Journal Article / 学術雑誌論文

Molecular phylogeny and evolution of the

maple powdery mildew (Sawadaea,
Erysiphaceae) inferred from nuclear rDNA
sequences
Hirose, Simon; Tanda, Seinosuke; Kiss, Levente; Grigaliunaite,
Banga; Havrylenko, Maria; Takamatsu, Susumu

Mycological Research. 2005, 109(8), p. 912-922.

http://hdl.handle.net/10076/2649

この版は著者の原稿を元にしています。引用等を行う際は、必ず、出版者が提供してい
る版を参照してください。
 Hirose et al.: Sawadadea phylogeny 1

Molecular phylogeny and evolution of the maple powdery mildew

(Sawadaea Miyabe; Erysiphaceae) inferred from nuclear rDNA
sequences

Simon Hirosea, Seinosuke Tandab, Levente Kissc, Banga Grigaliunaited,

Maria Havrylenkoe and Susumu Takamatsua,*

a
Faculty of Bioresources, Mie University, 1515 Kamihama, Tsu, Mie 514-8507, Japan

b
Faculty of Agriculture, Tokyo University of Agriculture, 1737 Funako, Atsugi, Kanagawa

243-0034, Japan

c
Plant Protection Institute, Hungarian Academy of Sciences, H-1525 Budapest, POB 102,

Hungary

d
Institute of Botany, Zaliuju Ezeru 49, Vilnius, LT – 08406, Lithuania

e
Departamento de Botánica, Centro Regional Universitario Bariloche, Universidad Nacional

del Comahue, Quintral 1250, (8400) San Carlos de Bariloche, Río Negro, Argentina

––––––––––––––––––––––––––––––

*
Corresponding author

Susumu Takamatsu

Faculty of Bioresources, Mie University, 1515 Kamihama, Tsu, Mie 514-8507, Japan

Tel: +81-59-2319497; Fax: +81-59-2319540; E-mail: takamatu@bio.mie-u.ac.jp

 Hirose et al.: Sawadadea phylogeny 2

Abstract

To understand the phylogenetic relationships and evolution of the powdery mildew genus

Sawadaea (Ascomycete: Erysiphaceae), obligate parasitic fungi of maples, we performed

molecular phylogenetic analyses based on 47 internal transcribed spacer (ITS) sequences and

10 28S rDNA sequences. Seven major clades of Sawadaea, each represented by powdery

mildew specimens collected from a single or a small number of closely related sections of

Acer (maples), were identified in this study, suggesting a close evolutionary relationship

exsists between Acer (host) and Sawadaea (parasite). A 6- to 11-base insertion/deletion was

found in the ITS1 region, and the presence or absence of the indel was consistent within the

respective clades. Because the outgroup genera Podosphaera and Cystotheca have no

deletions in these sites, deletion of the sequences may have occurred during the divergence of

the respective clades of Sawadaea. The seven clades of Sawadaea were divided into two

geographical groups, viz., the East Asian group and the global group, based on the countries

of collection. Calculation of the evolutionary timing of Sawadaea using molecular clocks

showed that the divergence of different species of Acer occurred many millions of years

before the radiation of Sawadaea. Thus, the close evolutionary relationship between

Sawadaea and Acer found in this study might not be due to a true co-evolutionary process.
Powdery mildew fungi belonging to the genus Sawadaea may have jumped onto Acer spp.

long after the radiation of the major sections of these trees, and then expanded their host

ranges according to the phylogeny and geographical distribution of Acer.

Keywords: Aceraceae; Erysiphales; Evolution; Geographical distribution; ITS; Maple;

Molecular clock; Molecular phylogeny; Powdery mildew

 Hirose et al.: Sawadadea phylogeny 3

1. Introduction

The Erysiphaceae (Ascomycete: Erysiphales) are a group of obligate parasitic fungi of

plants that cause powdery mildew diseases on about 10,000 angiosperm species (Amano,

1986). With the exception of the dormant stage, their life cycle depends completely on living

hosts, from which they obtain nutrients without killing the host cells and without which they

are unable to survive. To maintain the obligate parasitic life cycle, the Erysiphaceae have

developed highly specific and sophisticated mechanisms to avoid the resistance system of the

host, to obtain nutrient resources from the host without causing too much damage to the host

cells, to synchronize their life-cycle parameters to those of the host, etc. (Aist and Bushnell,

1991; Bushnell and Gay, 1978; Giese et al., 1997). Consequently, most species of

Erysiphaceae show strict host specificity, in which a given species or race can infect and

utilize only one narrow range of host plants, or sometimes only a particular host species.

Therefore, it is expected that the association between the Erysiphaceae and their hosts would

have been conserved during the course of their evolution. The Erysiphaceae are thus good

model organisms to investigate evolutionary relationships between plant pathogenic fungi and

their host plants (Mori et al., 2000; Hirata et al., 2000; Matsuda and Takamatsu, 2003;

Takamatsu, 2004).

Recent molecular evolutionary studies have identified five major lineages in the

Erysiphaceae (Mori et al., 2000), each of which is currently recognized as a tribe of the family

(Braun, 1999; Braun and Takamatsu, 2000; Takamatsu, 2004). Three of the five tribes include

both tree-parasitic taxa and herb-parasitic taxa. Because tree-parasitic taxa are usually situated

in the basal positions of phylogenetic trees of their respective tribes, we can infer that the
 Hirose et al.: Sawadadea phylogeny 4

Erysiphaceae were originally tree parasites, and laterally expanded their host ranges to

herbaceous plants on multiple occasions (Mori et al., 2000; Takamatsu et al., 2000). One

obvious example is found in the genus Podosphaera. This genus includes two sections: the

tree-parasitic section, Podosphaera, and the herb-parasitic section, Sphaerotheca. Two

hundred and fifty plant species are known hosts of the powdery mildew species in section

Podosphaera, 86% of which belong to the Rosaceae. Two subsections of the section

Sphaerotheca, i.e., subsections Sphaerotheca and Magnicellulatae, are considered to derive

from the section Podosphaera by two independent episodes of host-jumping from trees to

herbs (Takamatsu et al., 2000). In the evolutionary route from section Podosphaera to

subsection Magnicellulatae, host-jumping occurred from the genus Prunus (Rosaceae) to

herbs of the Scrophulariaceae, and jumping then subsequently occurred from the

Scrophulariaceae to the Asteraceae (Hirata et al., 2000).

