10), an ef‐
fect that was not affected by EE rearing. The ANOVA for the scores
found in AcbN revealed significantly greater levels of the transcript in
a significant Prenatal treatment x Rearing condition × Age interaction PEE vs. PV rats (F1,56 = 8.88, p = 0.004; η2p = 0.14). A planned com‐
(F1,56 = 7.36, p = 0.0088; η2p = 0.12, see Fig. 5). The post hoc tests parison revealed that this PEE-induced exacerbation was not observed
did not reveal significant differences among the adolescent groups, after EE (i.e., no significant differences were observed between PEE-EE
whereas in infants there was significantly greater transcriptional regu‐ and PV-EE rats). In PFC, BDNF levels were significantly reduced in PEE

D
lation of KOR in the PEE-NE vs. PV-NE. This difference was normalized adolescents vs PV adolescents (significant Prenatal treatment × Age in‐
(i.e., no difference was observed between PEE and PV groups) when teraction: F1,56  =  5.24, p  =  0.0259; η2p  =  0.09), whereas in AMY
rearing involved enriched conditions. mRNA for BDNF was lower in infants than in adolescents (F1,56 = 4.90,
p = 0.0310; η2p = 0.08).
TE
The significant Prenatal treatment × Rearing interaction on PDYN
gene expression in VTA led us to scrutinize, in this structure, methyla‐
tion patterns at the promotor region of this gene, in infant and adoles‐ 3.3. Gene expression in the dams (descriptive data at Table 4)
cents. These scores are depicted in Fig. 4. The ANOVA yielded a signif‐
icant main effect of Age at CpG site 1 and 3 (F1,46 = 6.42, p = 0.0148; Transcriptional regulation of PDYN in AcbN was, among dams
2 2
η p = 0.12 and F1,46 = 4.51, p = 0.0391; η p = 0.09, respectively). reared under standard conditions, significantly lower in PEE vs PV
The effect of Age for the average methylation score at the three CpG groups. This effect was normalized among dams given EE (i.e., mRNA
EC

sites was also significant (F1,46 = 5.61, p = 0.0221; η2p = 0.11). Thus, levels were, after EE, similar regardless prenatal treatment) (significant
the patterns were separately analysed by age. No significant main ef‐ Prenatal treatment x Rearing condition interaction; F1,14  =  13.82,
fects nor significant interactions were found in in p = 0.0023; η2p = 0.50). VTA and PFC mRNA levels of PDYN were
not affected by prenatal treatment or environmental enrichment.
mRNA levels of KOR were not affected in PFC, yet in VTA EE en‐
hanced levels of the transcript in PV rats only (significant Prenatal
RR

treatment x Rearing condition interaction; F1,16 = 9.30, p  =  0.0076;

2
η p = 0.37). In AcbN the group PEE-NE exhibited significantly lower

mRNA coding for KOR than its counterpart PV-NE. No difference be‐
tween PV and PEE groups was found when the dams were exposed to
EE (significant Prenatal treatment x Rearing condition interaction;
F1,16 = 8.90, p = 0.0088; η2p = 0.36).
mRNA levels of BDNF were not affected in AcbN. In PFC the corre‐
CO

sponding ANOVA yielded a significant main effect of Prenatal treat‐

ment (F1,15 = 6.45, p = 0.0226; η2p = 0.30) and the Prenatal treat‐
ment x Rearing condition neared significance (F1,15  =  3.70,
p = 0.0737; η2p = 0.20). Guided by our a priori hypothesis we con‐
ducted planned comparisons between PEE and PV dams, one for each
rearing condition. These analyses indicated greater mRNA coding for
BDNF in PEE-NE vs PV-NE dams (p  ≤ 0.05), yet no differences among
UN

PV and PEE groups exposed to EE. No effect was observed in VTA.

3.4. Ethanol intake patterns at the two-bottle choice tests

Fig. 5. Prenatal ethanol exposure (PEE) and rearing condition affect mRNA levels of
kappa opioid receptor (KOR) in amygdala (AMY). This variable was measured in male Total fluid intake (ml/100  g of body weight) was significantly
and female infant and adolescent rats. The data were collapsed across sex. The asterisk
sign indicates that infant PEE rats reared in non-enriched conditions (NE) showed signifi‐
greater in females than in males (F1,58  =  8.59, p  =  0.0048;
2
cantly higher levels of mRNA coding for KOR than control rats given vehicle in-utero η p = 0.13), an effect that did not significantly interact with the re‐

(Prenatal Vehicle, PV) reared in non-enriched conditions (NE) and than PEE rats reared maining factors (descriptive data not shown). The ANOVA for g/kg
under environmental enrichment (EE). The data are expressed as relative expression (2- ethanol intake revealed significant interactions between Sex, Days of
ΔΔCt) of the gene of interest as a function of the calibrator (i.e., normalized to β-Actin

and GADPH), and described as mean ± SEM. assessment, and either Prenatal treatment (F8,464 = 3.22, p = 0.0014;

