Toxicology in Vitro 29 (2015) 1492–1502

Contents lists available at ScienceDirect

Toxicology in Vitro
journal homepage: www.elsevier.com/locate/toxinvit

Magnetite nanoparticles induced adaptive mechanisms counteract

cell death in human pulmonary fibroblasts
Mihaela Radu a,b, Diana Dinu a, Cornelia Sima c, Radu Burlacu d, Anca Hermenean b,e, Aurel Ardelean e,
Anca Dinischiotu a,⇑
a
Department of Biochemistry and Molecular Biology, University of Bucharest, 91-95 Splaiul Independentei, Bucharest 050095, Romania
b
Department of Histology, Faculty of Medicine, Pharmacy and Dentistry, Vasile Goldis Western University of Arad, 1 Feleacului, Arad 310396, Romania
c
Laser Department, National Institute of Laser, Plasma and Radiation Physics, 409 Atomistilor, Bucharest-Magurele 077125, Romania
d
Department of Mathematics, University of Agriculture Sciences and Veterinary Medicine, 59 Marasti, Bucharest 011464, Romania
e
Department of Experimental and Applied Biology, Institute of Life Sciences, Vasile Goldis Western University of Arad, 86 Rebreanu, Arad 310414, Romania

a r t i c l e i n f o a b s t r a c t

Article history: Magnetite nanoparticles (MNP) have attracted great interest for biomedical applications due to their
Received 21 November 2014 unique chemical and physical properties, but the MNP impact on human health is not fully known.
Revised 28 May 2015 Consequently, our study proposes to highlight the biochemical mechanisms that underline the toxic
Accepted 4 June 2015
effects of MNP on a human lung fibroblast cell line (MRC-5). The cytotoxicity generated by MNP in
Available online 9 June 2015
MRC-5 cells was dose and time-dependent. MNP-treated MRC-5 cells accumulated large amount of iron
and reactive oxygen species (ROS) and exhibited elevated antioxidant scavenger enzymes. Reduced
Keywords:
glutathione (GSH) depletion and enhanced lipid peroxidation (LPO) processes were also observed. The
Magnetite nanoparticles
MRC-5 cells
cellular capacity to counteract the oxidative damage was sustained by high levels of heat shock protein
Oxidative stress 60 (Hsp60), a protein that confers resistance against ROS attack and inhibition of cell death. While signif-
Hsp60 icant augmentations in nitric oxide (NO) and prostaglandine E2 (PGE2) levels were detected after 72 h of
PGE2 MNP-exposure only, caspase-1 was activated earlier starting with 24 h post-treatment. Taken together,
Caspase-1 our results suggest that MRC-5 cells have the capacity to develop cell protection mechanisms against
MNP. Detailed knowledge of the mechanisms induced by MNP in cell culture could be essential for their
prospective use in various in vivo biochemical applications.
Ó 2015 Published by Elsevier Ltd.

1. Introduction processes. Cellular alterations induced by NPs can be associated

Currently, living organisms are constantly exposed to naturally
occurring, anthropogenic or engineered nanoparticles (NPs). The
skin, as well as the respiratory and gastrointestinal tracts are entry
points for these particles in organisms. NPs, which have at least
one dimension smaller than one micrometer, can interfere with
cellular function to influence proliferation, metabolism and death
Abbreviations: MNP, magnetite nanoparticles; MRC-5, human lung fibroblast
cell line; ROS, reactive oxygen species; GSH, reduced glutathione; LPO, lipid
peroxidation; Hsp60, heat shock protein 60; NO, nitric oxide; PGE2, prostaglandine
E2; MRI, magnetic resonance imaging; SOD, superoxide dismutase; CAT, catalase;
GPX, glutathione peroxidase; GR, glutathione reductase; HRTEM, high resolution
transmission electron microscopy; SAED, selected area electron diffraction; XRD, X
ray diffraction; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bro-
mide; H2DCFDA, 20 ,70 -dichlorodihydrofluorescein diacetate; DCF, dichlorofluores-
cein; GST, glutathione S-transferase.
⇑ Corresponding author.
E-mail addresses: ancadinischiotu@yahoo.com, anca.dinischiotu@bio.unibuc.ro
(A. Dinischiotu).
with diseases such as cancer and degenerative pathologies. The
toxicity of NPs depends on various factors, including: size, compo-
sition, crystallinity, surface functionalization, surface charge,
aggregation, and solubility, but also the individual’s genetic traits
that can provide or not the capacity to counteract the effects of
these particles (Buzea et al., 2007).
Magnetite nanoparticles (MNP) are abundant constituents of
the ambient airborne particulate matter in the urban environment,
resulting especially from traffic, industry and power stations emis-
sions (Grobéty et al., 2010; Karlsson et al., 2008). Furthermore,
mixed magnetite–maghemite nanoparticles are potentially adsor-
bents for arsenic and chromium which could facilitate their
removal from contaminated water (Chowdhury and Yanful, 2010).
MNP are of special interest in biological and medical sciences
due to their superior biocompatibility compared to other magnetic
materials, their chemical stability in physiological media, and
because they are easy and inexpensive to synthesize (Figuerola
et al., 2010). As a result, the synthesis of MNP has rapidly