Host–parasite co-speciation in the Erysiphaceae was recently reported between the genus

Golovinomyces and the Asteraceae by molecular phylogenetic analysis (Matsuda and

Takamatsu, 2003). Tree topology comparisons between the asteraceous hosts and their

parasites revealed that Golovinomyces diverged along with the phylogeny of host tribes

Cardueae, Astereae, Heliantheae, and Lactuceae of the Asteraceae. This molecular analysis

indicates that host-jumping has also occurred from the Asteraceae to other families, as well as

within the Asteraceae. Based on these results, it was suggested that Golovinomyces adapted

two different strategies during the evolution of host–parasite relationships. Most probably, one

strategy was divergence in accordance with the phylogeny of their hosts, which occurred

within the Asteraceae, and the other was host-jumping from the Asteraceae to other plant

families.
 Hirose et al.: Sawadadea phylogeny 5

The genera of the Erysiphaceae are divided into two groups: (A) those having large host

ranges and (B) those having narrow host ranges (Amano, 1986). The genera Erysiphe,

Golovinomyces, Leveillula, Podosphaera, and Phyllactinia are representatives of the former

group, each having more than 50 plant families as their hosts. The latter group includes the

genera Arthlocladiella, Cystotheca, Brasiliomyces, Pleochaeta, Sawadaea, and Typhulochaeta,

each having one or only a few plant families as their hosts. It is noteworthy that all of the

genera with narrow host ranges are tree-parasitic. In general, tree-parasitic powdery mildews

are ancestral to herb-parasitic powdery mildews (Mori et al., 2000; Takamatsu et al., 2000;

Takamatsu, 2004). The genus Sawadaea belongs to the narrow host range group. Of the 82

host species of the genus (including subspecies and varieties), 77 (94%) belong to the

Aceraceae, three to the Sapindaceae, and two to the Hippocastanaceae (Amano, 1986). Thus,

Sawadaea is a powdery mildew genus mainly parasitizing the Aceraceae. The genus belongs

to the tribe Cystotheceae, which consists of three genera, Cystotheca, Podosphaera, and

Sawadaea. These genera form a distinct monophyletic group and share a unique characteristic,

namely the occurrence of distinct fibrosin bodies in their conidia (Mori et al., 2000). Of these

three genera, Cystotheca and Podosphaera produce only one ascus in their ascomata, whereas

the ascomata of Sawadaea contain many asci. Because all other erysiphaceous genera are

polyascal, this divergence from polyascal type to monoascal type may have occurred in the

tribe Cystotheceae. This suggests that Sawadaea is an ancestral genus in the tribe

Cystotheceae, which is supported by an earlier molecular phylogenetic analysis (Mori et al.,

2000).

The family Aceraceae consists of only two genera: Acer and Dipteronia. The latter genus

is composed of only two species that are distributed in China. The genus Acer (maples),
 Hirose et al.: Sawadadea phylogeny 6

consisting of about 150 species with many intraspecific taxa, is represented by trees and

shrubs that are widely distributed in the temperate regions of the Northern Hemisphere

(Delendick, 1990; de Jong, 1994). Many Acer have been cultivated as popular ornamental

trees in parks, streets or gardens. The Erysiphaceae reportedly occur only on the genus Acer,

and not on the genus Dipteronia. Delineation of the different taxa in the genus Acer is

sometimes difficult because of the large number of microspecies, and doubtful varieties and

forms based on morphological variation within many species (Ogata, 1967; Delendick, 1990;

Park et al., 1993). Recently, molecular phylogenetic approaches clarified the taxonomy and

evolutionary history of this genus (Hasebe et al., 1998; Suh et al., 2000).

For the phylogenetic analysis of Sawadaea in the present study, we used 47 nucleotide

sequences comprising about 500 bases of the internal transcribed spacer (ITS) region,

including the 5.8S rRNA gene, and 10 sequences comprising about 800 bases of the domains

D1 and D2 of the 28S rRNA gene. The main purposes of this study were (1) to reconstruct the

phylogenetic relationships among Sawadaea species; and (2) to reconstruct the evolutionary

history of Sawadaea with special regard to the aspects of host relationships, geographical

distributions, and timing of evolutionary events.

2. Materials and methods

2.1. Sample sources

Host plants, collection locations, and accession numbers of the nucleotide sequence

databases (DDBJ, EMBL, and GenBank) used in this study are listed in Table 1. Most of the

sequences were determined during this study and registered in DDBJ under the accession
 Hirose et al.: Sawadadea phylogeny 7

numbers of AB193350–AB193401. The powdery mildew anamorphs found on Acer spp. and

belonging to the genus Sawadaea were identified based on the following morphological

characteristics: macro-conidia with distinct fibrosin bodies produced in chains and

germinating with slender germ tubes (Pannosa type; Braun, 1987); nipple-shaped or indistinct

hyphal appressoria; and, sometimes, the presence of micro-conidia with fibrosin bodies. If

ascomata were present, further identification was based on dichotomously branched

appendages with uncinate–circinate tips arising from the upper half of the ascomata, and

polyascal ascomata containing eight ascospores in an ascus. Sawadaea species were identified

based on teleomorph characteristics when available; otherwise, they were tentatively

identified by host plants based on the monograph of Braun (1987).

2.2. DNA extraction, PCR, and sequencing

Whole-cell DNA was isolated from ascomata or mycelia by the Chelex method (Walsh et

al., 1991; Hirata and Takamatsu, 1996). The ITS region including the 5.8S rDNA, and

domains D1 and D2 of the 28S rDNA were separately amplified two or three times using the

polymerase chain reaction (PCR) with nested primer sets. PCR reactions were conducted with

TaKaRa Taq DNA polymerase (TaKaRa, Tokyo, Japan) under the following thermal cycling

conditions in a thermal cycler TP-400 (TaKaRa, Tokyo, Japan): an initial denaturing step at

95˚C for 2 min; thermocycling for 30 cycles, where each cycle consisted of 30 sec at 95˚C

followed by 30 sec at 52˚C for annealing, and 30 sec at 72˚C for extension; and a final

extension cycle of 7 min at 72˚C. A negative control, lacking template DNA, was included for

each set of reactions. The PCR product was subjected to electrophoresis in a 1.5% agarose gel

in TAE buffer. The DNA product of each amplification was then excised from the

ethidium-stained gel and purified using the JETSORB kit (Genomed, Oeynhausen, Germany)

following the manufacturer's protocol. Nucleotide sequences of the PCR products were

obtained for both strands using direct sequencing in a DNA sequencer CEQ2000XL

(Beckman Coulter, Fullerton, CA, USA). The sequence reactions were conducted using the

CEQ Dye Terminator Cycle Sequencing kit (Beckman Coulter, Fullerton, CA, USA)
 Hirose et al.: Sawadadea phylogeny 8

following the manufacturer's instructions.

For amplification of the ITS region, primers ITS5 (White et al., 1990) and p3 (Kusaba

and Tsuge, 1995) were used for the first amplification. One microliter of the first reaction

mixture was used for the second amplification with the partial nested primer set ITS5 and

ITS4 (White et al., 1990). The ITS5/ITS4 fragment was subjected to sequencing using ITS1,

ITS4, T3 (ACG CTC GAA CAG GCA TGC CC), and T4 (TCA ACA ACG GAT CTC TTG

GC) (Hirata and Takamatsu, 1996) as sequence primers. For amplification of the 28S rDNA,

primers PM3 (GKG CTY TMC GCG TAG T) (Takamatsu and Kano, 2001) and TW14 (GCT

ATC CTG AGG GAA ACT TC) (Mori et al., 2000), and NL1 (AGT AAC GGC GAG TGA

AGC GG) (Mori et al., 2000) and TW14 were used for the first and second amplification,

respectively. Primers NL1, NL2 (TAC TTG TTC GCT ATC GGT CT), NL3 (AGA CCG ATA

GCG AAC AAG TA) (Mori et al., 2000), and NLP2 were used for sequencing.