7
A. Wille-Bille et al.
2
η p  =  0.05) or Rearing Conditions (F8,464  =  2.13, p  =  0.0320;
2
η p = 0.04). Based on these effects we analysed ethanol intake sepa‐
rately in males and females.
Fig. 6 (upper panel) depicts absolute ethanol intake (g/kg) across
ethanol intake sessions as a function of prenatal treatment and rearing
conditions, in male rats. The corresponding ANOVA revealed a signifi‐
cant main effect of Rearing condition (F1,30  =  7.62, p  ≤  0.0097;
2
η p  =  0.20), with EE male rats drinking significantly less (approxi‐
mately half) ethanol than NE peers. The Day of assessment x Prenatal
Treatment interaction was also significant (F8,240 = 2.47, p = 0.0136;
2
η p  =  0.08), with the planned comparisons indicating that ethanol
drinking in PV rats was stable (i.e., there was no significant changes
across days nor when comparing the first and the last intake session),
whereas PEE rats exhibited a gradual increase in ethanol intake across
days and greater ethanol intake in the last vs. the first ethanol intake
session (ps  ≤ 0.05). Visual inspection of Fig. 6 suggests that Rearing
condition modulated ethanol intake in PV rats but did not affect intake
scores in PEE counterparts. Guided by these impressions and by our a-
priori hypotheses we conducted planned comparisons between EE and
NE, separately for PEE and PV groups. These comparisons indicated
that, across days of testing, ethanol drinking (g/k) was significantly
lower in PV-EE vs PV-NE rats (F1,30 = 7.52, p = 0.0101), yet similar in
PEE-EE vs PEE-NE rats (F1,30 = 1.06, p = 0.31. These results indicate
that PEE had a permissive effect upon absolute ethanol drinking in the
D
males, whereas EE exerts a protective effect upon alcohol intake.
Percent ethanol preference in males yielded a profile very similar to
that of g/kg of ethanol ingested (Fig. 7). The ANOVA yielded a signifi‐
cant main effect of Rearing (F1,30 = 10.08, p = 0.0034; η2p = 0.25)
TE
and a significant interaction between Prenatal treatment and Day of as‐
sessment (F8,240 = 3.04, p = 0.0027; η2p = 0.09). EE rats exhibited
significantly lower percent ethanol intake than NE rats, and the levels
of preference kept fairly stable in PV males, around 30% across
EC
RR
CO
UN
Fig. 6. Ethanol intake (g/kg) in male (panel A) and female (panel B) adolescent rats exposed to prenatal ethanol (PEE) or prenatal vehicle (PV) exposure and then reared under environ‐
mental enrichment (EE) or standard conditions (NE). The ANOVA revealed a significant main effect of EE, with male adolescent rats reared under EE consuming significantly less ethanol
than those reared in standard conditions (NE). This effect is indicated by the asterisk sign. Planned comparisons indicated that, across sessions, the effect of EE on ethanol intake was
found in PV but not in PE rats. The ampersand sign indicates this significant effect. Data is presented as mean ± SEM.
8
Neuropharmacology xxx (xxxx) xxx-xxx
the course of the ethanol intake sessions. On contrast, the planned com‐
parisons conducted on PEE male rats indicated that level of preference
of ethanol intake session 6 was significantly greater than on session 1
(F1,30 = 6.84, p = 0.0138), and ethanol preference on the last session
was nearly significantly greater than on session 6 (F1,30  =  4.14,
p = 0.0506). The planned comparisons indicated that, across days of
F
testing, percent ethanol predilection was significantly lower in PV-EE
when compared to PV-NE counterparts (F1,30 = 9.23, p = 0.0048), yet
similar in PEE-EE vs PEE-NE rats (F1,30 = 1.75, p = 0.1953).
OO
The ANOVA for ethanol intake (g/kg) in female rats revealed that in
the first but not in the subsequent sessions, absolute ethanol intake (see
Fig. 6) was greater in PEE than in PV females (significant Prenatal
treatment × Day interaction; F8,224 = 2.16, p = 0.0309; η2p = 0.07).
Percent ethanol preference in female rats was greater in session 4–9
than in sessions 1–3 (F8,224 = 6.31, p = 0.0000; η2p = 0.18).
Overall, these result suggest that EE induced a protective effect on
PR
ethanol intake and preference, an effect more noticeable in males than
in females, and in PV than in PEE rats. It is important to remark that
the male offspring drank significantly less ethanol than the female off‐
spring. The latter result suggests that the protective effect of EE on
ethanol drinking may only emerge at lower levels of voluntary drink‐
ing.
3.5. Vehicle intake scores
A separate group of PEE and PV adolescents were exposed to two
water bottles. Water intake was significantly greater in females than in
males (F1,51 = 10.78, p = 0.0018, η2p = 0.17). Separate ANOVAs for
males and females revealed (data not shown) that intake decreased
gradually across testing days (F8,216 = 8.50, p = 0.0000, η2p = 0.24
and F8,192 = 10.88, p  =  0.0001; η2p  =  0.31; males and females re‐
spectively).
A. Wille-Bille et al.
D
Fig. 7. Ethanol Preference (%) in male (panel A) and female (panel B) adolescent rats exposed to prenatal ethanol (PEE) or prenatal vehicle (PV) exposure and subsequent reared under
TE
environmental enrichment (EE) or standard rearing conditions (NE). The ANOVA reveled a significant main effect of EE, with male adolescent rats reared under EE showing significantly
less ethanol preference than those reared in standard conditions (NE). This effect is indicated by the asterisk sign. Moreover, planned comparisons indicated that, across sessions, the pro‐
tective effect of EE on percent ethanol intake was found in PV but not in PE rats. The ampersand sign indicates this significant effect. Data is presented as mean ± SEM.
3.6. Associations between behavioral responsivity at LDB test and gene
expression or methylation scores (see Table 5)
EC
Most of the significant associations between behavior at LDB and
gene expression scores were exhibited by PEE rats. In these subjects, a
shorter latency to first exit the white compartment – a behavior indica‐
tive of greater anxiety -- was significantly associated with greater PDYN
mRNA levels at VTA (rs = −0.54/-0.60), and reduced time spent in the
white compartment was significantly associated with lower mRNA cod‐
ing for BDNF at AMY (rs =  −0.50/-0.58). These effects were similarly
RR
expressed by rats exposed or not to EE. In the PEE-EE rats, in turn,
shorter latency to exit the white compartment was associated with
greater transcriptional regulation of BDNF at VTA (rs  =  −0.74) and
AMY (rs = −0.54), and with greater transcriptional regulation of PDYN
at AMY (rs =  −0.58). PEE-NE rats, on the other hand, exhibited a sig‐
nificant and positive association between latency to exit or time spent
CO
in the white compartment and transcriptional regulation of BDNF at
PFC (rs = 0.76), and a significant and positive association between the
latter measure and number of transfers between compartments
(rs = 0.60). Number of transfers and PDYN mRNA levels at VTA were
significantly associated (r = −0.60) in PV-NE rats. Number of transfers
was significantly associated with the average percent of methylation at
the PDYN promotor region in VTA (group PEE-EE) and with the aver‐
age percent of methylation at the promotor region of KOR in AMY
UN
(group PV-NE).
4. Discussion
PEE significantly altered the transcriptional regulation of several
opioid genes, in brain mesocorticolimbic areas of infant or adolescent
offspring, and yielded an anxiety-like phenotype in the LDB test. Some
of these effects were mitigated by exposure to an enriched environ‐
ment. For instance, PEE upregulated transcript levels for PDYN
9
Neuropharmacology xxx (xxxx) xxx-xxx
F
OO
PR
and KOR, in VTA and AMY respectively, and EE inhibited these effects.
PEE also diminished mRNA KOR levels in AcbN and increased anxiety
in the LDB, yet these effects were insensitive to EE rearing. Moreover,
greater upregulation of PDYN mRNA levels at VTA or AMY, or greater
alterations in the transcriptional regulation of BDNF at AMY or VTA
was associated, in PEE rats only, with greater anxiety in the LDB test.
These results indicate that early programming of gene expression,
induced by maternal ethanol exposure, can be mitigated by environ‐
mental enrichment. Very few studies have assessed these interactions
between perinatal programming of gene expression and environmental
enrichment exposure (but see Crofton et al., 2015, for a discussion
on how EE could inoculate against subsequent stressors or drugs of
abuse). Intriguing studies revealed that malnourished rats exhibited al‐
terations in anxiety, in gene expression of the glucocorticoid receptor
(Soares et al., 2015) and in spatial learning (Soares et al., 2017). These
effects were inhibited by chronic (PDs 8–35), yet mild (1 h per day) ex‐
posure to EE. Similarly, EE modulated the detrimental effects of gesta‐
tional inflammation on the gene expression of BDNF and its receptor
TrkB (Kent ner et al., 2016).
Of relevance, the study suggests a role for DNA methylation in the
effects evoked by EE on the PEE-induced alterations of PDYN gene ex‐
pression in VTA, namely at the level of CpG1. Epigenetic markers are
stably inherited from one cell generation to the next, making DNA
methylation a potential mechanism by which environmental insults,
such as the prenatal ethanol exposure employed in this study, pass
down from one generation to the other (Klose and Bird, 2006; Pid s ‐
ley and Mill, 2011).
The present study has the novelty of exposing the complete litter to
enriched rearing from the ending of gestation up to a week after the
weaning of the offspring. To our knowledge, the previous studies that
assessed the effects of EE on PEE-mediated effects applied EE always af‐
ter weaning (Wang et al., 2018) (Tipyasang et al., 2014). The pre‐
sent work also has the novelty of employing a relatively low level
A. Wille-Bille et al. Neuropharmacology xxx (xxxx) xxx-xxx

