Development of a bicistronic lentiviral platform for the expression of CRISPR/Cas9-

mCherry system in fish cell lines.

Sebastián Escobar-Aguirre1*, Duxan Arancibia2, Amanda Escorza2, Cristián Bravo1,

Pedro Zamorano3, María Estela Andrés2, Víctor Martínez1*

1
FAVET-INBIOGEN, Facultad de Ciencias Veterinarias y Pecuarias, Universidad de Chile,

Avda. Santa Rosa, 11735, Santiago, Chile

2
Department of Cellular and Molecular Biology, Faculty of Biological Sciences, Pontificia

Universidad Católica de Chile.

3
Departamento Biomédico, Facultad de Ciencias de la Salud, Instituto Antofagasta,

Universidad de Antofagasta, Avenida Angamos 601, Antofagasta, Chile.  

* Corresponding authors: Sebastián Escobar-Aguirre, FAVET-INBIOGEN, Facultad de

Ciencias Veterinarias y Pecuarias, Universidad de Chile, Avda. Santa Rosa, 11735,

Santiago, Chile.

Víctor Martínez, FAVET-INBIOGEN, Facultad de Ciencias Veterinarias y Pecuarias,

Universidad de Chile, Avda. Santa Rosa, 11735, Santiago, Chile.

E-mail address: s.escobar.a@veterinaria.uchile.cl, vmartine@uchile.cl

ABSTRACT

CRISPR/Cas9 system has been widely used in animals and plants as an efficient genome

editing tool. In salmonids or fish cells, the technique is not commonly used due to the lack

of proper vectors using fish specific promoters for the expression of sgRNAs and the Cas9

protein, making it difficult to implement. In the present study, we show the optimization of

a CRISPR/Cas9 lentiviral system designed for expression of fish cells using mCherry as a

reporter gene. For this purpose, the efficacy of the expression of the Cas9 nuclease and the

sgRNA was analyzed in CSHE-214 cells. A plasmid was constructed encoding the spCas9

protein driven by the core promoter for human elogantion factor 1 α (EFS-NS) in a

bicistronic cassette that also expressed mCherry. For the expression of the sgRNA, a

cassette containing the U6 RNA III polymerase promoter zebrafish was used. The new

lentiviral plasmid was able to display the expression for Cas9, mCherry and sgRNA in the

fish cells CHSE/F as assessed by RT-PCR and Western blot analysis. This is the first

approach for developing a genome editing system in fish cells using lentiviral vectors,

which make it a powerful platform to for determining gene function in diseases for

biotechnological developments in the salmon industry.

Keywords CRISPR/Cas9, sgRNA, CHSE/F, fish cells, U6 promoter

HIGHLIGHTS

● A lentiviral Crispr/Cas9 mCherry system for a fish cell line was developed.

● The Zebrafish RNA U6 promoter drives sgRNA expression in salmon cell lines.

● EFS-NS mammalian promoter drives gene expression of Cas9 in fish cells.

1. INTRODUCTION

Recently, a new gene-editing system has been applied with high targeting efficiency and

low cell toxicity, known as clustered regularly interspaced short palindromic repeats

(CRISPR)/CRISPR-associated protein 9 (Cas9). Based on the type II prokaryotic CRISPR

from Streptococcus pyogenes, the co-delivery of endonuclease Cas9 combined with a

synthetic small guide RNA (sgRNA) targeting certain gene(s) has shown to be a reliable

tool to edit eukaryotic genomes at the desired site(s). Cas9 endonuclease targeted by the

sgRNA generates a double-strand break (DSB) that is repaired by the non-homologous end-

joining (NHEJ), a process that re-ligates the DSBs generating insertion/deletion (indel)

mutations or by the homology-directed repair (HDR) enabling existing genes to be edited,

deleted or new ones inserted. Unlike ZFNs and TALENs, sgRNA is the only component

that needs a designation for each genomic target, thereby significantly simplifying the

design and decreasing the cost of gene editing compared to the protein-based target

recognition platforms. The simplicity of the CRISPR/Cas9 system enabled to establish a

method for genome editing in a wide range of organisms, generating knockout models very

efficiently and Çvery quickly [1,2]. In this line, CRISPR/Cas9 system has been used in fish,
to generate lines of site-directed mutated animals. The editing is usually accomplished by

delivery of the Cas9 system to a single cell fish egg embryo and has been carried out

successfully in zebrafish [1,3,4], Atlantic salmon [5,6], and tilapia [7]. The methodology

has been difficult to implement in fish somatic cell lines due to the lack of fish specific

promoters for the expression of sgRNAs and the Cas9 protein. To date, there is only one

report describing the editing of salmon cells [8] which stably express Cas9 and EGFP and

the introduction of sgRNAs was accomplished by lipofection. Lentiviruses has shown to be

a proper platform to deliver the Cas9/CRISPR in mammalian cells with high efficiency [9].