2.3. Molecular phylogenetic analyses

Sequences were initially aligned using the Clustal V package (Higgins et al., 1992). The

alignment was then visually refined with a word processing program, using color-coded

nucleotides, and ambiguously aligned sites were removed from the data set in the following
analyses. The data matrix used for phylogenetic analyses are available from TreeBASE as

accession number: SN2078. Phylogenetic trees were obtained from the data using parsimony,

distance, and maximum likelihood (ML) methods. For the parsimony analysis, we used the

maximum-parsimony (MP) method with a heuristic search using PAUP* 4.0b8 (Swofford,

2001). This search was repeated 100 times with different random starting points, using the

stepwise addition option to increase the likelihood of finding the most parsimonious tree. All

sites were treated as unordered and unweighted. Alignment gaps were treated either as

missing data, ‘fifth character’, or indel codes. The branch-swapping algorithm used was TBR,

the MULPARS option was in effect, and zero-length branches were collapsed.

For distance analysis, the most appropriate evolution model was determined for a given

data set using PAUP* and Modeltest 3.06 (Posada and Crandall, 1998). A starting tree was
 Hirose et al.: Sawadadea phylogeny 9

obtained with the neighbor-joining (NJ) method. With this tree, likelihood scores were

calculated for 56 alternative models of evolution by PAUP*. The output file was then

imported to Modeltest to compare the models by the Akaike information criterion (Akaike,

1974). Once a model of evolution was chosen, it was used to construct phylogenetic trees with

the NJ method by PAUP*. The strength of the internal branches from the resulting trees were

tested by bootstrap analysis using 1000 replications (Felsenstein, 1985) in both parsimony and

distance analyses.

For ML analysis, we used the computer program package MOLPHY version 2.3. (Adachi

and Hasegawa, 1996). To obtain a starting tree topology, NucML of MOLPHY was used to

generate a distance matrix with the HKY85 model (Hasegawa et al., 1985); the distance

matrix was then introduced into NJdist to produce a NJ tree. The NJ tree topology was then

introduced into NucML with the aligned dataset, and an ML tree was estimated heuristically

using the local rearrangement search option of NucML.

Rooted RASA analysis (Relative Apparent Synapomorphy Analysis; Milinkovitch

and Lyons-Weiler, 1998; Lyons-Weiler et al., 1998) was performed to select appropriate

outgroup taxa. Based on phylogenetic analysis of the 28S rDNA, we selected three fungal

groups, shown in Fig. 1, as candidates of outgroup taxa: group A, Podosphaera pannosa and P.

filipendulae; group B, P. tridactyla and P. xanthii; and group C, Cystotheca wrightii and C.

lanestris. The ITS sequences of each candidate were combined with the data set of Sawadaea

to produce three kinds of data set with different outgroup taxa. These data sets were

introduced to RASA version 2.4 to calculate tRASA (phylogenetic signal) values. The taxa

that represented the highest tRASA value were regarded as the most appropriate outgroup

taxa, and were used for subsequenct phylogenetic analyses.

3. Results
 Hirose et al.: Sawadadea phylogeny 10

3.1. Phylogenetic relationship of Sawadaea within the Erysiphaceae

Ten sequences of domains D1 and D2 of the 28S rDNA of Sawadaea species were

aligned with 30 sequences of other erysiphaceous taxa obtained from the DNA database.

Byssoascus striatosporus was used as an outgroup taxon based on Mori et al. (2000). The data

set comprised 41 taxa and 968 characters, of which 209 (21.6%) characters were variable and

148 (15.3%) characters were informative for parsimony analysis. A parsimony analysis (gap =

missing data) using PAUP* generated 18 equally parsimonious trees with 611 steps (CI =

0.4746, RI = 0.7494, RC = 0.3557). Tree topologies were almost consistent among the 18

trees, except for only tiny branching orders of the terminal branches. One of the 18 trees with

the highest log likelihood value is shown in Fig. 1. The five tribes that have been recognized

in the Erysiphaceae (Erysipheae, Phyllactinieae, Golovinomyceteae, Cystotheceae and

Blumerieae) (Cook et al., 1997; Braun, 1999; Braun and Takamatsu, 2000; Mori et al., 2000;

Takamatsu, 2004) were again supported as monophyletic groups, although Erysiphe

australiana was not in the tribe Erysipheae. The 10 Sawadaea taxa formed a clade with strong

bootstrap supports (97%) and were sister to the genus Cystotheca with an 85% bootstrap

value. The clade of the tribe Cystotheceae, comprising the genera Cystotheca, Podosphaera,

and Sawadaea, was supported 99% in bootstrap analysis, and was sister to the tribe

Blumerieae.

3.2. Phylogenetic relationships within Sawadaea

The nucleotide sequences of the ITS regions, including the 5.8S rRNA gene of Sawadaea
 Hirose et al.: Sawadadea phylogeny 11

species, ranged from 463 bp to 473 bp in length. The differences in ITS sequence length

among Sawadaea species were caused mainly by a 6–11 bp insertion/deletion (indel) between

sites 84 and 94 of the ITS1 region (Fig. 2). These 47 sequences of Sawadaea were aligned to

produce a data set of 480 characters, of which 65 characters (13.5%) were variable and 35

characters (7.3%) were informative for parsimony analysis.

The ITS sequences of the respective outgroup fungal groups were combined with the

above data set of Sawadaea to produce three kinds of data sets with different outgroup taxa.

Because the combined data set with group B as the outgroup showed the highest tRASA value

(34.7875) in RASA analysis, P. tridactyla and P. xanthii were used as outgroup taxa in the

following analyses. Three kinds of tree constructing algorithms were used to reconstruct

phylogenetic relationships: MP, NJ and ML analyses. Three different gap treatments (gap =

missing data, fifth character, and indel coding) were used in the MP analysis. Seven

monophyletic groups were commonly generated in all five trees (Figs. 3 and 4), although the

branching order of the groups differed between trees. The respective clades were represented

by the following taxa: clade 1, S. tulasnei collected in Japan; clade 2, S. tulasnei collected in

Europe and North America; clade 3, Sawadaea sp. on Acer buergerianum; clade 4, Sawadaea

sp. on A. argutum; clade 5, S. polyfida; clade 6, S. bicornis on A. pseudoplatanus and

Sawadaea sp. on A. negundo; and clade 7. S. bicornis on A. campestre and A. platanoides.

Monophyly of clades 1, 2, 4, 5 and 7 was strongly supported by the bootstrap value of 83% or

more, and clade 6 was moderately supported (65% bootstrap) in the MP analysis with gap =

fifth character (Fig. 3). Clades 6 and 7 were further grouped together with 78% bootstrap

support. Clades 1 and 2 had 10 bp deletions, clade 3 had 11 bp deletions, and clade 4 had 6 bp

deletions, in the ITS1 region (Fig. 2), whereas clades 5, 6 and 7 had no deletions in this region.
 Hirose et al.: Sawadadea phylogeny 12

This was consistent in the respective clades, which supports the robustness of the respective

clades. These seven clades were divided into two distinct groups based on country specimens

were collected in. All specimens of clades 1, 3, 4 and 5 were collected in Japan, and all

specimens of clades 2, 6 and 7 were collected from other parts of the world (Europe, North

and South America, Oceania, and Western Asia).