Table 5 less exposure to EE or standard housing. In sharp contrast, level of

Associations between behavioral responsivity at Light-dark box test and gene expression
scores. PV: Prenatal Vehicle, PEE: Prenatal Ethanol exposure, EE: Environmental enrich‐
ment, NE: Non-enriched, VTA: Ventral tegmental Area, AcbN: Nucleus Accumbens Core,
PFC: Prefrontal Cortex, AMY: Amygdala. PDYN: prodynorphin, KOR: Kappa Opioid Re‐
ceptor, BDNF: Brain-derived Neurotrophic factor. Bold numbers indicate a significant as‐
sociation.
ethanol intake in males spared from the prenatal insult was low and
stable, particularly after exposure to EE. These effects were specific to
ethanol intake, as 24 h water intake was not affected by EE or PEE, nor
by EE. These results meet the hypothesis that PEE makes the offspring
less likely to take advantage of environmental treatments such as EE.

F
PV group PEE group This hypothesis, however, should be taken with caution. The male off‐
spring also drank less than the females. Thus, it is possible that the pu‐
Latency (s) to exit NE EE NE EE
tative protective effect of EE only emerges at lower levels of voluntary

OO
VTA PDYN .16 .04 -.54 -.58 drinking, and is not applicable to high levels of drinking.
KOR .27 .22 .11 -.20 It is worth noting that EE is thought to ameliorate the effects of
BDNF .08 .30 -.01 -.74 ethanol and other drugs, yet there are conflicting results (Fer nan dez-
AcbN PDYN -.19 .18 .08 -.11 Teruel et al., 2002). This is, rats or mice exposed to EE often exhibit
KOR .22 -.09 .22 -.34 reduced ethanol- or cocaine-induced CPP or self-administration (de
BDNF -.03 -.28 -.04 .23 Car valho et al., 2010; Galaj et al., 2017; Ro driguez-Or tega et
PFC PDYN .34 .05 -.27 .01 al., 2018), as well as a blunted ethanol-induced behavioral sensitiza‐

PR
KOR -.09 .09 .13 -.08
tion (Rueda et al., 2012). In contrast, other studies have reported in‐
BDNF -.12 -.03 .76 .12
creased ethanol intake (Fer nan dez-Teruel et al., 2002; Rock man et
AMY PDYN .08 -.28 -.22 -.58
al., 1986, 1989; Rock man and Gib son, 1992) (Be rardo et al.,
KOR .30 .28 .55 -.04
BDNF .23 -.20 − 0.06 -.54
2016) after exposure to environmental enrichment. The latter results
Time (s) in white area seem to clash with the present study. However, in many of those stud‐
VTA PDYN -.09 -.01 -.41 -.16 ies EE was applied for a few weeks. Instead, in the present study the lit‐
KOR .18 .17 .02 -.44 ters were born in EE and kept in that condition after weaning. This sug‐
BDNF .00 .38 -.07 -.38 gests that longer or complex enriched paradigms are needed to induce

D
AcbN PDYN -.16 .22 .24 -.22 positive cognitive or neurobiological effects. It has been reported that
KOR .06 -.02 .22 -.27 short term exposure to EE (6 h daily for 10 days) did not improve Mor‐
BDNF -.12 -.22 .31 .18 ris water maze performance in rats lesioned in the subiculum (Bindu
PFC PDYN .21 .23 -.42 .03 et al., 2005), yet an improvement was found after 1 month of EE
TE
KOR .08 -.01 .01 .30 (Kap gal et al., 2016).
BDNF .02 -.11 .55 .31
Gene transcriptional regulation in the dams had some similarities
AMY PDYN .04 .40 -.21 -.12
(and differences) with that found in offspring. PEE upregulated PDYN
KOR .21 .17 .46 -.20
and KOR gene expression in the offspring, in VTA and AMY, respec‐
BDNF 0.09 -.06 -.50 -.58
Number of Transfers
tively, yet downregulated PDYN and KOR gene expression in the dam's
AcbN. Despite the regional differences of these effects (and the differ‐
EC