http://dx.doi.org/10.1016/j.tiv.2015.06.002
0887-2333/Ó 2015 Published by Elsevier Ltd.
 M. Radu et al. / Toxicology in Vitro 29 (2015) 1492–1502
developed over the last few years for fundamental biomedical
applications; their varied uses include that of contrast agents for
magnetic resonance imaging (MRI) (Maity et al., 2010), heating
mediators for cancer therapy (Ito et al., 2007), as well as in vitro cell
sorting and magnetically guided drug delivery (Lin et al., 2007). In
addition, the ability of magnetite to combine both therapeutic and
diagnostic functions into one nanoparticle has attracted great
interest for its potential theranostic applications (Shaw et al.,
2008). Beside medical applications, ferrofluids containing MNP
are also used in electronic devices, mechanical engineering, analyt-
ical instrumentation, heat transfer and art.
The principal route for MNP absorption inside the human body
is respiration. Once inside, MNP translocate to the circulatory and
lymphatic systems first, subsequently reaching tissues and organs.
Depending on particle size, inhaled nanoparticles can be deposited
throughout the human respiratory system including pharyngeal,
nasal, tracheobronchial and alveolar regions (Price et al., 2002).
As the use of NPs has increased significantly, research aimed at
uncovering the potential risks to human health is mandatory.
Understanding and controlling the interaction between MNP and
biomolecules at the molecular and cellular level is crucial for suc-
cessfully designing MNP for potentially novel biological
applications.
Despite the extensive use of MNP, the studies published to date
regarding their toxicity are inconsistent. Both in vitro and in vivo
studies have demonstrated that the presence of MNP can exert
lower toxic effects than those established for molecular iron
(Pisanic et al., 2009), with some reports highlighting a low toxicity
for MNP at doses of 100 lg/mL or higher (Ankamwar et al., 2010).
By contrast, other studies have coupled the exposure to MNP to
notable toxic effects such as: inflammation, the formation of
apoptotic bodies, impaired mitochondrial function, membrane
integrity alteration, generation of reactive oxygen species (ROS),
and chromosome condensation (Park et al., 2010; Ramesh et al.,
2012). In addition, it was demonstrated recently that magnetite
deposition in rat lungs caused goblet cell hyper- and/or metaplasia
in the upper respiratory tract, increased lung and
lung-associated-lymph node weights and induced inflammatory
changes in the bronchiolo-alveolar region (Pauluhn, 2012).
Finally, ROS formation in the human alveolar epithelial-like
type-II cells could also contribute to MNP-induced genotoxicity
(Könczöl et al., 2011).
Oxidative stress and ROS formation has been considered as an
important mechanism responsible for MNP-induced toxicity
(Singh et al., 2010). After the intracellular uptake via different
mechanisms such as: receptor-mediated endocytosis,
caveolin-mediated internalization, and macropynocitosis, MNP
may presumably release iron ions within lysosomes in the pres-
ence of hydrolyzing enzymes effective at low pH values. Iron, being
a highly redox-active transition metal, can be involved in the
Fenton reaction producing high reactive hydroxyl radicals that
can probably attack lipids, DNA and proteins (Halliwell and
Gutteridge, 2007). In response, cells have developed several cellu-
lar defense pathways, which under normal metabolic conditions
regulate the level of ROS and protect against the damage generated
by free radicals. These defense systems include both
low-molecular-weight free radical scavengers, such as the tripep-
tide glutathione (GSH), and antioxidant enzymes, i.e. superoxide
dismutase (SOD), catalase (CAT), glutathione peroxidase (GPX),
and glutathione reductase (GR) (Kehrer, 1993).
Cell survival during stress requires the induction of the heat
shock response. Production of high levels of heat shock proteins
(Hsp) can be triggered by exposure to different environmental
stress conditions, such as an increase in temperature, the presence
of environmental pollutants, free radicals, and so forth (Santoro,
2000). Thus, defining the interlinks between oxidative stress and
1493
cell death following MNP exposure may be a necessary step to
characterize the effects of these nanoparticles on living cells.
Despite the great potential of MNP in biology and medicine, the
mechanisms by which they can induce toxicity in human cells has
not been completely elucidated. The present study was, therefore,
undertaken in order to investigate the MNP biological effects on
human lung fibroblasts (MRC-5). Mechanisms of induced oxidative
stress and its effects on various enzymatic and non-enzymatic
antioxidants, as well as the modulation of Hsp60 proteins expres-
sion, nitric oxide (NO), prostaglandin E2 (PGE2) and caspase-1
release were investigated.
2. Materials and methods
2.1. Chemicals
GIBCOÒ Modified Eagle’s Medium (MEM), fetal bovine serum,
phosphate buffered saline (PBS), Trizol reagent and the Western
Breeze Chromogenic Kit-Anti-Mouse were purchased from
Invitrogen (Carlsbad, California, USA). Nicotinamide adenine
dinucleotide phosphate disodium salt (NADP+) and nicotinamide
adenine dinucleotide phosphate reduced tetrasodium salt
(NADPH) were supplied by Merck (Darmstadt, Germany).
Tetramethoxypropane (TEP) and thiobarbituric acid (TBA) were
obtained from Fluka (Milwaukee, USA). The Detect XÒ
Glutathione Colorimetric Detection Kit was purchased from Arbor
Assay (Michigan, USA). Antibodies for HSP 60 and b-actin were
purchased from Santa Cruz Biotechnology (Santa Cruz, CA). All
other chemicals used were of analytical grade and were from
Sigma (St. Louis, Missouri, USA).
2.2. Nanoparticles
MNP were provided by NaBond Technologies Co., Ltd, China.
They have been characterized from the morpho-structural and size
distribution point of view using high resolution transmission elec-
tron microscopy (HRTEM, Philips CM120 model), selected area
electron diffraction (SAED) and X ray diffraction (XRD,
Bruker-AXS D8 ADVANCE).
2.3. Cell culture conditions and treatment
MRC-5 (purchased from the American Type Culture Collection)
is a fibroblast cell line derived from the normal lung tissue of a
14-week-old male and was chosen for this study due to its previ-
ously demonstrated suitability for NP toxicity studies (Li et al.,
2010; Radu et al., 2010). The cells were cultured in minimum
essential medium (MEM) supplemented with 1% antibiotic antimy-
cotic solution (mixture of penicillin, streptomycin and ampho-
tericin B) and 10% fetal bovine serum at 37 °C in a 5% CO2
humidified atmosphere. They were seeded at a density of
7.5  105 cells/75 cm2 flask. The culture medium was changed
every 3 days. All the experiments were carried out with cells
between passage number 11 and 20. The suspension of MNP was
sterilized and sonicated before the cell culture treatment. The cells
were incubated with nanoparticles for 24, 48 and 72 h. Controls
without MNP were performed for each experiment.
2.4. Cell viability/cytotoxicity
The viability of the cells was determined by the tetrazolium salt
test (Mosmann, 1983). The medium from each well was removed
by aspiration, the cells were washed with 200 lL of PBS/well and
then a volume of 50 lL (1 mg/mL) of 3-(4,5-dimethylthiazo
l-2-yl)-2,5-diphenyltetrazolium bromide (MTT) solution was
1494 M. Radu et al. / Toxicology in Vitro 29 (2015) 1492–1502
added to each well. After 2 h of incubation, the MTT solution from
each well was removed by aspiration. A volume of 50 lL iso-
propanol was added and the plate was shaken to dissolve the for-
mazan crystals. The absorbance at 595 nm was then determined
using a Tecan multiplate reader (TecanGENios, Grödic, Germany),
for each well. The absorbance for untreated cells was taken to rep-
resent the 100% viability.
2.5. Intracellular iron determination
The level of intracellular iron was measured according to the
Zhu assay (Zhu et al., 2012). Briefly, after treatment with MNP, cells
were washed with phosphate-buffered saline (PBS), collected and
counted. Subsequently, the cell pellet was digested in a volume
of 200 ll of 5 N HCl for 24 h at 37 °C. After centrifugation at
2000 rpm, for 10 min, a volume of 50 lL of supernatant was added
into a 96-well plate and then 50 lL of solution of 1% ammonium
persulfate were added to convert the ferrous ions to ferric ones.
Finally, a volume of 100 lL of 0.5 M potassium thiocyanate was
added in the solution and the mix was shaken for 5 min in order
to develop the red colored iron-thiocyanate. The formed complexes
were spectrophotometrically detected at 480 nm. A standard curve
for iron was made under identical conditions using known amount
of iron salts.
2.6. Determination of intracellular ROS
A spectrofluorimetric procedure has been used to identify ROS
in MRC-5 cells by utilizing the dye 20 ,70 -dichlorodihydrofluorescein
diacetate (H2DCFDA) (Wan et al., 1993). After treatment with
12.5 lg/mL MNP, the cells were immediately incubated with
10 lM H2DCFDA in the dark at 37 °C for 30 min. The cells were
washed twice and suspended in 2 mL of PBS solution. The fluores-
cence of dichlorofluorescein (DCF) was spectrofluorimetrically
recorded at kex 488 nm/kem 515 nm in each sample.
2.7. Antioxidant enzymes activities assays
MRC-5 cells, harvested from culture flasks, were washed with
PBS three times, trypsinized, and centrifuged at 1500 rpm for
10 min at 4 °C. Cell pellets were resuspended in 0.3 mL of PBS
and then sonicated on ice three times, for 30 s each. The total
extract was centrifuged at 5000 rpm for 10 min at 4 °C. Aliquots
of the supernatant were used for the biochemical assays. The pro-
tein concentration, expressed as mg/mL, was determinated by the
Bradford method, using bovine serum albumine as standard
(Bradford, 1976).