There were only two cases when specimens on the same host species, collected in

different countries, were placed in different clades. Firstly, the five specimens of Sawadaea sp.

collected from A. negundo in Japan, France, the United States, Argentina and Australia were

included in two different clades: the fungus collected in Japan was placed in clade 1 with S.

tulasnei, whereas those collected in other countries were placed in clade 6 with S. bicornis on

A. pseudoplatanus. Secondly, Sawadaea sp. on A. platanoides collected in Japan was placed

in clade 1 with many specimens of S. tulasnei collected in Japan, but did not group with other

specimens of S. tulasnei on A. platanoides that were collected in Europe and North America.

To exclude the possibility that the sequences of Sawadaea sp. on A. negundo and A.

platanoides collected in Japan were created by any kind of experimental error, independent

DNA extraction, PCR and sequencing were performed

3.3. Dating of evolutionary events

We used a molecular clock to estimate the timing of divergence of Sawadaea and

initially performed likelihood ratio tests for ITS data sets to check whether a molecular clock

hypothesis was applicable. Because the likelihood ratio test could not reject a molecular clock

hypothesis for the data set, the data set was used to construct unweighted pair-group method
 Hirose et al.: Sawadadea phylogeny 13

with arithmetic averages (UPGMA) trees using PAUP*. Kimura’s two-parameter criterion

(Kimura, 1980) was used for calculation of pairwise genetic distances. The molecular clock

(2.52 × 10-9 per site per year) reported by Takamatsu and Matsuda (2004) was used for the

calculation. As shown in Fig. 5, Sawadaea split from the outgroup taxa about 30 million years

ago in the Oligocene, and divergence of the seven major clades of Sawadaea occurred within

10 million years ago.

4. Discussion

4.1. Phylogenetic relationshisp of Sawadaea within the Erysiphaceae

The present phylogenetic analyses performed with five different tree-constructing

methods commonly supported the presence of seven monophyletic groups in the genus

Sawadaea. However, the branching order of the seven clades was inconsistent between the

trees. Sequence analyses of the ITS regions of Sawadaea revealed a 6–11 bp indel between

sites 84 and 94 of the data set in the ITS1 region (Fig. 2). The presence and absence of the

different indels were consistent within the respective clades. Because the closely related genus

Podosphaera has similar sequences in this site, deletion of these sequences may have

occurred during the divergence of the respective clades of Sawadaea. Therefore, clades

containing this sequence could be regarded as ancestral clades. On the other hand, clades 1

and 2 have an identical 10 bp deletion in this region. Because it is unlikely that identical

deletion events occur independently in different lineages, clades 1 and 2 may share a common

ancestral taxon in which a deletion event occurred. Among the five trees, only the MP tree,
 Hirose et al.: Sawadadea phylogeny 14

which treated gaps as a fifth character, satisfied the above constraint. Therefore, we regarded

this tree as the most likely one and show it in Fig. 3. The members of clades 1 and 2 are

identified morphologically as S. tulasnei, a similarity that may also support the monophyly of

these two clades.

The most probable explanation of the deletion events that occurred over evolution in

Sawadaea could be as follows. A 6 bp deletion occurred in the lineage leading to the large

clade comprising clades 1, 2, 3 and 4. A further 4 bp deletion then occurred in the lineage

leading to the grouping of clades 1, 2 and 3. Then, a one base deletion occurred in the lineage

leading to Sawadaea sp. on A. buergerianum (clade 3). However, other branching orders

cannot be ruled out.

4.2. Host-parasite relationships

According to Amano (1986), the Sawadaea occurs on 56 species of Acer (excluding

subspecies and varieties) worldwide, indicating that about a third of Acer species are infected

by Sawadaea. As the average ratio of the host plants of the Erysiphaceae in angiosperms is

about 4.5%, this high ratio of host species in Acer suggests a close relationship between

Sawadaea (parasite) and Acer (host). We investigated the distribution of host species in 26

sections of Acer recognized by Ogata (1967) and found that host species of Sawadaea are

distributed in most of the 26 sections.

In clade 1, almost all of the host plants belong to section Platanoidea, except A.

crataegifolium (section Macrantha) and A. ginnala (section Trilobata). Similarly, the hosts of

clade 2 also belong to section Platanoidea (A. platanoides) and section Trilobata (A.
 Hirose et al.: Sawadadea phylogeny 15

tataricum). As sections Platanoidea, Macrantha and Trilobata form a monophyletic group in

the molecular phylogenetic analyses of Acer (Hasebe et al., 1998; Suh et al., 2000), the fungi

composing clades 1 and 2 infect closely related Acer species, except for A. negundo. Acer

buergerianum (clade 3) and A. argutum (clade 4) belong to sections Pentaphylla and Glabra,

respectively. Clade 5 mostly consists of host species of section Palmata, except A. cissifolium,

which belongs to section Cissifolia. The ITS sequence of the fungus on A. cissifolium has

some differences from those on section Palmata. Clade 6 is composed of sections Acer (A.

pseudoplatanus) and Negundo (A. negundo) and clade 7 of section Platanoidea (A. campestre

and A. platanoides). Consequently, host species in each of the seven clades of the Sawadaea

tree each represent a single or a small number of closely related sections of Acer. These

results reveal that the relationships between clades of Sawadaea (parasite) and sections of

Acer (host) have been conservative in their evolutionary history, which suggests that the

divergence of Sawadaea occurred in accord with the phylogeny of Acer. However, an isolate

of Sawadaea sp. on A. negundo did not group with the other four in clade 6 and was placed in

clade 1. Similarly, a Sawadaea sp. on A. platanoides collected in Japan was included in clade

1, instead of clade 2 in which all the other isolates from A. platanoides were placed. Acer

negundo and A. platanoides are mainly distributed in North America, and Europe and Central

Asia, respectively, but during the past decades both Acer species have repeatedly been

introduced to Japan as ornamental trees. This suggests that a powdery mildew native to Japan

has recently acquired parasitism to A. negundo and A. platanoides after these maples were

imported. These examples may indicate that the geographical position of the host plants is

also an important factor in extending the host range of Sawadaea.

 Hirose et al.: Sawadadea phylogeny 16

4.3. Geographical relationships

Our phylogenetic analysis shows important differences in geographical distribution

of taxa among the clades. All of the taxa composing clades 1, 3, 4 and 5 were collected in

Japan. Although we did not use specimens from China in this analysis, these clades could be

regarded as East Asian groups. In contrast, the taxa composing clades 2, 6 and 7 were

collected in Europe and North America, and some isolates of clade 6 were also collected in

South America, Eastern Asia and Oceania. We designated these clades as global groups. East

Asia, especially China, is considered the present center of diversification for Acer, because

most sections of Acer and about 50% of the species occur in this region (Suh et al., 2000).

Fossil records indicate that ancestral species of some maples presently distributed in Europe,

e.g., A. campestre and A. platanoides, migrated to Europe from East Asia during the Miocene

after the closure of the Turgai Strait (Wolfe, 1981; Tiffney and Manchester, 2000). Of the 82

host species of Sawadaea, 33 are recorded in East Asia, and only 11 and 13 are recorded in

Europe and North America, respectively (Amano, 1986). This similarity in distribution of

Acer (host) and Sawadaea (parasite) suggests that ancestors of some Sawadaea species also

migrated to Europe from East Asia with their host plants and diverged into the global groups

in that region. The different deletion/insertion status among clades 2, 6 and 7 (global clades)

found in the ITS1 region may indicate that at least two different lineages of Sawadaea

migrated to Europe and then diverged separately there.