VTA PDYN -.60 .00 -.14 -.07

KOR -.11 -.15 -.22 -.41 ences in their direction, i.e., upregulation vs. downregulation), all of
BDNF -.38 .07 -.11 .16 them were normalized by EE. PEE also altered transcriptional regula‐
AcbN PDYN .01 -.34 -.26 .33 tion of BDNF in the offspring's VTA and AcbN. EE inhibited this effect
KOR -.31 .20 -.03 .23 of PEE in AcbN but not in VTA. PEE downregulated BDNF mRNA levels
BDNF .29 .04 .60 .37 at the offspring's PFC yet upregulated the transcript in the dams. The
PFC PDYN .29 .22 -.26 .15 latter, but not the former, PEE-induced alteration in BDNF transcrip‐
RR

KOR .19 -.25 -.07 .19 tional regulation was altered by EE.
BDNF .21 -.04 0.31 -.12 The mechanisms underlying the effects of EE are still under investi‐
AMY PDYN .08 -.19 .23 .06
gation, yet have been associated with modulation of BNDF (Vazquez-
KOR .35 -.42 -.03 -.31
San ro man et al., 2013). In the present study EE inhibited a four-fold
BDNF 0.20 .09 -.15 -.35
PEE-induced upregulation of BDNF gene expression in PFC. Also, EE
heightened mRNA coding for BDNF in AcbN, albeit to a similar extent
in dams with or without prenatal programming. The present results re‐
CO

of maternal intoxication that – unlike preparations that expose dams to
large quantities of ethanol (Con tr eras et al., 2017) -- captures the
episodic and sporadic binge-like ethanol intake often reported by preg‐
nant women (Lopez et al., 2015).
The transcript levels of BDNF were significantly altered in the PEE
offspring. We observed a PEE-induced reduction in transcriptional reg‐
ulation of BDNF in the VTA of infants and in the PFC of adolescents,
UN
semble those reported, in adolescent mice, by Rueda et al. (2012). In
that study an EE protocol that proved beneficial at the behavioral level
(i.e., blocked ethanol-induced behavioral sensitization) also decreased
BDNF levels in the prefrontal cortex. Also relevant, in a more recent
study we observed that chronic ethanol treatment reduced mRNA
BDNF levels in the PFC of adolescent mice, compared to adults. EE re‐
stored this effect of chronic ethanol exposure (Pau tassi et al., 2017).

and a significant increase in AcbN. The PEE-induced exacerbation at
AcbN was not observed after EE. BDNF is an upstream activator of
PDYN expression and ethanol can modulate this signaling pathway
(Lo grip et al., 2008). These findings are consistent with prior litera‐
ture. Tipyasang et al. (2014) found that 60 days of EE restored a
PEE-induced BDNF alteration in the hippocampus.
EE also seemed to exert a protective effect upon ethanol intake pat‐
terns, a pattern that was only seen in males. Perhaps more important,
the male rats exposed to prenatal ethanol exhibited a gradual increase
in ethanol intake and preference, a pattern that was similar regard
A caveat of the present study is the lack of measurement of mater‐
nal behaviors. Differential levels of maternal care (e.g., licking of the
pups, time spent on the nest, time adopting a kyphotic posture to pro‐
mote breastfeeding) might account for the results found in the off‐
spring. Another limitation is that the gestational period chosen for
ethanol exposure is roughly equivalent to the human second trimester
(Par nell et al., 2014), a period in which initiation of drinking during
pregnancy is unlikely. Alcohol drinking, however, may continue into
the second trimester, particularly for those who do not know they