Given the difficulty of transfecting fish cell lines, the development of a lentiviral

CRISPR/Cas9 system for fish cell lines offers a more efficient screening platform to assess

gene function and their role in cell biology and disease. Therefore, the aim of this study was

to develop a CRISPR/cas9 lentiviral platform for fish cell lines as a powerful gene editing

tool, which could result in new inside to protein function, their role in disease and

biotechnological applications for the salmon industry.

2. Material and Methods

2.1 Plasmid vector construction

The expression vector LentiCRISPR-Cas9-2A-mCherryU6ZF (LcU6ZF, hereafter) created

for first time for fish cell lines was based on the mammalian LentiCRISPR Puro (from Feng

Zhang, addgene plasmid #52961) and modified in two steps as follows. To generate

LCmCherry v2, the mCherry sequence was obtained from FU-mCherry-w (a in house made

plasmid) and then digestion with BsiWI and SacII restriction enzymes (New Englands

Biolabs) was done. The 0.7 kb amplicon, previously digested with BsiWI and SacII
restriction enzymes, was then purified from agarose gel using Qiagen DNA extraction kit

and subsequently ligated (T4 ligase, Roche) into the LentiCRISPR v2 at the site of the

discarded puromycin fragment (1.3 kb). Secondly, the full length U6 promoter from

zebrafish (U6ZF) was amplified by PCR from genomic DNA Danio rerio (kindly provided

by Dra. Carmen Gloria Feijoo´s Lab, Chile), using FwU6ZF and RvU6Zf primers. The

primers were designed (Table S1) according to Shinya et al. (2013), including the BsmBI

and KpnI restriction sites, respectively. PCR conditions, using a Pfu DNA polymerase

(Invitrogen), were as follows: 95 C for 5 min, 40 cycles of 95 C for 30 s, 56 C for 30 s, and

72o C for 0.5 min, with a final extension at 72o C for 10 min. Finally, the PCR U6

fragment (0.3 kb) was gel-extracted and subsequently cloned into LCmCherry v2 by

replacing it with the human U6 promoter region (termed as LcU6ZF), after digestion of the

vector with BsmBI and KpnI restriction enzymes (New England Biolabs). Finally, plasmids

were verified by sequencing.

2.2 Cloning sgRNA oligonucleotide in the novel LcU6ZF vector

The promoter activity for RNA pol III was measured by U6 promoter-driven sgRNA and

scaffold synthesis. To do this, the filler fragment (2 kb) was replaced by the GFP

oligonucleotides (data not shown). Primers (Table 1) XXX were annealed by extension

protocol and cloned into LcU6ZF as follows: First, 1 ul (100 uM) of each forward and

reverse oligonucleotide (Table S1) was phosphorylated with PNK (New England Biolabs)

for 30 minutes and annealed in annealing buffer (0.4M Tris pH 8, 0.2 M MgCl 2, 0.5 M

NaCl, 10 mM EDTA pH 8.0) by incubation at 95 C for 5 min, followed by ramping down

to 4 ºC/min at 22ºC. Oligonucleotides were diluted (1:200) and ligated into the novel
LcU6ZFsgGFP (hereafter). Plasmids were prepared using a QIAprep Spin Midiprep Kit

(Qiagen). Finally, plasmids were verified by sequencing.

2.3 Cell culture and rates of transfection

Three fish cell lines, ASK, CHSE/F and SHK-1, were used, each of them was transfected

with the plasmid pGFP. Later on, successful transfections were determined by counting the

number of GFP positive cells (supplemental data 1). The CHSE/F cell line provided the

best results and thus, was the cell line used for the following experiments. CHSE/F derived

from Common bluegill (Lepomis macrochirus) embryo were grown as monolayer at 20 °C

in Leibovitz L-15 medium (Invitrogen) supplemented with 10% fetal calf serum (Biological

Industries, Inc.). In order to determine the rates of transfection a pGFP vector (Clontech)

was used in these cells. Thus, the cell line expressing the GFP marker was developed

transfecting 2.5 µg of DNA (6-well plates at high confluency (70-90%) using

Lipofectamine 3000 (Invitrogen) following the manufacturer’s instructions. The percentage

of transfection (supplemental data 2) was obtained by cell sorting (BD FACSAria II) after

72 hours using the same parameter described by Dehler (2016). NOTE: Recently, this cell

line has been reassigned as the fish cell line from Lepomis macrochirus, as this finding still

could a matter of controversy, during the developing of this report we will consider the

primary assignation as a Chinook salmon cell line (formerly known as CHSE-214).

However, independently of the source, the cell line is fish derived, therefore it doesn´t

change the outcome of the results reported.

2.4 RNA isolation and reverse transcription (cDNA) of CHSE/F cells

In order to evaluate the U6 and EFS-NS promoter activity, the total RNA from transfected

LcU6ZFgRNAGFP and non-transfected CHSE/F cells was extracted using TRIZOL

reagent (Invitrogen Life Technology) and treated with RNAse-free DNaseI (1U, Thermo

Scientific) according to manufacturer’s guidelines. RNA integrity was determined by

capillary electrophoresis using 2 uL of diluted sample (1:5) on Fragment Analyzer

(Advanced analytical) with Standard Sensitivity RNA Analysis kit. The first-strand of

cDNA was synthesized from 0.5 μg of total RNA using Superscript III Reverse

Transcriptase (Invitrogen, Life Technologies) and oligo(dT), according to the supplier’s

instructions. The cDNAs were amplified using specific primers (Table S1) on a PCR

reaction (Go Taq, Promega). PCR product was visualized on agarose gels stained with

ethidium bromide.