4.4. Evolutionary timing

 Hirose et al.: Sawadadea phylogeny 17

There are many fossil records of Acer, which show that the following sections had

already diverged in the Eocene; sections Acer, Campestria, Distyla, Rubra, and Spicata sensu

Ogata (1967) (Tanai, 1978; Wolfe, 1981). In these sections, Spicata and Distyla have the

oldest fossil records from the Paleocene (Wolfe, 1981). The oldest specimens of the other

sections are from the early Eocene (Tanai, 1978; Wolfe, 1981). Based on these records, we

can postulate that Acer diverged in the early Tertiary and major sections radiated during the

Paleocene and Eocene. The present calculation of the evolutionary timing of Sawadaea using

molecular clocks shows that Sawadaea split from the outgroup taxa about 30 million years

ago in the Oligocene, and the divergence of the major clades of Sawadaea occurred within 10

million years ago in the Pliocene (Fig. 5). This result indicates that the time of radiation of

Acer is not congruent with the radiation time of Sawadaea: the evolution of this group of

powdery mildew fungi follows the radiation of Acer about 40 million years later. Therefore,

the close evolutionary relationship between Sawadaea (parasite) and Acer (host) shown above

is not a consequence of a true host–parasite co-evolution. Sawadaea may have acquired

parasitism to Acer long after the radiation of the major sections of its host, expanded its host

range according to the phylogeny of the host, or according to the host geographical position.

It is presumed that a rapid climatic change occurred from the Eocene to the

Oligocene eras, which resulted in a decrease of the average yearly temperature by about 10oC

(Tiffney, 1985; Tiffney and Manchester, 2001). There was a warm period in the middle

Miocene (ca. 15 million years ago), and then a global cooling occurred again during the

Pliocene and the Pleistocene. By calculating of evolutionary timing using a molecular clock,

Hasebe et al. (1998) suggest that the genetic interactions between eastern Asian and eastern

North American Acer continued at least until the late Miocene. The temporary warming in the
 Hirose et al.: Sawadadea phylogeny 18

middle Miocene and the subsequent cooling may have caused disjunctions in a variety of

plants including Acer (Wolfe, 1981; Tiffney and Manchester, 2001). We presume that these

disjunctions triggered the radiation of the respective clades of Sawadaea recognized in the

present phylogenetic analysis.

Acknowledgements

We thank Dr. Mitsuyasu Hasebe (National Institute of Basic Biology, Japan) for comments on

taxonomy and phylogeny of maples; Miss Saranya Limkaisang and Miss Seiko Niinomi for

sequencing of some Sawadaea specimens; and Prof. Glen Stanosz for providing a Sawadaea

specimen. This work was supported in part by Grant-in-Aid for Scientific Research (Nos.

13660047, 14255004 and 15405021) to ST from the Japan Society for the Promotion of

Science (JSPS). The support of a fellowship under the OECD Co-operative Research

Programme: Biological Resource Management for Sustainable Agricultural Systems and that

of a Janos Bolyai Research Fellowship, both awarded to LK, are also acknowledged.

References

Adachi, J., Hasegawa, M., 1996. MOLPHY: Programs for Molecular Phylogenetics, ver. 2.3.

Institute of Statistical Mathematics, Tokyo, Japan.

Aist, J.R., Bushnell, W.R., 1991. Invasion of plants by powdery mildew fungi, and cellular

mechanisms of resistance. In: Cole, G.T., Hoch, H.C. (Eds.), The Fungal Spore and

Disease Initiation in Plants and Animals. Plenum Press, New York, USA, pp. 321–345.

Akaike, H., 1974. A new look at the statistical model identifications. IEEE Trans. Automat.
 Hirose et al.: Sawadadea phylogeny 19

Contr. AC-19, 716–723.

Amano (Hirata), K., 1986. Host Range and Geographical Distribution of the Powdery Mildew

Fungi. Japan Scientific Societies Press, Tokyo, Japan.

Braun, U., 1987. A monograph of the Erysiphales (powdery mildews). Beih. Nova Hedwigia

89, 1–700.

Braun, U., 1999. Some critical notes on the classification and generic concept of the

Erysiphaceae. Schlechtendalia 3, 49–55.

Braun, U., Takamatsu, S., 2000. Phylogeny of Erysiphe, Microsphaera, Uncinula

(Erysipheae) and Cystotheca, Podosphaera, Sphaerotheca (Cystotheceae) inferred from

rDNA ITS sequences – some taxonomic consequences. Schlechtendalia 4, 1–33.

Bushnell, W.R., Gay, J., 1978, Accumulation of solutes in relation to the structure and

function of haustoria in powdery mildews. In: Spencer, D.M. (Ed.), The Powdery

Mildews. Academic Press, New York, USA, pp. 183–235.

Cook, R.T.A., Inman, A.J., Billings, C., 1997. Identification and classification of powdery

mildew anamorphs using light and scanning electron microscopy and host range data.

Mycol. Res. 101, 975–1002.

de Jong, P.C., 1994. Taxonomy and reproductive biology of maples. In: van Gelderen, D.M.,

de Jong, P.C., Oterdoom, H.J. (Eds.), Maples of the World. Timber Press, Portland, pp.

69–103.

Delendick, T.J., 1990. A survey of foliar flavonoids in the Aceraceae. Mem. New York Bot.

Gard. 54, 1–129.

Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap.

Evolution 39, 783–791.

Giese, H., Hippe-Sanwald, S., Somerville, S., Weller, J., 1997. Erysiphe graminis. In: Carroll,
 Hirose et al.: Sawadadea phylogeny 20

G.C., Tudzynski, P. (Eds.), The Mycota V Plant Relationships Part B. Springer, Berlin,

Germany, pp. 55–78.

Hasebe, M., Ando, T., Iwatsuki, K., 1998. Intragenetic relationships of maple trees based on

the choloroplast DNA restriction fragment length polymorphisms. J. Plant Res. 111,

441–451.

Hasegawa, M., Kishino, H., Yano, T.-A., 1985. Dating of the human-ape splitting by a

molecular clock of mitochondrial DNA. J. Mol. Evol. 22, 160–174.

Higgins, D.G., Bleaby, A.J., Fuchs, R., 1992. CLUSTAL V: improved software for multiple

sequence alignment. Comput. Appl Biosci 8, 189-191.

Hirata, T., Cunnington, J.H., Paksiri, U., Limkaisang, S., Shishkoff, N., Grigaliunaite, B.,

Sato, Y., Takamatsu, S., 2000. Evolutionary analysis of subsection Magnicellulatae of

Podosphaera sect. Sphaerotheca (Erysiphales) based on the rDNA internal transcribed

spacer sequences with special reference to host plants. Can. J. Bot. 78, 1521–1530.

Hirata, T., Takamatsu, S., 1996. Nucleotide sequence diversity of rDNA internal transcribed

spacers extracted from conidia and cleistothecia of several powdery mildew fungi.