10
A. Wille-Bille et al.
are pregnant or suffer from an alcohol use disorder (O' Ke effe et al.,
2015).
Another important limitation is that gene expression, but not behav‐
ioral, data was collapsed across sex. This decision, which was due to
the relatively low “n” associated with the gene expression assays, hin‐
ders the understanding of the relationships between gene expression
and behavior. For instance, some behavioral effects are sex-specific yet
the significant, PEE- or EE-induced, alterations in gene expression are
presented after data was collapsed across sex. An additional limitation
is that food intake was not measured, neither in the dams nor in the
offspring. Ethanol intubations may have altered feeding patterns, which
in turn can lead to confounds in the data. Also, the EE protocol in‐
cluded a running wheel within the general enriched environment, yet
we did not measure the activity in the running device. Voluntary run‐
ning has been shown to reverse PEE-induced alterations in glutathione
in male and female rats (Bro cardo et al., 2012), and mitigated the ef‐
fects of PEE in spatial memory and hippocampal cell proliferation
(Christie et al., 2005; Redila et al., 2006).
Despite these limitations, the present study confirms that PEE is as‐
sociated with changes in gene expression and in DNA methylation and
suggests that these alterations may yield a phenotype with greater
propensity for ethanol intake. The results also indicate that long-term
exposure to EE holds promise as a remedial treatment for these detri‐
mental effects of PEE. The latter statement is in agreement with previ‐
D
ous suggestions that EE protects against acquired vulnerabilities (Lavi ‐
ola et al., 2008) or prevents the development of drug addiction (Soli ‐
nas et al., 2010).
TE
Authorship
Wille-Bille, D'Addario and Pautassi designed the study. Wille-Bille,
Miranda-Morales, Jiménez-García, Bellia and Pautassi run the intake
and behavioral tests. Bellia, D'Addario and Wille-Bille run the gene ex‐
pression and methylation assays. Pautassi, Wille-Bille, Bellia and D'Ad‐
EC
dario run the statistical analysis. Pautassi and Wille-Bille wrote the first
draft of the manuscript. All authors contributed to and approved the fi‐
nal manuscript.
Author contributions
RR
Conceptualization: Wille-Bille, D'Addario and Pautassi. Methodol‐
ogy: Wille-Bille, D'Addario and Pautassi. Validation: Wille-Bille, Mi‐
randa-Morales, Jiménez-García, Bellia. Formal analysis: Pautassi, Wille-
Bille, Bellia and D'Addario. Investigation: Pautassi, Wille-Bille,
Jiménez-García, Bellia and D'Addario. Funding acquisition: D'Addario
and Pautassi. Data Curation: Wille-Bille and Bellia. Writing - Original
Draft: Pautassi and Wille-Bille. Writing - Review & Editing: All authors.
CO
Visualization: Pautassi and Wille-Bille. Supervision: D'Addario and Pau‐
tassi.
Declaration of competing interest
We declare having no competing interest nor conflict of interest re‐
lated to our MS or its results.
UN
Acknowledgements
This work was supported by PICT 2015–0325 of Agencia Nacional de
Promoción Científica y Tecnológica (FONCyT),
to RMP. The funders had no fur‐
ther role in study design; in the collection, analysis and interpretation
of data; in the writing of the report; and in the decision to submit the
paper for publication.
References
Abate, P., Hernandez-Fonseca, K., Reyes-Guzman, A.C., Barbosa-Luna, I.G., Mendez, M.,
2014. Prenatal ethanol exposure alters met-enkephalin expression in brain re
11
Neuropharmacology xxx (xxxx) xxx-xxx
gions related with reinforcement: possible mechanism for ethanol consumption in off‐
spring. Behav. Brain Res. 274, 194–204.
Akison, L.K., Kuo, J., Reid, N., Boyd, R.N., Moritz, K.M., 2018. Effect of choline supple‐
mentation on neurological, cognitive, and behavioral outcomes in offspring arising
from alcohol exposure during development: a quantitative systematic review of clini‐
cal and preclinical studies. Alcohol Clin. Exp. Res. 42, 1591–1611.
Alati, R., Mamun, A.A., Williams, G.M., O’Callaghan, M., Najman, J.M., Bor, W., 2006. In
utero alcohol exposure and prediction of alcohol disorders in early adulthood: a birth
F
cohort study. Arch. Gen. Psychiatr. 63, 1009–1016.
Bakhireva, L.N., Kane, M.A., Bearer, C.F., Bautista, A., Jones, J.W., Garrison, L., Begay,
M.G., Ozechowski, T., Lewis, J., 2019. Prenatal alcohol exposure prevalence as mea‐
sured by direct ethanol metabolites in meconium in a Native American tribe of the
OO
southwest. Birth Defects Res. 111, 53–61.
Bakhireva, L.N., Sharkis, J., Shrestha, S., Miranda-Sohrabji, T.J., Williams, S., Miranda,
R.C., 2017. Prevalence of prenatal alcohol exposure in the state of Texas as assessed
by phosphatidylethanol in newborn dried blood spot specimens. Alcohol Clin. Exp.
Res. 41, 1004–1011.
Balaszczuk, V., Salguero, J.A., Villarreal, R.N., Scaramuzza, R.G., Mendez, S., Abate, P.,
2019. Hyperlocomotion and anxiety- like behavior induced by binge ethanol expo‐
sure in rat neonates. Possible ameliorative effects of Omega 3. Behav. Brain Res. 372,
112022.
Berardo, L.R., Fabio, M.C., Pautassi, R.M., 2016. Post-weaning environmental enrich‐
ment, but not chronic maternal isolation, enhanced ethanol intake during periadoles‐
PR
cence and early adulthood. Front. Behav. Neurosci. 10, 195.
Bindu, B., Rekha, J., Kutty, B.M., 2005. Post insult enriched housing improves the 8-arm
radial maze performance but not the Morris water maze task in ventral subicular le‐
sioned rats. Brain Res. 1063, 121–131.
Bordner, K., Deak, T., 2015. Endogenous opioids as substrates for ethanol intake in the
neonatal rat: the impact of prenatal ethanol exposure on the opioid family in the
early postnatal period. Physiol. Behav. 148, 100–110.
Brocardo, P.S., Boehme, F., Patten, A., Cox, A., Gil-Mohapel, J., Christie, B.R., 2012. Anx‐