SOD activity was measured following the oxidation of NADPH at
340 nm (Paoletti et al., 1986). Superoxide anions were generated
from oxygen molecules in the presence of EDTA, MnCl2 and mer-
captoethanol. A control was run with each set of three duplicate
samples. One unit of activity was defined as the amount of enzyme
required to inhibit the rate of NADPH oxidation of the control by
50%.
CAT activity was assayed by monitoring the disappearance of
H2O2 at 240 nm, according to the Aebi method (1984). CAT activity
was calculated in terms of U/mg protein, where one unit was the
amount of enzyme that catalyzed the conversion of one lmole
H2O2 in a minute.
GPX was assayed by the Beutler (1971) method, using H2O2 and
NADPH as substrates. The conversion of NADPH to NADP+ was fol-
lowed by recording the changes in absorption intensity at 340 nm,
and one unit was expressed as one lmole of NADPH consumed per
minute, using a molar extinction coefficient of
6.22  103 M1 cm1.
The glutathione S-transferase (GST) activity was assayed
spectrophotometrically at 340 nm by measuring the rate of
1-chloro-2,4-dinitrobenzene (CDNB) conjugation with GSH,
according to the Habig et al. method (1974). One unit of GST activ-
ity was expressed as one lmole of conjugated product per minute.
The CDNB extinction coefficient of 9.6 mM1 cm1 was used for the
calculation.
GR activity was measured according to the method of Goldberg
and Spooner (1983), in 0.1 M phosphate buffer, pH 7.4 with
0.66 mM GSSG and 0.1 mM NADPH by recording the decrease of
absorbance at 340 nm. One unit of GR activity was defined as
one lmole of NADPH per minute under standard conditions.
All the enzymatic activities, calculated as specific activities
(U/mg of protein), were expressed as% from controls.
2.8. Lipid peroxidation assay
Malondialdehyde (MDA), a marker for lipid peroxidation, was
assayed via the thiobarbituric acid reaction according to
Dinischiotu et al. (2013). A volume of 200 lL of sample with a pro-
tein concentration of 2 mg/mL was treated with 700 lL 0.1 N HCl
and the mixture was incubated for 20 min at room temperature.
Then, 900 lL of 0.025 M thiobarbituric acid (TBA) were added
and the total volume was incubated for 65 min at 37 °C. Finally, a
volume of 400 lL of 0.1 M Tris–HCl, 5 mM EDTA buffer, pH 7.4
was added. The fluorescence of MDA was recorded using a
520 nm/549 nm (excitation/emission) filter. A calibration curve
with 1,1,3,3-tetramethoxy propane in the range 0.05–5 lM was
used to calculate the MDA concentration. The results were
expressed as nmoles of MDA/mg protein.
2.9. Reduced glutathione determination
The cellular lysate, deproteinized with 5% sulfosalicylic acid,
was analyzed for total glutathione and oxidized glutathione
(GSSG) using the Detect XÒ Glutathione colorimetric detection kit
and following manufacturer’s instructions. The reduced glu-
tathione (GSH) concentration was obtained by subtracting the
GSSG level from the total glutathione concentration. The GSH
levels were calculated as nmoles/mg protein.
2.10. Western blotting
Samples (25 lg protein) were run on 10% sodium dodecyl sul-
fate polyacrylamide (SDS–PAGE) gels, using the Mini-Protean 3
system (Bio Rad Laboratories, Hercules, CA, USA), for Hsp60 detec-
tion. The protein bands were electro-blotted on PVDF membranes,
using the Mini Trans-Blot system (Bio Rad Laboratories, Hercules,
CA, USA). Membranes were maintained for 30 min in blocking
solution, washed for 5 min in MiliQ water and incubated for one
hour with the primary antibodies for Hsp60. After rinsing three
times with antibody wash solution the membrane was developed
with Western Breeze Chromogenic Immunodetection Kit using
5-bromo-4-chloro-3-indolyl-1-phosphate (BCIP)/nitro blue tetra-
zolium (NBT) substrate for alkaline phosphatase. Beta-actin
protein (42 kDa) was used as an internal standard. The blots were
captured and quantified using BioCapt MW and ImageJ analysis
software. The values for each band were normalized to b-actin.
2.11. Quantitative RT-PCR
Total RNA was extracted from MRC-5 cells using Trizol reagent
according to the manufacturer’s instructions. RNA samples were
dissolved in diethylpyrocarbonate (DEPC)-treated water and the
RNA concentration in each sample was determined by spectropho-
tometry. One lg of each sample of total RNA was
 M. Radu et al. / Toxicology in Vitro 29 (2015) 1492–1502
Table 1
Primer sets for RT-PCR analysis.
Gene name Primer sequence (50 –30 )
GAPDH Forward: GCCATCAGGTCACATACACG
Reverse: GATACACGGAGCACCAGGTT
hsp60 Forward: GTGGAAAAAGGAATCATTGACC
Reverse: GTAGTTAACAGAGAGGCCACACC
reverse-transcripted into cDNA using the complementary DNA
synthesis kit M-MLV RT, in a total volume of 25 lL. The samples
were incubated for 5 min at 25 °C, 45 min at 42 °C, 10 min at
95 °C and then chilled on ice. For real-time PCR, a volume of 1 lL
of hsp60 cDNA was amplified in 1 iQ SYBR Green Supermix con-
taining specific primer pairs (Table 1), using the iCycleriQ
Real-Time PCR Detection System (Biorad), at a final volume of
25 lL. PCR parameters were: an initial step for denaturation at
95 °C for 3 min followed by 45 cycles at 95 °C for 30 s, anneal/ex-
tend at 58 °C for 30 s followed by final extension at 72 °C for
30 s. Following amplification, melting curves were generated to
confirm the specificity of each primer pair with 85 cycles of
increasing increments of 0.5 °C beginning with 55 °C for 10 s. The
samples were performed in triplicate and the
glyceraldehydes-3-phosphate dehydrogenase (GAPDH) mRNA
was used for normalizing the hsp60 mRNA levels.
2.12. Caspase-1 activity assay
The activity of caspase-1, that recognizes the sequence YVAD,
was assessed using the Caspase-1/ICE Colorimetric Protease
Assay Kit provided by BioVision. The assay was done by spec-
trophotometric detection of the chromophore p-nitroanilide
(pNA) after cleavage from the labeled substrate YVAD-pNA at
405 nm according to supplier’s instructions.
2.13. Nitric oxide determination
NO concentration was measured by the Green assay (Green
et al., 1982). In this method, nitrite is first treated with a diazotiz-
ing reagent, e.g., sulfanilamide (SA), in acidic media to form a tran-
sient diazonium salt. This intermediate is then allowed to react
with a coupling reagent, N-naphthyl-ethylenediamine (NED), to
form a stable azo compound, measured spectrophotometrically at
550 nm. Thus, volumes of 80 lL of culture supernatant were added
to a microplate and mixed with a 1:1 solution of 10% NED and SA.
Then intensity of the developed color was measured spectrophoto-
metrically at a wavelength of 550 nm. A standard curve with differ-
ent concentrations of sodium nitrate was also performed. The NO
concentrations were expressed in lM.
2.14. Prostaglandin E2 immunoassay
PGE2 production was determined with a competitive
immunoassay using the Human PGE2 kit (Invitrogen, California,
US) according to the manufacturer’s instructions. Briefly,
PGE2-alkaline phosphatase tracer, PGE2-specific monoclonal anti-
body and either standard or sample (culture supernatants) were
added to each well of an 96-well microtiter plate pre-coated with
goat polyclonal anti-mouse IgG. After incubation for 2 h at room
temperature, the plate was washed and a solution of para-nitro-
phenyl phosphate (pNPP), as substrate for alkaline phosphatase
was added. The amount of yellow product formed in this enzy-
matic reaction was read at 405 nm, allowing quantification of
PGE2 in each sample. The PGE2 concentration was expressed in
pg/mL.
1495
2.15. Annexin-V/PI double-staining assay
After exposure to MNP, MRC-5 cells were harvested, washed,
and resuspended in ice cold PBS. Apoptotic cells were determined
with an FITC Annexin-V Apoptosis Detection Kit (Invitrogen,
California, USA) according to the manufacturer’s protocol. Briefly,
the cells were centrifuged and subsequently incubated in the dark,
for 15 min, with 100 lL of binding buffer containing 5 lL of
Annexin V-FITC and 5 lL of propidium iodide (PI). Afterwards,
apoptosis was analyzed by fluorescence microscopy (Olympus
IX7 with U-RFL-T power supply unit).
2.16. DNA integrity assay
In order to check DNA integrity, 2  106 cells were incubated in
digestion buffer [100 mM NaCl, 10 mM Tris–HCl (pH 8), 25 mM
EDTA (pH 8), 0.5% SDS, 0.1 mg/mL proteinase K] at 50 °C for 3 h
with gentle agitation. To eliminate the RNA contamination, the
solution was incubated 1 h with 2 mg/mL RNase A at 37 °C. The
DNA from each sample was purified by phenol/chloroform/isoamyl
alcohol (25:24:1) extraction, and then centrifuged at 10,000 rpm
for 5 min. The supernatant containing DNA was transferred to a
clean tube and mixed with a half volume of 7.5 M ammonium
acetate and 2 volumes of cold 100% ethanol. The precipitate was
centrifuged at 10,000 rpm for 3 min and the pellet was washed
with 70% ethanol, dried and dissolved in 50 lL of TE buffer
[10 mM Tris–HCl (pH 8), 1 mM EDTA]. The DNA samples thus
obtained were electrophoretically separated on a 1% agarose gel
at 80 V for 60 min. Subsequently, the gels were stained with ethid-
ium bromide and visualized under UV light.
2.17. Statistical analysis
Data were expressed in terms of mean ± standard deviation
(SD) of triplicate measurements for five independent experiments.
The results were compared using Student’s t-test and validated by
confidence intervals using the Quattro Pro X3 software. The results
were considered significant only if the P value was less than 0.05
and the confidence interval of control and treated cells samples
did not overlap (a = 0.05).
3. Results
3.1. MNP characteristics
Nanoparticle crystallinity is demonstrated by the XRD pattern
(Fig. 1) and the SAED image (Fig. 2C). The peaks representing mag-
netite in the crystalline phase can be observed in the XRD diagram
(Fig. 1).
Fig. 1. XRD of MNP.
1496 M. Radu et al. / Toxicology in Vitro 29 (2015) 1492–1502