Mycoscience 37, 265–270.

Kimura, M., 1980. A simple method for estimating evolutionary rates of base substitutions

through comparative studies of nucleotide sequences. J. Mol. Evol. 16, 111–120.

Kusaba, M., Tsuge, T., 1995. Phylogeny of Alternaria fungi known to produce host-specific

toxins on the basis of variation in internal transcribed spacers of ribosomal DNA. Curr.

Genet. 28, 491–498.

Lyons-Weiler, J., Hoelzer, G.A., Tausch, R.J., 1998. Optimal outgroup analysis. Biol. J. Linn.

Soc. 64, 493–511.

Maddison, W.P., Maddison, D.R., 1992. MacClade: Analysis of Phylogeny and Character

Evolution. Sinauer Associates, Inc., Sunderland, MA, USA.

 Hirose et al.: Sawadadea phylogeny 21

Matsuda, S., Takamatsu, S., 2003. Evolution of host-parasite relationship of Golovinomyces

(Ascomycete: Erysiphales) inferred from nuclear rDNA sequences. Mol. Phylogenet.

Evol. 27, 314–327.

Milinkovitch, M.C., Lyons-Weiler, J., 1998. Findings optimal ingroup topologies and

convexities when the choice of outgroups is not obvious. Mol. Phylogenet. Evol. 9,

348–357.

Mori, Y., Sato, Y., Takamatsu, S. 2000. Evolutionary analysis of the powdery mildew fungi

using nucleotide sequences of the nuclear ribosomal DNA. Mycologia 92, 74–93.

Ogata, K., 1967. A sytematic study of the genus Acer. Bull. Tokyo Univ. Forests 63, 89–206.

Park, C.W., Oh, S.-H., Shin, H., 1993. Reexamination of vascular plants in Ullung Island,

Korea II: Taxonomic identity of Acer takeshimense Nakai (Aceraceae). Korean J. Pl.

Taxon. 23, 217–231.

Posada, D., Crandall, K.A., 1998. Modeltest: Testing the model of DNA substitution.

Bioinformatics 14, 817–818.

Suh, Y., Heo, K., Park, C.W., 2000. Phylogenetic relationships of maples (Acer L.;

Aceraceae) implied by nuclear ribosomal ITS sequences. J. Plant Res. 113, 193–202.

Swofford, D.L., 2001. PAUP: Phylogenetic Analysis Using Parsimony (and Other Methods)

4.0b8. Sinauer, Sunderland, MA, USA.

Takamatsu, S., 2004. Phylogeny and evolution of the powdery mildew fungi (Erysiphales,

Ascomycota) inferred from nuclear ribosomal DNA sequences. Mycoscience 45,

147–157.
 Hirose et al.: Sawadadea phylogeny 22

Takamatsu, S., Hirata, T., Sato, Y. 2000. A parasitic transition from trees to herbs occurred at

least twice in tribe Cystotheceae (Erysiphaceae): evidence from nuclear ribosomal DNA.

Mycol. Res. 104, 1304–1311.

Takamatsu, S., Kano, Y., 2001. PCR primers useful for nucleotide sequencing of rDNA of the

powdery mildew fungi. Mycoscience 42, 135–139.

Takamatsu, S., Matsuda, S., 2004. Estimation of molecular clocks for ITS and 28S rDNA in
Erysiphales. Mycoscience 45, 340–344.

Tanai, T., 1978. Taxonomical reinvestigation of the genus Acer L., based on vein architecture

of leaves. J. Jap. Bot. 53, 65–83.

Tiffney, B.H., 1985. The Eocene North Atrantic Land Bridge: its importance in Tertiary and

modern phytogeography of the Northern Hemisphere. J. Arnold Arbor. 66, 243-273.

Tiffney, B.H., Manchester, S.R., 2001. The use of geological and paleontological evidence in

evaluating plant phylogeographic hypotheses in the Northern Hemisphere Tertiary. Int. J.

Plant Sci. 162, S3–S17.

Walsh, P.S., Metzger, D.A., Higuchi, R., 1991. Chelex 100 as a medium for simple extraction

of DNA for PCR-based typing from forensic material. BioTechniques 10, 506–513.

White, T.J., Bruns, T.D., Lee, S., Taylor, J., 1990. Amplification and direct sequencing of

fungal ribosomal genes for phylogenetics. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J.,

White, T.J. (Eds.), PCR Protocols: a guide to methods and applications. Academic Press,

San Diego, California, USA, pp. 315–322.

Wolfe, J.A. 1981. Vicariance biogeography of angiosperms in relation to paleobotanical data.

In: Nelson, G., Rosen D.E. (Eds.), Vicariance Biogeography. Columbia University Press,

New York, USA, pp. 413–435.

 Hirose et al.: Sawadadea phylogeny 23

FIGURE LEGENDS

Fig. 1. Phylogenetic analysis of the domains D1 and D2 of the 28S rDNA sequences for ten

isolates of Sawadaea, 30 taxa of the Erysiphaceae covering all known tribes, and an outgroup

taxon. The tree is a phylogram of one of the 18 most parsimonious trees with 611 steps, which

was found using a heuristic search employing 100 times random stepwise addition option of

PAUP* treated gaps as missing data. The tree also has the highest likelihood of the 18 most

parsimonious trees, which was found by determining the log likelihood of all 18 trees.

Horizontal branch lengths are proportional to the number of nucleotide substitutions that were

inferred to have occurred along a particular branch of the tree. The bootstrap values of 1000

replications are shown on the respective branch. The consistency index (CI) is 0.4746; the

retention index (RI) is 0.7494; and the rescaled consistency index (RC) is 0.3557. The

respective tribes of the Erysiphaceae were shown in the right of the tree. Outgroups A, B, and

C were subjected to the RASA analysis to find appropriate outgroup taxa for phylogenetic

analysis of the genus Sawadaea using ITS sequences.

Fig. 2. Insertion/deletion (indel) found between sites 84 and 94 of the rDNA ITS1 region of

Sawadaea. The presence or absence of the indel is consistent within the respective clades.

Deletion events are likely to have occurred during the radiation of Sawadaea because none of

the outgroup taxa have deletions in this site.

Fig. 3. Phylogenetic analysis of the ITS sequences for 47 isolates of Sawadaea and two

outgroup taxa. The tree is a phylogram of one of the eight most parsimonious trees with 172
 Hirose et al.: Sawadadea phylogeny 24

steps, which was found using a heuristic search employing 100 times random stepwise

addition option of PAUP* treated gaps as the fifth character. The tree also has the highest

likelihood of the eight most parsimonious trees, which was found by determining the log

likelihood of all eight trees. Horizontal branch lengths are proportional to the number of

nucleotide substitutions that were inferred to have occurred along a particular branch of the

tree. The bootstrap values of 1000 replications are shown on the respective branch. The

consistency index (CI) is 0.7907; the retention index (RI) is 0.8925; and the rescaled

consistency index (RC) is 0.7057. The numbers adjacent to the right of the tree correspond to

the seven major clades of Sawadaea. ‘6 bp deletion’ and ‘4 bp deletion’ adjacent to the left of

the tree refer to the putative deletion events in ITS1 region occurred during the radiation of

Sawadaea.