iety- and depression-like behaviors are accompanied by an increase in oxidative
stress in a rat model of fetal alcohol spectrum disorders: protective effects of volun‐
tary physical exercise. Neuropharmacology 62, 1607–1618.
Burke, A.R., Miczek, K.A., 2014. Stress in adolescence and drugs of abuse in rodent mod‐
els: role of dopamine, CRF, and HPA axis. Psychopharmacology 231, 1557–1580.
Contreras, M.L., de la Fuente-Ortega, E., Vargas-Roberts, S., Munoz, D.C., Goic, C.A.,
Haeger, P.A., 2017. NADPH oxidase isoform 2 (NOX2) is involved in drug addiction
vulnerability in progeny developmentally exposed to ethanol. Front. Neurosci. 11,
338.
Cuzon, V.C., Yeh, P.W., Yanagawa, Y., Obata, K., Yeh, H.H., 2008. Ethanol consumption
during early pregnancy alters the disposition of tangentially migrating GABAergic in‐
terneurons in the fetal cortex. J. Neurosci. : Off. J. Soc. Neurosci. 28, 1854–1864.
Chotro, M.G., Arias, C., 2003. Prenatal exposure to ethanol increases ethanol consump‐
tion: a conditioned response? Alcohol 30, 19–28.
Chotro, M.G., Arias, C., Laviola, G., 2007. Increased ethanol intake after prenatal ethanol
exposure: studies with animals. Neurosci. Biobehav. Rev. 31, 181–191.
Crofton, E.J., Zhang, Y., Green, T.A., 2015. Inoculation stress hypothesis of environmen‐
tal enrichment. Neurosci. Biobehav. Rev. 49, 19–31.
Christie, B.R., Swann, S.E., Fox, C.J., Froc, D., Lieblich, S.E., Redila, V., Webber, A., 2005.
Voluntary exercise rescues deficits in spatial memory and long-term potentiation in
prenatal ethanol-exposed male rats. Eur. J. Neurosci. 21, 1719–1726.
D’Addario, C., Caputi, F.F., Rimondini, R., Gandolfi, O., Del Borrello, E., Candeletti, S.,
Romualdi, P., 2013. Different alcohol exposures induce selective alterations on the
expression of dynorphin and nociceptin systems related genes in rat brain. Addict.
Biol. 18, 425–433.
D’Addario, C., Shchetynsky, K., Pucci, M., Cifani, C., Gunnar, A., Vukojevic, V.,
Padyukov, L., Terenius, L., 2017. Genetic variation and epigenetic modification of
the prodynorphin gene in peripheral blood cells in alcoholism. Prog. Neuro-Psy‐
chopharmacol. Biol. Psychiatry 76, 195–203.
Day, N.L., Helsel, A., Sonon, K., Goldschmidt, L., 2013. The association between prenatal
alcohol exposure and behavior at 22 years of age. Alcohol Clin. Exp. Res. 37, 1171–
1178.
de Carvalho, C.R., Pandolfo, P., Pamplona, F.A., Takahashi, R.N., 2010. Environmental
enrichment reduces the impact of novelty and motivational properties of ethanol in
spontaneously hypertensive rats. Behav. Brain Res. 208, 231–236.
Delatour, L.C., Yeh, P.W.L., Yeh, H.H., 2019. Prenatal exposure to ethanol alters synaptic
activity in layer V/VI pyramidal neurons of the somatosensory cortex. Cerebr. Cor‐
tex.
Dominguez, H.D., Lopez, M.F., Chotro, M.G., Molina, J.C., 1996. Perinatal responsiveness
to alcohol’s chemosensory cues as a function of prenatal alcohol administration dur‐
ing gestational days 17-20 in the rat. Neurobiol. Learn. Mem. 65, 103–112.
Donovan, J., 2013. The burden of alcohol use: focus on children and preadolescents. Al‐
cohol Res. Curr. Rev. 35, 186–192.
Doremus-Fitzwater, T.L., Spear, L.P., 2016. Reward-centricity and attenuated aversions:
an adolescent phenotype emerging from studies in laboratory animals. Neurosci.
Biobehav. Rev..
Eade, A.M., Sheehe, P.R., Molina, J.C., Spear, N.E., Youngentob, L.M., Youngentob, S.L.,
2009. The consequence of fetal ethanol exposure and adolescent odor re-exposure on
the response to ethanol odor in adolescent and adult rats. Behav. Brain Funct. 5. 3-3.
Fabio, M.C., Macchione, A.F., Nizhnikov, M.E., Pautassi, R.M., 2015. Prenatal ethanol in‐
creases ethanol intake throughout adolescence, alters ethanol-mediated aversive
learning, and affects mu but not delta or kappa opioid receptor mRNA expression.
Eur. J. Neurosci. 41, 1569–1579.
Falkenberg, T., Mohammed, A.K., Henriksson, B., Persson, H., Winblad, B., Lindefors, N.,
1992. Increased expression of brain-derived neurotrophic factor mRNA in rat hip‐
pocampus is associated with improved spatial memory and enriched environment.
Neurosci. Lett. 138, 153–156.
Fernandez-Teruel, A., Driscoll, P., Gil, L., Aguilar, R., Tobena, A., Escorihuela, R.M.,
2002. Enduring effects of environmental enrichment on novelty seeking, saccha
A. Wille-Bille et al.
rin and ethanol intake in two rat lines (RHA/Verh and RLA/Verh) differing in incentive-
seeking behavior. Pharmacol., Biochem. Behav. 73, 225–231.
Fontaine, C.J., Pinar, C., Yang, W., Pang, A.F., Suesser, K.E., Choi, J.S.J., Christie, B.R.,
2019. Impaired bidirectional synaptic plasticity in juvenile offspring following prena‐
tal ethanol exposure. Alcohol Clin. Exp. Res. 43, 2153–2166.
Galaj, E., Shukur, A., Manuszak, M., Newman, K., Ranaldi, R., 2017. No evidence that en‐
vironmental enrichment during rearing protects against cocaine behavioral effects
but as an intervention reduces an already established cocaine conditioned place pref‐
erence. Pharmacol., Biochem. Behav. 156, 56–62.
Gaztanaga, M., Angulo-Alcalde, A., Spear, N.E., Chotro, M.G., 2017. The role of acetalde‐
hyde in the increased acceptance of ethanol after prenatal ethanol exposure. Front.
Behav. Neurosci. 11, 14.
Guttlein, L., Macchione, A.F., Hernandez-Fonseca, K., Haymal, O.B., Molina, J.C., Mendez
Ubach, M., Abate, P., 2019. Maternal manipulation during late gestation (GDs 17-20)
enhances ethanol consumption and promotes changes and opioid mRNA expression
in infant rats. Behav. Brain Res. 368, 111908.
Kapgal, V., Prem, N., Hegde, P., Laxmi, T.R., Kutty, B.M., 2016. Long term exposure to
combination paradigm of environmental enrichment, physical exercise and diet re‐
verses the spatial memory deficits and restores hippocampal neurogenesis in ventral