Fig. 2. HRTEM (A and B) and SAED (C) of MNP.

Fig. 4. Viability of MRC-cells following exposure to 2.5, 6.25 and 12.5 lg/mL MNP.
The values are calculated as means ± SD (n = 5) and expressed as % from controls.
⁄
P < 0.05 vs. controls.

Fig. 3. Size distribution of MNP.

The HRTEM images (Fig. 2) revealed that MNP have a rectangu-

lar shape.
The size distribution of MNP is shown in Fig. 3. This was inves-
tigated by performing a statistical assessment of the electron
microscopy images. The primary nanoparticle size is in the range
of 20–180 nm with the arithmetic mean value of approximately
50 nm. The size distribution is a lognormal function.

3.2. Cell viability

Fig. 5. Iron concentration in 12.5 lg/mL MNP treated-MRC-5 cells. Values are
The effects of MNP exposure on MRC-5 cells viability was dose calculated as means ± SD (n = 5). ⁄P < 0.05 vs. controls; ⁄⁄P < 0.01 vs. controls;
⁄⁄⁄
and time-dependent (Fig. 4). Incubation with doses of 2.5, 6.25 and P < 0.001 vs. controls.

12.5 lg/mL of MNP (corresponding to 1.81, 4.525 and 9.051 lg

iron/mL) for 24 and 48 h had no significant effect on viability.
Nevertheless, after 72 h exposure at all three doses, significant
and moderate decreases of cell viability were registered. Taking
into account these data, the MNP concentration used in subsequent
experiments was 12.5 lg/mL.
11.91 ± 1.1 pg/cell for MNP incubation times of 24 h, 48 h and
72 h, respectively. Control samples of MNP untreated cells con-
tained close to 0.2 pg of iron per cell.

3.3. Intracellular iron concentration 3.4. ROS generation

The time-dependent changes in the iron level recorded for the
MRC-5 cells exposed to 12.5 lg/mL MNP are illustrated in Fig. 5.
Significant increases in iron concentration were detected for all
durations of MNP treatment. To be more specific, the iron accumu-
lated in our cell line was 9.59 ± 0.8 pg/cell, 10.5 ± 0.9 pg/cell and
A significant increase in ROS levels was observed for MRC-5
cells treated with for 12.5 lg/mL MNP starting with 48 h of expo-
sure, when the level increased by 52% compared to control. For
longer periods of exposure, the ROS levels remained
up-regulated, but to a lesser extent (Fig. 6).
 M. Radu et al. / Toxicology in Vitro 29 (2015) 1492–1502
Fig. 6. ROS production induced by 12.5 lg/mL MNP in MRC-5 cells. Values are
calculated as means ± SD (n = 5) expressed as % from controls. ⁄P < 0.05 vs. controls.
3.5. Antioxidant enzymes activity
Fig. 7 shows the effects of 12.5 lg/mL MNP administration on
the activities of the antioxidant enzymes SOD (7A), CAT (7B) and
GPX (7C), as well as the activities of two enzymes involved in glu-
tathione metabolism, i.e. GST (7D) and GR (7E). An increase of SOD
and CAT activities was observed starting with the second day of
MNP treatment (Fig. 7A and B), while GPX was activated after only
72 h of nanoparticles exposure (Fig. 7C). The SOD activity increased
Fig. 7. Effects of 12.5 lg/mL MNP administration on SOD (A), CAT (B), GPX (C), GST (D) and GR (E) activities in MRC-5 cells. Values are calculated as means ± SD (n = 5) and
expressed as % from controls. ⁄P < 0.05 vs. controls.
1497
by 11.7% and 38% after 48 and 72 h of treatment, respectively,
whereas CAT activity showed an increase by 9.5% and 16.9% for
the same periods of treatment. The activity of GPX was raised by
22.7% after 72 h of MNP administration. GST activity remained
unchanged after 12.5 lg/mL MNP treatment, whereas a decrease
in GR activity, by 33.2%, was recorded after 72 h of MNP
administration.
3.6. Lipid peroxidation and glutathione concentration
The levels of MDA and GSH recorded in MRC-5 cells are showed
in Table 2. Lipid peroxidation levels, expressed as MDA, were sig-
nificantly higher than in unexposed cells. A time-dependent
increase in the MDA level in MRC-5 cells was observed, with the
most significant change of 70% being recorded after 72 h of MNP
exposure. By contrast, the GSH levels declined starting with 48 h
of MNP exposure, which culminated with a 60% decrease after
72 h compared to control.
3.7. Protein level and gene expression of Hsp60
MNP interfered with Hsp60 expression and protein level in
MRC-5 cells. A good correlation between Hsp60 mRNA expression
and Hsp60 protein level was observed. As shown in Fig. 8A and B,
the Hsp60 protein was up-regulated by MNP treatment. At 48 h
after MNP exposure, the level of this protein was 70% greater than
1498 M. Radu et al. / Toxicology in Vitro 29 (2015) 1492–1502

Table 2
GSH and MDA levels in MRC-5 cells after MNP treatment. Values are calculated as
means ± SD (n = 5) and expressed as % from controls.

Exposure Sample GSH MDA

time (nmoles/mg protein) (nmoles/mg protein)
24 h Control 100 ± 4.05 100 ± 6.22
MNP 106.21 ± 68.54 107.99 ± 8.6
48 h Control 100 ± 7.12 100 ± 7.3 2
MNP 52.53 ± 3.29* 115.97 ± 6.48
72 h Control 100 ± 48.29 100 ± 3.90
MNP 41.55 ± 6.46* 9.48*
*
P < 0.05 vs. controls.

that of the control. MNP stimulated Hsp60 mRNA expression in
MRC-5 cells in a time-dependent manner, with an increase by
119% and 166% after 48 and 72 h of MNP administration, respec-
tively (Fig. 8C).
3.8. Caspase-1 activity
Fig. 9. Activation of caspase-1 from MRC-5 cells by of 12.5 lg/mL MNP treatment.
Values are calculated as means ± SD (n = 5) and expressed as % from controls.
⁄
p < 0.05 vs. controls; ⁄⁄p < 0.05 vs. controls.
(Fig. 11A). In addition, it was observed that DNA integrity was
not affected for the duration of the experiment (Fig. 11B).

Our studies showed that MNP induced moderate caspase-1 acti-
vation in MRC-5 cells. To be more specific, the levels of this protein
were increased by 35%, 21% and 25% after 24, 48 and 72 h, respec-
tively (Fig. 9).
3.9. Inflammatory markers, NO and PGE2
We analyzed the levels of NO and PGE2, two molecules gener-
ally associated with the inflammatory process. Significant eleva-
tions of NO and PGE2 concentrations in the culture medium of
MRC-5 cells were detected only after 72 h of MNP exposure. At this
time point, the NO concentration and the PGE2 level were
increased by 81% (Fig. 10A) and by 82% (Fig. 10B), respectively.
3.10. Apoptotic/necrotic cells and DNA damage assessment
Annexin V/PI staining revealed that magnetite nanoparticles
exposure did not induce apoptosis or necrosis in MRC-5 cells
4. Discussion
The tremendous potential of MNP in terms of developing new
therapeutic approaches make these nanoparticles of great interest
for biomedical research. As a result, it has become increasingly
important to understand the biological response to their adminis-
tration, considering that the main limitation in MNP applications is
their toxicity. Thus, this study was initiated in order to evaluate the
possible toxic effects of MNP on MRC-5 cells taking into account
that human environmental, occupational and intentional expo-
sures to these often occurs (i.e. due to the fact that more and more
iron oxide nanoparticles are manufactured for nanomedicine).
Previous studies showed that the MNP cytotoxicity was depen-
dent on time and dose-exposure as well as on the characteristics of
the cell lines themselves. For example, while MNP were more toxic
for human umbilical vein endothelial cells (Wu et al., 2010) and
aortic endothelial cells (Ge et al., 2013), a lower toxicity was
detected in macrophage and liver cells (Brown et al., 2014;
Priprem et al., 2010). In addition, moderate cytotoxic effects were