Fig. 4. Branching order of the seven major clades of Sawadaea in MP trees with three

different gap treatments, and NJ and ML trees. The bootstrap values of 1000 replications are

shown on the respective branches. All five trees commonly support seven major clades of

Sawadaea, although branching order of the clades was different between trees. White triangle

and black triangle show 6 bp and 10 bp (4 bp in the MP tree with gap = fifth character)

deletion events occurred in the ITS1 region, respectively. Note that only the MP tree treated

gaps as the fifth character, but the other four trees, can explain the deletion events

parsimoniously.

Fig. 5. Estimated dates of divergence of major clades of Sawadaea based on the nucleotide

sequences of the rDNA ITS region and nucleotide substitution rate of Erysiphaceae (2.52 ×
 Hirose et al.: Sawadadea phylogeny 25

10-9 per site per year) reported by Takamatsu and Matsuda (2004). The numbers adjacent to

the right of the tree correspond to the seven major clades of Sawadaea. The shaded area

indicates the divergence time of the seven major clades of Sawadaea, suggesting that the

divergence occurred within 10 million years ago. myr, million years

Hirose et al.: Sawadadea phylogeny 1
Table 1. Host plants of the genus Sawadaea used in this study and sequence data base accession numbers
––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
Host Location of collection and voucher Date Fungal Data base ID No. c
b
species –––––––––––––––––––
ITS 28S
––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
Acer amoenum Hokkaido, Japan; TUAMH3148 a 10 Oct 1985 polyfida AB193374
a
A. amoenum var. matsumurae Niigata, Japan; MUMH486 23 Sep 1998 polyfida AB193358
A. amoenum var. matsumurae Niigata, Japan; MUMH483 a 22 Sep 1998 polyfida AB193381
A. argutum Nagano, Japan; MUMH1056 a 30 Sep 2000 sp. AB193367
a
A. argutum Tochigi, Japan; TUAMH3823 25 Sep 1987 sp. AB193375 AB193395
A. australe Mie, Japan; MUMH881 a 14 Nov 1999 sp. AB193384
A. buergerianum Aichi, Japan; MUMH1273 a 8 Jul 2001 sp. AB193389 AB193401
A. campestre Budapest, Hungary; MUMH688 a 8 Sep 1999 bicornis AB193362
A. campestre Sachsen-Anhaet, Germany; MUMH1061 a 25 Sep 1977 bicornis AB193378
A. campestre Kafanskij, Armenia; MUMH1062 a 17 Nov 1981 bicornis AB193379 AB193396
a
A. cissifolium Akita, Japan; TUAMH4792 5 Oct 1996 sp. AB193373 AB193394
A. crataegifolium Niigata, Japan; MUMH496 a 23 Sep 1998 tulasnei AB193359
A. crataegifolium Shiga, Japan; MUMH863 a 6 Nov 1999 tulasnei AB193364
a
A. crataegifolium Nagano, Japan; MUMH1058 1 Oct 2000 tulasnei AB193368
A. ginnala Nagano, Japan; TUAMH4609 a 28 Nov 1995 tulasnei AB193372
a
A. japonicum Fukui, Japan; MUMH1054 14 Oct 2000 polyfida AB193369 AB193393
A. micranthum Nagano, Japan; TUAMH3502 a 10 Oct 1986 sp. AB193371
A. mono var. ambiguum Niigata, Japan; MUMH300 a 19 Oct 1996 tulasnei AB193356
A. mono subsp. glaucum Niigata, Japan; MUMH194 a 19 Oct 1996 tulasnei AB193357
a
A. mono var. marmoratum Shiga, Japan; MUMH93 7 Nov 1994 tulasnei AB022367 d AB022366d
A. mono var. marmoratum Nagano, Japan; MUMH1057 a 30 Sep 2000 tulasnei AB193366
a
A. mono var. marmoratum Hokkaido, Japan; MUMHs112 2 Oct 1995 tulasnei AB193388 AB193400
A. mono var. marmoratum Kanagawa, Japan; TUAMH5785 a 4 Nov 1999 tulasnei AB193377
A. mono var. marmoratum Kagoshima, Japan; MUMH1051 a 27 Oct 2000 tulasnei AB193386 AB193399
a
A. mono var. mayrii Niigata, Japan; TUAMH4667 27 Oct 1995 tulasnei AB193376
A. negundo Mie, Japan; MUMH901 a 6 Jun 1999 sp. AB193353
a
A. negundo Marseille, France; MUMH609 28 Aug 1999 sp. AB193354 AB193392
A. negundo California, USA; UC1512313 sp. AF011313 d
Table 1. (Continue)
––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
Host Location of collection and voucher Date Fungal Data base ID No. c
b
species –––––––––––––––––––––––
ITS 28S
––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
A. negundo Australia; VPRI19684 sp. AF073356 d
a
A. negundo Bariloche, Argentina; MUMH2478 2 Mar 2004 sp. AB193350
A. nipponicum Niigata, Japan; TUAMH3450 a 9 Oct 1986 sp. AB193370
A. palmatum Mie, Japan; MUMH47 a 23 Sep 1994 polyfida AB000936 d AB022364 d
A. palmatum Ehime, Japan; MUMH551 a 9 Nov 1998 polyfida AB193382 AB193397
A. platanoides Budapest, Hungary; MUMH686 a 8 Sep 1999 tulasnei AB193361
A. platanoides Vilnius, Lithuania; MUMH737 a 9 Sep 1999 tulasnei AB193363
A. platanoides Ohio, USA; MUMH906 a 23 Oct 1999 tulasnei AB193385 AB193398
a
A. platanoides Hokkaido, Japan; MUMHs103 2 Oct 1995 sp. AB193387
A. platanoides Nyon, Swizerland; VPRI22170 bicornis AF298540 d
A. pseudoplatanus Canterbury, UK; MUMH904 a Oct 1999 bicornis AB193380
A. pseudoplatanus Bariloche, Argentina; MUMH2435 a 27 Feb 2004 sp. AB193351
A. rufinerve Mie, Japan; MUMH138 a 6 Sep 1996 sp. AB193355
a
A. shirasawanum Mie, Japan; MUMH4 23 Sep 1994 polyfida AB193352
A. sieboldianum Niigata, Japan; MUMH485 a 23 Sep 1998 polyfida AB193360
a
A. sieboldianum Shiga, Japan; MUMH891 7 Nov 1999 polyfida AB193365
A. tataricum Trakai, Lithuania; MUMH718 a 12 Sep 1999 sp. AB193383
a
Acer sp. Buffalo, USA; MUMH2343 27 Oct 2003 sp. AB193390
Acer sp. Montreal, Canada; MUMH2422 a Jul 2003 sp. AB193391
–––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
a
Herbarium specimens at the following herbaria: MUMH, Mie University Mycological Herbarium; TUAMH, Tokyo University of Agriculture
Mycological Herbarium.
b
Fungal species were identified based on the teleomorphic characters when they were available. Otherwise, they were tentatively identified by host
plants based on the monograph of Braun (1987).
c
The nucleotide sequence data will appear in the DDBJ, EMBL, and GenBank Database under the respective accession number.
d
Sequences obtained from DNA databeses.
 Brasiliomyces trina AB022350
Erysiphe simulans AB022395
Erysiphe gracilis AB022357
65
Erysiphe mori AB022418
Typhulochaeta japonica AB022415
Erysiphe glycines AB022397
87
81 Erysiphe heraclei AB022391
Erysipheae
68 Erysiphe friesii AB022382
61 91 Erysiphe pulchra AB022389
Erysiphe aquilegiae AB022405
Erysiphe adunca AB022374
80 Golovinomyces cichoracearum AB022360
78 Golovinomyces orontii AB022412
56 Arthrocladiella mougeotii AB022379 Golovinomyceteae
Neoerysiphe galeopsidis AB022369
78 Erysiphe australiana AB022407
91 Phyllactinia moricola AB022401
98 Phyllactinia kakicola AB022372
51 Leveillula taurica AB022387 Phyllactinieae
Pleochaeta shiraiana AB022403
Sawadaea polyfida ex A. japonicum
Sawadaea sp. ex A. cissifolium
51 Sawadaea sp. ex A. argutum
Sawadaea polyfida ex A. palmatum
84 Sawadaea tulasnei ex A. mono var. marmoratum
60
Sawadaea tulasnei ex A. mono var. marmoratum
Sawadaea sp. ex A. negundo
97 Sawadaea bicornis ex A. campestre
85 Sawadaea tulasnei ex A. platanoides
Sawadaea sp. ex A. buergerianum Cystotheceae
99 Cystotheca wrightii AB022355
99 Cystotheca lanestris AB022353 Outgroup C
97 Podosphaera longiseta AB022423
71 Podosphaera tridactyla AB022393
98 Podosphaera xanthii AB022410 Outgroup B
83
90 Podosphaera pannosa AB022347
Podosphaera filipendulae AB022384 Outgroup A
55 Blumeria graminis f. sp. hordei AB022399
100 Blumeria graminis f. sp. tritici AB022376 Blumerieae
Blumeria graminis f. sp. bromi AB022362
Byssoascus striatosporus U17912
5 changes
　
 [ 80 90 100]
[ . . .]
Sawadaea Clade1 CTGCTCTGGCGGG----------CCTGCT
Sawadaea Clade2 CTGCTCTGGCGGG----------CCTGCC
Sawadaea Clade3 TTGCCCTGGCGG-----------CCTGCC
Sawadaea Clade4 CTCCTCTGGGGGGCCA------ACCTGCC
Sawadaea Clade5 CTGCTCTGGTGGGCCAGGCTCGACCTGCC
Sawadaea Clade6 CTACTTTGGCGGGCCGGGCTCGACCTACC
Sawadaea Clade7 CTACTTTGGCGGGCCAGGCTCGACCTACC
Podosphaera xanthii TTGCTTTGGCGGGCCGGGCTCGACCTGCC
P. tridactyla TTGCTTTGGCGGGCCGGGCTCGACCTGCC
P. pannosa TTGCTTTGGCGGGCCGGGCTCGACCTACC
P. filipendulae TTGCTTTGGCGGGCCGGGCTCGACCTACC
Cystotheca wrightii TTGCTTTGGCGGGCCGGGCCCTGTGCCCT
C. lanestris TTGCTTTGGCGGGCCGGGCCGCGTGCCCT
 62 Sawadaea sp. ex A. rufinerve JPN
62 S. tulasnei ex A. crataegifolium JPN
66 S. tulasnei ex A. crataegifolium JPN
S. tulasnei ex A. crataegifolium JPN
S. tulasnei ex A. ginnala JPN
S. tulasnei ex A. mono var. marmoratum JPN
Sawadaea sp. ex A. negundo JPN
S. tulasnei ex A. mono var. ambiguum JPN
97 S. tulasnei ex A. mono var. marmoratum JPN 1 East Asia
S. tulasnei ex A. mono subsp. glaucum JPN
Sawadaea sp. ex A. nipponicum JPN
S. tulasnei ex A. mono var. mayrii JPN
S. tulasnei ex A. mono var. marmoratum JPN
S. tulasnei ex A. mono var. marmoratum JPN
72 Sawadaea sp. ex A. platanoides JPN
S. tulasnei ex A. mono var. marmoratum JPN
4 base deletion S. tulasnei ex A. platanoides LIT