subicular lesioned rats. Neurobiol. Learn. Mem. 130, 61–70.
Karanikas, C.A., Lu, Y.L., Richardson, H.N., 2013. Adolescent drinking targets corti‐
cotropin-releasing factor peptide-labeled cells in the central amygdala of male and fe‐
male rats. Neuroscience 249, 98–105.
Kentner, A.C., Khoury, A., Lima Queiroz, E., MacRae, M., 2016. Environmental enrich‐
ment rescues the effects of early life inflammation on markers of synaptic transmis‐
sion and plasticity. Brain Behav. Immun. 57, 151–160.
Klose, R.J., Bird, A.P., 2006. Genomic DNA methylation: the mark and its mediators.
Trends Biochem. Sci. 31, 89–97.
Koob, G.F., 2013. Theoretical frameworks and mechanistic aspects of alcohol addiction:
alcohol addiction as a reward deficit disorder. Curr. Top. Behav. Neurosci. 13, 3–30.
Laviola, G., Hannan, A.J., Macrì, S., Solinas, M., Jaber, M., 2008. Effects of enriched envi‐
ronment on animal models of neurodegenerative diseases and psychiatric disorders.
Neurobiol. Dis. 31, 159–168.
Logrip, M.L., Janak, P.H., Ron, D., 2008. Dynorphin is a downstream effector of striatal
D
BDNF regulation of ethanol intake. FASEB J. : Off. Publ. Feder. Am. Soc. Experiment.
Biol. 22, 2393–2404.
Logrip, M.L., Janak, P.H., Ron, D., 2009. Blockade of ethanol reward by the kappa opioid
receptor agonist U50,488H. Alcohol 43, 359–365.
Lopez, M.B., Conde, K., Cremonte, M., 2017. Alcohol use disorders in argentinian girls
TE
and women 12 Months before delivery: comparison of DSM-IV, DSM-5, and ICD-10
diagnostic criteria. J. Addict. Med. 11, 106–113.
Lopez, M.B., Filippetti, V.A., Cremonte, M., 2015. [Alcohol consumption before and dur‐
ing pregnancy in Argentina: prevalence and risk factors]. Revista panamericana de
salud publica = Pan Am. J. Public Health 37, 211–217.
Miller, M.W., 2017. Effect of prenatal exposure to ethanol on the pyramidal tract in de‐
veloping rats. Brain Res. 1672, 122–128.
Mitchell, J.M., Liang, M.T., Fields, H.L., 2005. A single injection of the kappa opioid an‐
EC
tagonist norbinaltorphimine increases ethanol consumption in rats. Psychopharma‐
cology 182, 384–392.
Morales, M., Spear, L.P., 2014. The effects of an acute challenge with the NMDA receptor
antagonists, MK-801, PEAQX, and ifenprodil, on social inhibition in adolescent and
adult male rats. Psychopharmacology 231, 1797–1807.
Morean, M.E., Kong, G., Camenga, D.R., Cavallo, D.A., Connell, C., Krishnan-Sarin, S.,
2014. First drink to first drunk: age of onset and delay to intoxication are associated
with adolescent alcohol use and binge drinking. Alcohol Clin. Exp. Res. 38, 2615–
2621.
RR
Mosher, W.D., Jones, J., Abma, J.C., 2012. Intended and Unintended Births in the United
States: 1982–2010. National Health Statistics Reports. National Center for Health
Statistics, Hyattsville, MD, p. 55. 2012.
Munetsuna, E., Hattori, M., Sakimot, o Y, Ishida, A., Sakata, S., Hojo, Y., Kawato, S., Ya‐
mazaki, T., 2011. Environmental enrichment alters gene expression of steroidogenic
enzymes in the rat hippocampus. Gen. Comp. Endocrinol. 171, 28–32.
National Research and Council, 1996. Guide for the Care and Use of Laboratory Animals.
National Academy Press, Washington, D.C.
Nelson, L.R., Taylor, A.N., Lewis, J.W., Branch, B.J., Liebeskind, J.C., 1986. Morphine
analgesia is potentiated in adult rats prenatally exposed to ethanol. Brain Res. 372,
CO
234–240.
Nizhnikov, M.E., Pautassi, R.M., Carter, J.M., Landin, J.D., Varlinskaya, E.I., Bordner,
K.A., Werner, D.F., Spear, N.E., 2014. Brief prenatal ethanol exposure alters behav‐
ioral sensitivity to the kappa opioid receptor agonist (U62,066E) and antagonist
(Nor-BNI) and reduces kappa opioid receptor expression. Alcohol Clin. Exp. Res. 38,
1630–1638.
Nizhnikov, M.E., Pautassi, R.M., Varlinskaya, E.I., Rahmani, P., Spear, N.E., 2012. Onto‐
genetic differences in ethanol’s motivational properties during infancy. Alcohol 46,
225–234.
O’Keeffe, L.M., Kearney, P.M., McCarthy, F.P., Khashan, A.S., Greene, R.A., North, R.A.,
UN
Poston, L., McCowan, L.M., Baker, P.N., Dekker, G.A., Walker, J.J., Taylor, R.,
Kenny, L.C., 2015. Prevalence and predictors of alcohol use during pregnancy: find‐
ings from international multicentre cohort studies. BMJ open 5. e006323.
Parnell, S.E., Holloway, H.E., Baker, L.K., Styner, M.A., Sulik, K.K., 2014. Dysmor‐
phogenic effects of first trimester-equivalent ethanol exposure in mice: a magnetic
resonance microscopy-based study. Alcohol Clin. Exp. Res. 38, 2008–2014.
Pautassi, R.M., Godoy, J.C., Molina, J.C., 2015. Adolescent rats are resistant to the devel‐
opment of ethanol-induced chronic tolerance and ethanol-induced conditioned aver‐
sion. Pharmacol., Biochem. Behav. 138, 58–69.
Pautassi, R.M., Nizhnikov, M., Molina, J.C., Boehm, S.L., Spear, N., 2007. Differential ef‐
fects of ethanol and midazolam upon the devaluation of an aversive memory in in‐
fant rats. Alcohol 41, 421–431.
Pautassi, R.M., Suarez, A.B., Hoffmann, L.B., Rueda, A.V., Rae, M., Marianno, P., Ca‐
marini, R., 2017. Effects of environmental enrichment upon ethanol-induced condi
12
Neuropharmacology xxx (xxxx) xxx-xxx
tioned place preference and pre-frontal BDNF levels in adolescent and adult mice. Sci.
Rep. 7, 8574.
Paxinos, G.W.C., 2007. The Rat Brain in Stereotaxic Coordinates. AcadPress, San Diego.
Petrov, E.S., Nizhnikov, M.E., Varlinskaya, E.I., Spear, N.E., 2006. Dynorphin A (1-13)
and responsiveness of the newborn rat to a surrogate nipple: immediate behavioral
consequences and reinforcement effects in conditioning. Behav. Brain Res. 170, 1–14.
Pidsley, R., Mill, J., 2011. Epigenetic studies of psychosis: current findings, methodologi‐
cal approaches, and implications for postmortem research. Biol. Psychiatry 69, 146–
F
156.
Popoola, D.O., Nizhnikov, M.E., Cameron, N.M., 2017. Strain-specific programming of