Fig. 8. Hsp60 protein and gene expression in MRC-5 cells after treatment with 12.5 lg/mL MNP (at 24, 48 and 72 h). (A) Hsp60 immunoblot analysis and (B) quantitative
analyses. The control is represented as 100% and protein expression was normalized to each time control (normalized to b-actin). (C) The relative levels of Hsp60 mRNA
normalized to GAPDH mRNA level. Results are expressed as means (n = 5) ± SD. ⁄p < 0.05 vs. controls. ⁄⁄P < 0.05 vs. controls.
 M. Radu et al. / Toxicology in Vitro 29 (2015) 1492–1502
Fig. 10. NO (A) and PGE2 (B) levels in the culture medium of MRC-5 cells after exposure to magnetite nanoparticles. Values are calculated as means ± SD (n = 5) and expressed
as % from controls. ⁄p < 0.05 vs. controls.
noticed in A549 lung epithelial cells (Könczöl et al., 2011) and in
Vero kidney epithelial cells (Szalay et al., 2012) following MNP
exposure.
In our experiments, the cytotoxicity of MNP on MRC-5 cells was
found to be moderate, for all doses after 72 h (Fig. 4). Due to the
fact that lung cells are exposed to environmental (Buzea et al.,
2007) and intravenously injected MNP (Tseng et al., 2012), our
research could have important implications for human health.
The biological relevance in the human context of the 12.5 lg/mL
dose used in this study cannot be determined readily. According
to World Health Organization (WHO, 2005), even if the potential
detrimental effect of ultrafine particles (of which the majority
are in the nanosize range) on human cells is accepted, the epidemi-
ological data are not sufficient to conclude on the expo-
sure/response relationship of these.
The most important iron elevation was recorded at 72 h post
MNP exposure, when the level of iron was approximately 12 pg/-
cell (Fig. 5). In similar studies, the intracellular iron concentrations
reported vary greatly, ranging from a few pg of iron per cell (Zhang
et al., 2007) up to 62.5 pg Fe/cell in the MCF-7 human breast carci-
noma cell line (Kumar et al., 2012). While the amount of cellular
iron is influenced by MNP concentration and exposure time, the
results appear to strongly depend on the type of cell line used
(Liu and Wang, 2013). An iron content of 120 pg/cell was reported
for flasks treated with a dose of 12.5 lg MNP/10 mL/75 cm2 flask;
this suggests that only 10% of the iron of magnetite entered the
cells. Similarly, an uptake efficiency of 9.6% was reported in human
umbilical vein endothelial cell (HUVEC) treated with microparti-
cles of iron oxide (van Tiel et al., 2010). The mechanisms by which
MNP enters the cells are not fully understood. Some studies proved
that, upon their intracellular internalization via endocytosis, MNP
are clustered within lysosomes where, presumably, they are
degraded into iron ions due to the action of an array of hydrolyzing
enzymes at low pH in accordance with endogenous iron metabo-
lism pathways (Tomitaka et al., 2009; Kai et al., 2011). Once pre-
sent in the cell, iron is ultimately sequestrated within ferritin,
which limits its capacity to generate free radicals (Ghio et al.,
2006). However, when ferritin is overloaded, free iron ions could
be released in the cell.
Iron oxide nanoparticles are believed to induce redox cycling
via the Fenton reaction, the hydroxyl radical formed being the
most prevalent source of ROS in biological systems (Nel et al.,
2006). The ferric ions from MNP could interact with hydrogen per-
oxide physiologically formed by different types of
enzyme-catalyzed reactions, generating another ROS type,
hydroperoxyl radical (Fe3+ + H2O2 ? Fe2+ + H+ + HOO) (Hurd and
Murphy, 2009). While the ROS generation leading to oxidative
stress was associated with the MNP nanotoxicity, the mechanisms
by which these nanoparticles generate ROS are still largely
unknown. Several possible mechanisms leading to the formation
of different species of ROS have been suggested; these include
1499
the interaction between magnetite and cellular organelles, such
as mitochondria and nuclei, the activation of membrane NADPH
oxidase (Nordberg et al., 2007; Könczöl et al., 2011), or the disrup-
tion of the well-structured electronic configuration of the
nano-sized material surface which creates reactive electron donor
or acceptor sites, leading to the formation of superoxide radicals
(Shubayev et al., 2009).
The low cytotoxic effect of MNP (25% decrease in cells viability
after 72 h) coupled to the small amounts of iron ions released (10%
of iron contents in magnetite) resulted in a relatively moderate
amount of ROS being produced. As a multistage process,
nanoparticle-induced ROS activation of the defense antioxidant
response occurred. The cells have developed several cellular
defense pathways, which under normal metabolic conditions reg-
ulate the level of ROS and protect against the deleterious effects
of ROS. This defense system includes both antioxidant enzymes,
such as SOD, CAT, GPX, GST and GR, and low-molecular-weight
free-radical scavengers, such as the tripeptide GSH. In order to elu-
cidate the adaptation of MRC-5 to ROS production induced by
MNP, we quantified the activities of these antioxidant enzymes.
Our results showed a similar response of SOD and CAT activities
in the cells exposed to 12.5 lg/mL MNP (Fig. 7A and B). SOD cat-
alyzes the conversion of free-radical superoxide to hydrogen per-
oxide. The GPX enzyme worked in tandem with CAT to scavenge
the excess of hydrogen peroxide: CAT converted the hydrogen per-
oxide into molecular oxygen and water, while GPX used GSH as an
electron donor and catalyzed the biotransformation of various
organic and inorganic peroxides. In our opinion, the upregulation
in GPX activity, noticed only at 72 h post-MNP administration
(Fig. 7C), explained the reduction in ROS level from 48 to 72 h.
Similarly, the inactivation of MNP induced-ROS production by
antioxidant enzymes has also been reported for A549 cells
(Limbach et al., 2007).
In our studies, the GST activities, which can detoxify the
endogenous compounds including peroxidized lipids, were
unchanged (Fig. 7D); this suggests this enzymatic defense against
ROS-induced by MNP degradation was not activated. The decrease
in GR activity after 72 h of MNP exposure with about 33% (Fig. 7E)
indicated an impaired reduction of GSSG to GSH, and could at least
partly explained the observed depletion of about 60% in GSH con-
centration (Table 2). On the other hand, ferric ions of magnetite,
being electrophilic, can deplete intracellular GSH by interacting
directly with sulfhydryl groups (Brodie et al., 1982) or by inhibiting
several cellular activities including the cysteine uptake (Bannai,
1984). Furthermore, the long exposure to ferric nanoparticles could
induce the loss of cellular GSH by glutathionylation of several pro-
teins (Hare and Stamler, 2005).
Iron accumulation as a result of exposure to iron oxide nanopar-
ticles could potentially result in deleterious cellular consequences
eventually leading to cell death (Singh et al., 2010). There is evi-
dence that increased levels of ROS can induce lipid peroxidation,
1500 M. Radu et al. / Toxicology in Vitro 29 (2015) 1492–1502
Fig. 11. Apoptosis detection (A): Phase-contrast (left), AnnexinV-FITC (center) and PI (right) for MRC-5 cells before and after 72 h MNP treatment. The images acquired by
fluorescence microscopy represent MRC-5 cells after 72 h treated with 10% DMSO (positive control), untreated cells and MNP-treated cells. The scale bar is the same for all
images and corresponds to 50 lm. DNA integrity (B): DNA samples were electrophoretically separated on an ethidium bromide stained-agarose gel. No DNA strand breakage
was detected.
DNA fragmentation and protein oxidation. The significant increase
of MDA concentration, by 116% and 170% after 48 and 72 h, respec-
tively, suggests that the antioxidative system adaptation was not
sufficient to prevent the damage of membrane lipids.
Hydroperoxyl and hydroxyl radicals are able to abstract an hydro-
gen atom from a methylene group adjacent to double bonds of
polyunsaturated fatty acids forming carbon centered radicals that
react with molecular oxygen to form lipid peroxides (Antunes
et al., 1996). An elevation in MDA level was also observed in