▼ 53
S. tulasnei ex A. platanoides HUN
Sawadaea sp. ex Acer sp. CAN
6 base deletion 81 Sawadaea sp. ex Acer sp. USA 2 Global
▼ 70 S. tulasnei ex A. platanoides USA
Sawadaea sp. ex A. tataricum LIT
Sawadaea sp. ex A. buergerianum JPN
100 Sawadaea sp. ex A. argutum JPN
3
Sawadaea sp. ex A. argutum JPN 4 East Asia
88 S. polyfida ex A. shirasawanum JPN
S. polyfida ex A. japonicum JPN
66 S. polyfida ex A. palmatum JPN
S. polyfida ex A. sieboldianum JPN
S. polyfida ex A. sieboldianum JPN
76 S. polyfida ex A. amoenum var. matsumurae JPN
S. polyfida ex A. amoenum var. matsumurae JPN
5 East Asia
S. polyfida ex Acer amoenum JPN
84 Sawadaea sp. ex A. micranthum JPN
100 S. polyfida ex A. palmatum JPN
Sawadaea sp. ex A. australe JPN
Sawadaea sp. ex A. cissifolium JPN
Sawadaea sp. ex A. negundo FRA
Sawadaea sp. ex A. negundo ARG
65 Sawadaea sp. ex A. pseudoplatanus ARG
S. bicornis ex A. pseudoplatanus UK 6 Global
Sawadaea sp. ex A. negundo AUST
78 Sawadaea sp. ex A. negundo USA
63 S. bicornis ex A. campestre HUN
S. bicornis ex A. campestre GER
83 S. bicornis ex A. campestre ARM 7 Global
S. bicornis ex A. platanoides SWI
Podosphaera tridactyla AB000943
P. xanthii D84387

10 changes
 ▼ ▼
90 85
Clade 1 Clade 1
61
Clade 5 Clade 5
▼ 86 Clade 2 ▼91 Clade 2
69 ▽ 100
Clade 6 Clade 4
83 77
Clade 7 67 Clade 6
▽ 99 Clade 4 69
Clade 7
▼ ▼ Clade 3
Clade 3
Outgroup Outgroup
MP (gap=missing) NJ (Tamura-Nei model)

97
▼
Clade 1 90
Clade 1
▼ 72 81 76
60
53 Clade 2 67 Clade 5
▽
70 ▼86
Clade 3 Clade 2
66 100
Clade 4 99 Clade 6
73
84 64
Clade 5 Clade 7
65 ▽
78 Clade 6 Clade 4
83 ▼
Clade 7 Clade 3
Outgroup Outgroup
MP (gap=5th character) ML (HKY85 model)
▼
94
Clade 1
59
Clade 5
▼ 87 Clade 2
▼
Clade 3
▽ 100
Clade 4
77
92 Clade 6
71
Clade 7
Outgroup
MP (indel code)
0.08 0.07 0.06 0.05 0.04 0.03 0.02 0.01 0 Distance

Clade
1

2
4
6
7
Outgroup
Geological
Oligocene Miocene Pliocene Epock
30 25 20 15 10 5 0 Time (myr)