prenatal ethanol exposure across generations. Alcohol 60, 191–199.
Pucci, M., Micioni Di Bonaventura, M.V., Giusepponi, M.E., Romano, A., Filaferro, M.,
OO
Maccarrone, M., Ciccocioppo, R., Cifani, C., D’Addario, C., 2016. Epigenetic regula‐
tion of nociceptin/orphanin FQ and corticotropin-releasing factor system genes in
frustration stress-induced binge-like palatable food consumption. Addict. Biol. 21,
1168–1185.
Rae, M., Zanos, P., Georgiou, P., Chivers, P., Bailey, A., Camarini, R., 2018. Environmen‐
tal enrichment enhances conditioned place preference to ethanol via an oxytociner‐
gic-dependent mechanism in male mice. Neuropharmacology.
Ramirez-Rodriguez, G., Ocana-Fernandez, M.A., Vega-Rivera, N.M., Torres-Perez, O.M.,
Gomez-Sanchez, A., Estrada-Camarena, E., Ortiz-Lopez, L., 2014. Environmental en‐
richment induces neuroplastic changes in middle age female BalbC mice and in‐
creases the hippocampal levels of BDNF, p-Akt and p-MAPK1/2. Neuroscience 260,
PR
158–170.
Redila, V.A., Olson, A.K., Swann, S.E., Mohades, G., Webber, A.J., Weinberg, J., Christie,
B.R., 2006. Hippocampal cell proliferation is reduced following prenatal ethanol ex‐
posure but can be rescued with voluntary exercise. Hippocampus 16, 305–311.
Riley, E.P., Infante, M.A., Warren, K.R., 2011. Fetal alcohol spectrum disorders: an
overview. Neuropsychol. Rev. 21, 73–80.
Rockman, G.E., Borowski, T.B., Glavin, G.B., 1986. The effects of environmental enrich‐
ment on voluntary ethanol consumption and stress ulcer formation in rats. Alcohol 3,
299–302.
Rockman, G.E., Gibson, J.E., 1992. Effects of duration and timing of environmental en‐
richment on voluntary ethanol intake in rats. Pharmacol., Biochem. Behav. 41, 689–
693.
Rockman, G.E., Gibson, J.E., Benarroch, A., 1989. Effects of environmental enrichment
on voluntary ethanol intake in rats. Pharmacol., Biochem. Behav. 34, 487–490.
Rodriguez-Ortega, E., de la Fuente, L., de Amo, E., Cubero, I., 2018. Environmental en‐
richment during adolescence acts as a protective and therapeutic tool for ethanol
binge-drinking, anxiety-like, novelty seeking and compulsive-like behaviors in
C57BL/6J mice during adulthood. Front. Behav. Neurosci. 12, 177.
Rueda, A.V., Teixeira, A.M., Yonamine, M., Camarini, R., 2012. Environmental enrich‐
ment blocks ethanol-induced locomotor sensitization and decreases BDNF levels in
the prefrontal cortex in mice. Addict. Biol. 17, 736–745.
Shenoda, B.B., 2017. An overview of the mechanisms of abnormal GABAergic interneu‐
ronal cortical migration associated with prenatal ethanol exposure. Neurochem. Res.
42, 1279–1287.
Solinas, M., Thiriet, N., Chauvet, C., Jaber, M., 2010. Prevention and treatment of drug
addiction by environmental enrichment. Prog. Neurobiol. 92, 572–592.
Solinas, M., Thiriet, N., El Rawas, R., Lardeux, V., Jaber, M., 2009. Environmental enrich‐
ment during early stages of life reduces the behavioral, neurochemical, and molecu‐
lar effects of cocaine. Neuropsychopharmacology : Off. Publ. Am. Coll. Neuropsy‐
chopharmacol. 34, 1102–1111.
Spear, L.P., 2000. The adolescent brain and age-related behavioral manifestations. Neu‐
rosci. Biobehav. Rev. 24, 417–463.
Spear, N.E., Molina, J.C., 2005. Fetal or infantile exposure to ethanol promotes ethanol
ingestion in adolescence and adulthood: a theoretical review. Alcohol Clin. Exp. Res.
29, 909–929.
Stairs, D.J., Klein, E.D., Bardo, M.T., 2006. Effects of environmental enrichment on ex‐
tinction and reinstatement of amphetamine self-administration and sucrose-main‐
tained responding. Behav. Pharmacol. 17, 597–604.
Tipyasang, R., Kunwittaya, S., Mukda, S., Kotchabhakdi, N.J., Kotchabhakdi, N., 2014.
Enriched environment attenuates changes in water-maze performance and BDNF
level caused by prenatal alcohol exposure. EXCLI J. 13, 536–547.
Varlinskaya, E.I., Spear, L.P., Diaz, M.R., 2018. Stress alters social behavior and sensitiv‐
ity to pharmacological activation of kappa opioid receptors in an age-specific manner
in Sprague Dawley rats. Neurobiol Stress 9, 124–132.
Vazquez-Sanroman, D., Sanchis-Segura, C., Toledo, R., Hernandez, M.E., Manzo, J.,
Miquel, M., 2013. The effects of enriched environment on BDNF expression in the
mouse cerebellum depending on the length of exposure. Behav. Brain Res. 243, 118–
128.
Waddell, J., Mooney, S.M., 2017. Choline and working memory training improve cogni‐
tive deficits caused by prenatal exposure to ethanol. Nutrients 9.
Walker, B.M., Koob, G.F., 2008. Pharmacological evidence for a motivational role of
kappa-opioid systems in ethanol dependence. Neuropsychopharmacology: Off. Publ.
Am. Coll. Neuropsychopharmacol. 33, 643–652.
Wang, R., Hausknecht, K.A., Shen, Y.L., Haj-Dahmane, S., Vezina, P., Shen, R.Y., 2018.
Environmental enrichment reverses increased addiction risk caused by prenatal
ethanol exposure. Drug Alcohol Depend. 191, 343–347.
Wille-Bille, A., Miranda-Morales, R.S., Pucci, M., Bellia, F., D’Addario, C., Pautassi, R.M.,
2018. Prenatal ethanol induces an anxiety phenotype and alters expression of dynor‐
phin & nociceptin/orphanin FQ genes. Prog. Neuro-Psychopharmacol. Biol. Psychia‐
try 85, 77–88.
Winer, B., Brown, D.R., Michels, K.M., 1991. Statistical Principles in Experimental De‐
sign. (New York).
Yamaguchi, H., Hara, Y., Ago, Y., Takano, E., Hasebe, S., Nakazawa, T., Hashimoto, H.,
Matsuda, T., Takuma, K., 2017. Environmental enrichment attenuates behavioral ab‐
normalities in valproic acid-exposed autism model mice. Behav. Brain Res. 333, 67–
73.
A. Wille-Bille et al. Neuropharmacology xxx (xxxx) xxx-xxx

Zhu, J., Apparsundaram, S., Bardo, M.T., Dwoskin, L.P., 2005. Environmental enrichment
decreases cell surface expression of the dopamine transporter in rat medial prefrontal
cortex. J. Neurochem. 93, 1434–1443.

F
OO
PR
D
TE
EC
RR
CO
UN

13