MRC-5 cells exposed to Fe2O3 nanoparticles (Radu et al., 2010)
and in LE rat lung epithelial cells treated with magnetite
(Ramesh et al., 2012); by contrast, a statistically insignificant
change in the lipid peroxidation level was observed in a A549
human lung epithelial line treated with hematite nano-sized parti-
cles (Guo et al., 2009).
Cells from all organisms respond to a variety of stress condition
by a rapid synthesis of a highly conserved family of proteins, ter-
med heat shock proteins (Hsp). Inducible forms of Hsp were orig-
inally described following heat stress (Garrido et al., 2001)
however, a variety of cellular stressors will lead to their induction
as part of an orchestrated stress response. Hsp can be activated by
oxidative stress (Fulda et al., 2010), conferring a transient protec-
tion. In response to stress factors, Hsp gene expression is modu-
lated firstly by heat shock factor protein 1 (HSF-1). The
mechanism of activation consists of HSF1 oligomerization and
nuclear translocation, followed by enhanced DNA binding on the
Hsp gene promoters.
Hsp60 protein levels were significantly increased in MRC-5 cells
starting with 48 h post-MNP administration (Fig. 8A and B); by
contrast, Hsp27, Hsp70 and Hsp90 expression was not changed
(data not shown). The experiments showed a similar profile in both
Hsp60 mRNA and protein analysis, attesting that induced gene
expression accounted for the up-regulation observed in protein
expression. The increase of Hsp60 gene expression in pulmonary
fibroblasts could explain the resistance to induced oxidative stress
after MNP exposure. The highest level of ROS was recorded at 48 h
after MNP administration, when Hsp60 gene expression began to
be up-regulated. Despite the downward trend in ROS concentra-
tion recorded after this time, the MDA level continuously increased
up to 72 h (Table 2); this suggests that Hsp60 induction was not
sufficient to completely counteract the oxidative stress produced
by MNP in MRC-5 cells.
Few studies have been conducted on HSP expression in cells
treated with NPs. An in vivo study suggested that CeO2 nanoparti-
cles inhalation caused elevation of Hsp60 and Hsp27 levels in the
mouse heart (Para, 2011). The induction of Hsp60 has also been
detected in many pulmonary cell types such as the bronchial
epithelium of patients with asthma (Fajac et al., 1997) or the
human pulmonary microvascular endothelial cells following heavy
metal exposure (Wagner et al., 1999).
In complex with Hsp10, Hsp60 provides a suitable environment
for the unfolded or misfolded protein intermediates to return to
their native conformation. Unlike most Hsps with obvious
pro-survival functions, Hsp60 appears to have both pro-survival
and pro-death functions (Chandra et al., 2007). Some studies have
shown that Hsp60 protects cells from stress-induced death
through activation of extracellular signal-regulated kinase (ERK)
and inhibition of caspase-3 (Samali et al., 1999). Conversely,
Hsp60 has a pro-apoptotic effect consisting of the release of cyto-
chrome c and caspase-3 activation in Jurkat cells (Samali et al.,
1999).
Up-regulation of Hsp60 in several cancers correlates with dif-
ferent evolution prognosis for the patients (Cappello et al., 2008).
Higher levels of Hsp60 protein help cells to be more resistant to
ROS attack (Cabiscol et al., 2002), which emphasizes the potential
pro-survival role of this protein. By contrast, loss of Hsp60
expression is associated with an increased risk of developing infil-
trating recurrent bladder cancer (Lebret et al., 2003). In addition,
an inhibition of Hsp60 under increased stress condition can sup-
press autophagy (Kim et al., 2009). In our opinion, the
up-regulation of Hsp60 induced cytoprotection against MNP cell
stresses in the MRC-5 line, probably due to cell death
suppression.
Significant elevations of NO and PGE2 concentrations in the cul-
ture medium of MRC-5 cells were detected only after 72 h of MNP
exposure. At this time, the NO concentration increased by 81%
(Fig. 10A) and the PGE2 level was augmented by 82% (Fig. 10B).
Hsp60 is also a ligand for Toll-like receptor 4 (TLR4) (Guo and
Friedman, 2010), which is present in lung tissue (Yang et al.,
2013). The activated TLR4 could trigger the canonical IKKb/NF-jB
signaling pathway and induce the up-regulation of inducible nitric
oxide synthase (iNOS) (Newton and Dixit, 2012). Previous studies
have suggested that endogenous and exogenous NO play a critical
role in the release of PGE2, by direct activation of cyclooxygenase
enzymes (Salvemini et al., 1993). Consequently, the increase in
Hsp60 could have induced NO synthesis and indirect release of
PGE2, an abundant eicosanoid product with crucial role in inflam-
mation (Wilborn et al., 1995). Also, PGE2 can promote cell survival
by a direct inhibition of caspase-3 via S-nitrosylation (Rossig et al.,
1999).
 M. Radu et al. / Toxicology in Vitro 29 (2015) 1492–1502
MNP treated MRC-5 cells, probably subsequent to caspase-3
inhibition, did not present DNA fragmentation. Similar results were
observed in the A549 human lung epithelial cells exposed to
20–60 nm MNP at a concentration of 10 lg/mL (Könczöl et al.,
2011) but the treatment with higher doses generated DNA oxida-
tive damage in the same cells (Karlsson et al., 2009).
Activated TLR 4 generates caspase-1 activation, a
pro-inflammatory cysteine protease, which is responsible for pro-
teolytic processing and activation of the proform of IL-1b (Staal
et al., 2011).
In our study, MNP exposure caused the up-regulation and activa-
tion of caspase-1 starting with 24 h of exposure, suggesting an
inflammatory response. The activity of caspase-1 in pulmonary
fibroblasts remained elevated up to 72 h of MNP exposure.
Recently, a new type of programmed cell death named pyroptosis,
or caspase-1-dependent cell death, was discovered (Labbé and
Saleh, 2011). In this pathway, the autocatalysis of inactive
pro-caspase-1 to active caspase-1 is triggered by the formation of
a cytosolic complex named the ‘‘inflammasome’’ (Lamkanfi et al.,
2007). Although in our experiment caspase-1 activation occurred,
no form of cell death was observed during the analyzed time inter-
vals (Fig. 9). It is possible that while caspase-1 activation in immune
cells triggers pyroptosis and influences the development of adaptive
immune responses (Bergsbaken et al., 2009), epithelial cells activate
caspase-1 to prevent cell death (Gurcel et al., 2006). This enzyme
supports survival and confers resistance to mammalian cells against
pathogenic bacteria that express a pore-forming toxin that, in turn,
can create holes in the plasma membrane of the host cell (Sollberger
et al., 2014). The repair of toxin-induced damage to the plasma
membrane requires the activation of the lipid biogenesis pathways,
controlled by two transcription factors known as sterol regulatory
element-binding protein 1 (SREBP1) and SREBP2 (Lamkanfi, 2011).
The molecular mechanism by which caspase-1 activates SREBPs is
completely unknown (Sollberger et al., 2014). In our case, MNP could
generate the same events due to the increased lipid peroxidation of
polyunsaturated acids from the plasma membrane.
5. Conclusions
The MNP treatment of MRC-5 cells resulted in a time-dependent
accumulation of Fe ions inside the cells that led to ROS generation.
The increased CAT and SOD activity, GSH depletion and MDA gener-
ation reflected the oxidative stress induced in MRC-5 cells. Based on
these findings, the increase in NO and PGE2 production coupled with
the surge of caspase-1 activity and Hsp60 expression could suggest
that MRC-5 cells successfully developed cell protection mechanisms
and suppressed cell death. When cells exposure to MNP doses higher
that 12.5 lg/mL occurs, an additional amount of ROS could be pro-
duced, and consequently, the processes mentioned above would
reach saturation. If these processes are saturated, most cellular com-
ponents are likely to be targets of oxidative damage, such as lipid
peroxidation, protein oxidation, GSH depletion and DNA single
strand breaks, that are all initiated by ROS excess. Taken together,
these events could lead to cellular dysfunction and ultimately cell
death. As a result, the need for a better understanding of this mech-
anism warrants further investigations.
Conflict of Interest
The authors declare that there are no conflicts of interest.
Transparency Document
The Transparency document associated with this article can be
found in the online version.
1501
Acknowledgements
This work was supported by the strategic grant
POSDRU/159/1.5/S/133391, Project ‘‘Doctoral and Post-doctoral
programs of excellence for highly qualified human resources train-
ing for research in the field of Life sciences, Environment and Earth
Science’’ co-financed by the European Social Found within the
Sectorial Operational Program Human Resources Development
2007–2013 and by the PNII-IDEI 340/2007 project financed by
National Council of Scientific Research (CNCSIS), Romania.
References
Aebi, H., 1984. Catalase in vitro. In: Bergmayer, H.U. (Ed.), Methods of enzymatic
analysis. FRG, Weinheim, pp. 673–684.
Ankamwar, B., Lai, T.C., Huang, J.H., Liu, R.S., Hsiao, M., Chen, C.H., Hwu, Y.K.,
2010. Biocompatibility of Fe3O4 nanoparticles evaluated by in vitro
cytotoxicity assays using normal, glia and breast cancer cells.
Nanotechnology 21, 75102.
Antunes, F., Salvador, A., Marinho, H.S., Alves, R., Pinto, R.E., 1996. Lipid peroxidation
in mitochondrial inner membranes. I. An integrative kinetic model. Free Rad.
Biol. Med. 21, 917–943.
Bannai, S., 1984. Transport of cystine and cysteine in mammalian cells. Biochim.
Biophys. Acta 779, 289–306.
Bergsbaken, T., Fink, S.L., Cookson, B.T., 2009. Pyroptosis: host cell death and
inflammation. Nat. Rev. Microbiol. 7, 99–109.
Beutler, E., 1971. Red cell metabolism. In: Grune, Stratton (Eds.), A manual of
biochemical methods. New York, pp. 71–73.
Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of
microgram quantities of protein utilizing the principle of proteindye binding.
Anal. Biochem. 72, 248–254.
Brodie, A.E., Potter, J., Reed, D.J., 1982. Unique characteristics of rat spleen
lymphocyte, L1210 lymphoma and HeLa cells in glutathione biosynthesis
from sulfur-containing amino acids. Eur. J. Biochem. 123, 159–164.
Brown, D.M., Johnston, H., Gubbins, E., Stone, V.-J., 2014. Serum enhanced cytokine
responses of macrophages to silica and iron oxide particles and nanomaterials:
a comparison of serum to lung lining fluid and albumin dispersions. J. Appl.
Toxicol. 34, 1177–1187.
Buzea, C., Pacheco, I.I., Robbie, K., 2007. Nanomaterials and nanoparticles: sources
and toxicity. Biointerphases 2, MR17–MR172.
Cabiscol, E., Bell, G., Tamarit, J., Echave, P., Herrero, E., Ros, J., 2002. Mitochondrial
Hsp60, resistance to oxidative stress, and the labile iron pool are closely
connected in Saccharomyces cerevisiae. J. Biol. Chem. 277, 44531–44538.
Cappello, F., Conway de Macario, E., Marasà, L., Zummo, G., Macario, A.J.L., 2008.
Hsp60 expression, new locations, functions and perspectives for cancer
diagnosis and therapy. Cancer Biol. Ther. 7, 801–809.
Chandra, D., Choy, G., Tang, D.G., 2007. Cytosolic accumulation of HSP60 during
apoptosis with or without apparent mitochondrial release: evidence that its
pro-apoptotic or pro-survival functions involve differential interactions with
caspase-3. J. Biol. Chem. 282, 1289–1301.
Chowdhury, S.R., Yanful, E.K., 2010. Arsenic and chromium removal by mixed
magnetite–maghemite nanoparticles and the effect of phosphate on removal. J.
Environ. Manage. 91, 2238–2247.
Dinischiotu, A., Stanca, L., Gradinaru, D., Petrache, S.N., Radu, M., Serban, A.I., 2013.
Lipid peroxidation due to in vitro and in vivo exposure of biological samples to
nanoparticles. Oxid. Stress Nanotechnol. 1028, 155–164.
Fajac, I., Roisman, G.L., Lacronique, J., Polla, B.S., Dusser, D.J., 1997. Bronchial gamma
delta T-lymphocytes and expression of heat shock proteins in mild asthma. Eur.
Respir. J. 10, 633–638.
Figuerola, A., Di Corato, R., Manna, L., Pellegrino, T., 2010. From iron oxide
nanoparticles towards advanced iron-based inorganic materials designed for
biomedical applications. Pharmacol. Res. 62, 126–143.
Fulda, S., Gorman, A.M., Hori, O., Samali, A., 2010. Cellular stress responses: cell
survival and cell death. Int. J. Cell Biol., 1–23, ID 21407
Garrido, C., Gurbuxani, S., Ravagnan, L., Kroemer, G., 2001. Heat shock proteins:
endogenous modulators of apoptotic cell death. Biochem. Biophys. Res.
Commun. 286, 433–442.
Ge, G., Wu, H., Xiong, F., Zhang, Y., Guo, Z., Bian, Z., Xu, J., Gu, C., Gu, N., Chen, X.,
Yang, D., 2013. The cytotoxicity evaluation of magnetic iron oxide nanoparticles
on human aortic endothelial cells. Nanoscale Res. Lett. 8, 215–224.
Ghio, J.A., Turi, J.L., Yang, F., Garrick, L.M., Garrick, M.D., 2006. Iron homeostasis in
the lung. Biol. Res. 39, 67–77.
Goldberg, D.M., Spooner, R.J., 1983. Glutathione reductase. In: Bergmayer, H.U. (Ed.),
Methods of Enzymatic Analysis. Verlag Chemie, Dearfield Beach, pp. 258–265.
Green, L.C., Wagner, D.A., Glogowski, J., Skipper, P.L., Wishnok, J.S., Tannenbaum,
S.R., 1982. Analysis of nitrate, nitrite, and [15N] nitrate in biological samples.
Anal. Biochem. 126, 131–138.
Grobéty, B., Gieré, R., Dietze, V., Stille, P., 2010. Airborne particles in the urban
environment. Elements 6, 229–234.
Guo, J.F., Friedman, S.L., 2010. Toll-like receptor 4 signalling in liver injury and
hepaticfibrogenesis. Fibrogen. Tissue Repair 3, 21.
1502 M. Radu et al. / Toxicology in Vitro 29 (2015) 1492–1502
Guo, B., Zebda, R., Drake, S.J., Sayes, C.M., 2009. Synergistic effect of co-exposure of
carbon black and Fe2O3 nanoparticles on oxidative stress in cultured lung
epithelial cells. Part. Fibre. Toxicol. 6, 4.
Gurcel, L., Abrami, L., Girardin, S., Tscopp, J., van der Goot, F.G., 2006. Caspase-1
activation of lipid metabolic pathways in response to bacterial pore-forming
toxins promotes cell survival. Cell 126, 1135–1145.
Habig, W.H., Pabst, M.J., Jakoby, W.B., 1974. Glutathione-S-transferase. The first
enzymatic step in mercapturic acid formation. J. Biol. Chem. 249, 7130–7139.
Halliwell, B., Gutteridge, J.M.C., 2007. Free Radicals in Biology and Medicine. Oxford
University Press, New York.
Hare, J.M., Stamler, J.S., 2005. NO/redox disequilibrium in the failing heart and
cardiovascular system. J. Clin. Invest. 115, 509–517.
Hurd, T.R., Murphy, M.P., 2009. Biological systems relevant for redox signalling and
control. In: Jacob, C., Winyard, P.G. (Eds.), Redox Signalling and Regulation in
Biology and Medicine. Wiley-VCH VerlagGmbH&Co. KGaA, Weinheim, pp. 13–
45.
Ito, A., Fujioka, M., Yoshida, T., Wakamatsu, K., Ito, S., Yamashita, T., Jimbow, K.,
Honda, H., 2007. 4-S-Cysteaminylphenol-ioded magnetite cationic liposomes
for combination therapy of hypertermia with chemotherapy against malignant
melanoma. Cancer Sci. 98 (3), 424–430.
Kai, W., Xiaojun, X., Ximing, P., Zhenqing, H., Qiqing, Z., 2011. Cytotoxic effects and
the mechanism of three types of magnetic nanoparticles on human hepatoma
BEL-7402 cells. Nanoscale Res. Lett. 6, 480.
Karlsson, H.L., Holgersson, A., Moller, L., 2008. Mechanisms related to the
genotoxicity of particles in the subway and from other sources. Chem. Res.
Toxicol. 21, 726–731.
Karlsson, H.L., Gustafsson, J., Cronholm, P., Moller, L., 2009. Size-dependent toxicity
of metal oxide particles—a comparison between nano- and micrometer size.
Toxicol. Lett. 188, 112–118.
Kehrer, J.P., 1993. Free radicals as mediators in tissue injury and disease. Crit. Rev.
Toxicol. 23, 21–48.
Kim, H., Choi, J., Ryu, J., Park, S.G., Cho, S., Park, B.C., Lee do, H., 2009. Activation of
autophagy during glutamate-induced HT22 cell death. Biochem. Biophys. Res.
Commun. 388, 339–344.
Könczöl, M., Ebeling, S., Goldenberg, E., Treude, F., Gminski, R., Gieré, R., Grobérty, B.,
Rothen-Rutishauser, B., Merfort, I., Mersch-Sunderman, V., 2011. Cytotoxicity
and genotoxicity of size-fractionated iron oxide (magnetite) in A549 human
lung epithelial cells: role of ROS, JNK, and NF-B. Chem. Res. Toxicol. 24, 1460–
1475.
Kumar, M., Singh, G., Arora, V., Mewar, S., Sharma, U., Jagannathan, N.R., Sapra, S.,
Dinda, A.K., Kharbanda, S., Singh, H., 2012. Cellular interaction of folic acid
conjugated superparamagnetic iron oxide nanoparticles and its use as contrast
agent for targeted magnetic imaging of tumor cells. Int. J. Nanomed. 7, 3503–
3516.
Labbé, K., Saleh, M., 2011. Pyroptosis: a caspase-1-dependent programmed cell
death and a barrier to infection. In: Couillin, I., Pétrilli, V., Martinon, F. (Eds.),
The Inflammasomes, Progress in Inflammation Research. Springer, Bassel AG,
pp. 17–37.
Lamkanfi, M., 2011. Emerging inflammasome effector mechanisms. Nat. Rev./
Immunol. 11, 213–220.
Lamkanfi, M., Kanneganti, T.D., Franchi, L., Nunez, G., 2007. Caspase-1
inflammasomes in infection and inflammation. J. Leukoc. Biol. 82, 220–225.
Lebret, T., Watson, R.W., Molinie, V., O’Neill, A., Gabriel, C., Fitzpatrick, J.M., Botto, H.,
2003. Heat shock proteins HSP27, HSP60, HSP70, and HSP90: expression in
bladder carcinoma. Cancer 98, 970–977.
Li, J.J., Hartono, D., Ong, C.N., Bay, B.H., Yung, L.Y., 2010. Autophagy and oxidative
stress associated with gold nanoparticles. Biomaterials 31, 5996–6003.
Limbach, L.K., Wick, P., Manser, P., Grass, R.N., Bruinink, A., Stark, W.J., 2007.
Exposure of engineered nanoparticles to human lung epithelial cells: influence
of chemical composition and catalytic activity on oxidative stress. Environ. Sci.
Technol. 41, 4158–4163.
Lin, B.L., Shen, X.D., Cui, S., 2007. Application of nanosized Fe3O4 in anticancer drug
carriers with target-orientation and sustained-release properties. Biomed.
Mater. 2, 132–134.
Liu, Y., Wang, J., 2013. Effects of DMSA-coated Fe3O4 nanoparticles on the
transcription of genes related to iron and osmosis homeostasis. Toxicol. Sci.
131, 521–536.
Maity, D., Chandrasekharan, P., Yang, C.T., Chuang, K.H., Shuter, B., Xue, J.M., Ding, J.,
Feng, S.S., 2010. Facile synthesis of water-stable magnetite nanoparticles for
clinical MRI and magnetic hyperthermia applications. Nanomedicine UK.5,
1571–1584.
Mosmann, J., 1983. Rapid colorimetric assay for cellular growth and survived. J.
Immunol. Meth. 65, 55–63.
Nel, A., Xia, T., Mädler, L., Li, N., 2006. Toxic potential of materials at the nanolevel.
Science 311, 622–627.
Newton, K., Dixit, V.M., 2012. Signalling in innate immunity and inflammation. Cold
Spring Harb. Perspect. Biol. 4, pii: a006049.
Nordberg, G.F., Fowler, B.A., Nordberg, M., Friberg, L.T., 2007. Handbook on the
Toxicology of Metals, third ed. Academic press, New York.
Paoletti, F., Aldinucci, D., Mocali, A., Caparrini, A., 1986. A sensitive
spectrophotometric method for the determination of superoxide dismutase
activity in tissue extracts. Anal. Biochem. 154, 538–541.
Para, R., 2011. Evaluation of Toxicological effects on Intra Tracheal Instilled CeO2
Nanoparticles on the Heart of Male Spargue–Dawley Rats. Theses, Dissertations
and Capstones. Paper 48.
Park, E.-J., Kim, H., Kim, Y., Yi, J., Choi, K., Park, K., 2010. Inflammatory responses may
be induced by a single intratracheal instillation of iron nanoparticles in mice.
Toxicology 275, 65–71.
Pauluhn, J., 2012. Subchronic inhalation toxicity of iron oxide (magnetite, Fe3O4) in
rats: pulmonary toxicity is determined by the particle kinetics typical of poorly
soluble particles. J. Appl. Toxicol. 32, 488–504.
Pisanic, T.R., Jin, S., Shubayev, V.I., 2009. Iron oxide magnetic nanoparticle
nanotoxicity: incidence and mechanisms. In: Sahu, S., Casciano, D. (Eds.),
Nanotoxicity: From in vivo and in vitro Models to Health Risks. John Wiley &
Sons Ltd, pp. 397–425.
Price, O.T., Asgharian, B., Miller, F.J., Cassee, F.R., Winter-Sorkina, R., 2002. Multiple
Path Particle Dosimetry model: A Model for Human and Rat Airway Particle
Dosimetry, (MPPD V1.0), RIVM Report, 650010030.
Priprem, A., Mahakunakorn, P., Thomas, C., Thomas, I., 2010. Cytotoxicity studies of
superparamagnetic iron oxide nanoparticles in macrophage and liver cells. Am.
J. Nanotechnol. 1, 78–85.
Radu, M., Munteanu, M.C., Petrache, S., Serban, A.I., Dinu, D., Hermenean, A., Sima,
C., Dinischiotu, A., 2010. Depletion of intracellular glutathione and increased
lipid peroxidation mediate cytotoxicity of hematite nanoparticles in MRC-5
cells. Acta. Biochim. Polon. 57, 355–360.
Ramesh, V., Ravichandran, P., Copeland, C.L., Gopikrishnan, R., Biradar, S., Goornavar,
V., Ramesh, G.T., Hall, J.C., 2012. Magnetite induces oxidative stress and
apoptosis in lung epithelial cells. Mol. Cell. Biochem. 363, 225–234.
Rossig, L., Fichtlscherer, B., Breitschopf, K., Haendeler, J., Zeiher, A.M., Mulsch, A.,
Dimmeler, S., 1999. Nitric oxide inhibits caspase-3 by S-nitrosylation in vivo. J.
Biol. Chem. 274, 6823–6826.
Salvemini, D., Misko, T.P., Masferrer, J.L., Seibert, K., Currie, M.G., Needleman, P.,
1993. Nitric oxide activates cyclooxygenase enzymes. Proc. Natl. Acad. Sci. 90,
7240–7244.
Samali, A., Cai, J., Zhivotovsky, B., Jones, D.P., Orrenius, S., 1999. Presence of a pre-
apoptotic complex of pro-caspase-3, Hsp60 and Hsp10 in the mitochondrial
fraction of Jurkat cells. The EMBO J. 18, 2040–2048.
Santoro, M.G., 2000. Heat shock factors and the control of the stress response.
Biochem. Pharmacol. 59, 55–63.
Shaw, S.Y., Westly, E.C., Pittet, M.J., Subramanian, A., Schreiber, S.L., Weissleder, R.,
2008. Perturbational profiling of nanomaterial biologic activity. Proc. Natl. Acad.
Sci. 105, 7387–7392.
Shubayev, V., Pisanic, T.R., Jin, S., 2009. Magnetic nanoparticles for theragnostics.
Adv. Drug Deliv. Rev. 61, 467–477.
Singh, N., Jenkins, G.J.S., Asadi, R., Doak, S.H., 2010. Potential toxicity of
superparamagnetic iron oxide nanoparticles (SPION). Nano Rev. 1, 5358.
Sollberger, G., Strittmatter, G.E., Garstkiewicz, M., Sand, J., Beer, H.-D., 2014.
Caspase-1: the inflammasome and beyond. Innate Immun. 20, 115–125.
Staal, J., Bekaert, T., Beyaert, R., 2011. Regulation of NF-jB signaling by caspases and
MALT1 paracaspase. Cell Res. 21, 40–54.
Szalay, B., Tátrai, E., Nyíro} , G., Vezér, T., Dura, D., 2012. Potential toxic effects of iron
oxide nanoparticles in in vivo and in vitro experiments. J. Appl. Toxicol. 32,
446–453.
Tomitaka, A., Hirukawa, A., Yamada, T., Morishita, S., Takemura, Y., 2009.
Biocompatibility of various ferrite nanoparticles evaluated by in vitro
cytotoxicity assays using HeLa cells. J. Magn. Magn. Mater. 321, 482–1484.
Tseng, W.-K., Chieh, J.-J., Yang, C.-K., Chiang, C.-K., Chero, Y.-L., Shieh, Y.Y., Horng, H.-
E., Yang, H.-C., Wu, C.-C., 2012. A noninvasive method to determine the fate of
Fe3O4 nanoparticles following intravenous injection using scanning SQUID
biosusceptometry. PLoS ONE 7 (11), e48510.
van Tiel, S.T., Wielopolski, P.A., Houston, G.C., Krestin, G.P., Bernsen, M.R., 2010.
Variations in labeling protocol influence incorporation, distribution and
retention of iron oxide nanoparticles into human umbilical vein endothelial
cells. Contrast Media Mol. Imaging 5, 247–257.
Wagner, M., Hermanns, I., Bittinger, F., Kirkpatrick, C.J., 1999. Induction of stress
proteins in human endothelial cells by heavy metal ions and heat shock. Am. J.
Physiol. 277, L1026–L1033.
Wan, C.P., Myung, E., Lau, B.H.S., 1993. An automated microfluorometric assay for
monitoring oxidative burst activity of phagocytes. J. Immunol. Meth. 159, 131–
138.
WHO. Word Health Organisation, 2005. Guidelines for air quality.
Wilborn, J., Crofford, L.J., Burdick, M.D., Kunkel, S.L., Strieter, R.M., Peters-Golden, M.,
1995. Cultured lung fibroblasts isolated from patients with idiopathic
pulmonary fibrosis have a diminished capacity to synthesize prostaglandin E2
and to express cyclooxygenase-2. J. Clin. Invest. 95, 1861–1868.
Wu, X., Tan, Y., Mao, H., Zhang, M., 2010. Toxic effects of iron oxide nanoparticles on
human umbilical vein endothelial cells. Int. J. Nanomed. 5, 385–399.
Yang, Z., Deng, Y., Su, D., Tian, J., Gao, Y., He, Z., Wang, X., 2013. TLR 4 as receptor for
HMGB1-mediated acute lung injury after liver ischemia/reperfusion injury. Lab.
Invest. 93, 792–800.
Zhang, C., Wangler, B., Morgenstern, B., Zentgraf, H., Eisenhut, M., Untenecker, H.,
Kruger, R., Huss, R., Seliger, C., Semmler, W., Kiessling, F., 2007. Silica- and
alkoxysilane-coated ultra small superparamagnetic iron oxide particles: a
promising tool to label cells for magnetic resonance imaging. Langmuir 23,
1427–1431.
Zhu, X.M., Wang, Y.X., Leung, K.C., Lee, S.F., Zhao, F., Wang, D.W., Lai, J.M., Wan, C.,
Cheng, C.H., Ahuja, A.T., 2012. Enhanced cellular uptake of aminosilane-coated
superparamagnetic iron oxide nanoparticles in mammalian cell lines. Int. J.
Nanomed. 7, 953–964.