2.5 PCR of CHSE/F cells transfected by LcU6ZFgRNAGFP

PCR amplifications from non-transfected and transfected cell were performed in reactions

containing 1 ul of cDNA, 0.2 mM dNTP, 0.4 mM of (U6ZF_F/U6F_R; Ubq_F/Ubq_R; and

FwdGFPPCR/RvgRNAscaffold) primers, respectively, in 25 ul of Go Taq 2x (Promega).

As follows: 95 ºC for 5 min, 35 cycles of 95 ºC for 30 s, 56-58 ºC for 30 s, and 72 ºC for 30

sec, with a final extension at 72 ºC for 10 min. PCR primers encompass the targeting sites

for each gene are listed in Table S1. The PCR product was separated in 1.5% agarose gel

containing SYBR™ Safe DNA Gel Stain (Thermo Fisher). The housekeeping expression

used in this study was the ubiquitin gene (UBQ) which was chosen based on previous work

done by Peña in this cell (2010) listed in Table S1.

2.6 Fluorescent monolayer of transfected CHSE/F Cell

After 96 hours with 10% of transfection, cells were washed twice in PBS 1X for five

minutes and fixed for 10 min in Paraformaldehyde 4% at room temperature. After fixation,

the coverslips were permeabilized in PBS/0.05% Triton X-100 and then washed with 1x

PBS. After three washes a final wash in distilled water was performed to remove the excess

of salt. Finally, the coverslips were mounted with DAPI fluoromount-G (SouthernBiotech).

Images were acquired with an Olympus DS-Fi2 epifluorescence microscope furnished with

20X and 40X Olympus UplanFI equipped with a Nikon DS-fi2 camera operated with the

standard QC capture software (Q-Imaging).

2.7 Western Blotting

CHSE/F Cells (transfected and not transfected) were lysed in buffer containing 50 mM Tris

(pH 7.5), 120 mM, NaCl, 1 mM EDTA, 1% Triton X-100, protease inhibitor cocktail

(Sigma-Aldrich). Proteins were denatured at 95 ºC for 5 min, separated by SDS–

polyacrylamide gel electrophoresis (10-12%) and then were transferred to nitrocellulose

membranes (Millipore). The membrane was incubated with phosphate-buffered saline

containing 5% dehydrated skim milk to block non-specific protein binding during

subsequent incubation of the membrane with the antibody. The membrane was incubated

with anti-mCherry (1:2000, Abexxa), anti-Flag antibody (1: 2000, Millipore), anti-H2B

antibody (1:2000, Abcam) , followed by horseradish peroxidase conjugated goat anti-

mouse IgG antibody (1:5000, Invitrogen, USA). Bands on X-O-mat Blue films (AGFA)

were visualized via enhanced chemiluminescence (ECL detection kit; Amersham, USA)

according to the manufacturer`s instructions.

3.8 Genome edition on Human cell transfected with a novel LcU6ZF plasmid

HEK293-T were cultured in DMEM (Dulbecco's modified Eagle's medium; Gibco),

supplemented with 10% (v/v) fetal bovine serum (Gibco), 100 units/ml penicillin (Gibco)

and 100 μg/ml streptomycin (Gibco), and maintained at 37°C in an atmosphere of 95% air

and 5% CO2. Cells were transfected with LcU6ZF mcherry V2 or mock (containing filler

fragment) and LcU6ZF with three different sgRNAs (Table 1) using Calfectin agent

following manufacturer's recommendations (Calbiotech). Forty-eight hours after

transfection the cells were homogenized, and western blot was performed following the

same protocol mentioned above. The following primary antibodies were used: goat

polyclonal anti-CDNF (1:1,000, R&D Systems) and mouse monoclonal anti-GAPDH

(1:10,000, Millipore). For immunoblotting, horseradish peroxidase-conjugated antibodies

were used to detect goat and mouse primary antibodies (1:5,000, Invitrogen, USA).

3. RESULTS

3.1 Generation of a novel Lentiviral (construct) CRISPR/cas9 system in fish cells

The present study reveals a novel and easy method to express CRISPR/Cas9 system in the

fish cell line, CHSE/F. The vector LCU6ZF was adapted from mammalian to express

sgRNAS sgRNAs and the Cas9 nuclease in fish cells. The final plasmid was obtained by

replacing from the plasmid Lenti CRISPR-cas9 Puro V2 the selection marker puromycin

and inserting the cDNA of mCherry derived from the plasmid that FU-mCherry-W, (Fig. 1

A,B). Additionally, the U6 promoter sequence from zebrafish, containing the putative
TATA box domain (Shinya. et al 2013) was amplified by PCR (Fig. 1C) and cloned in the

new LcU6ZF plasmid replacing the U6 mammalian promoter. To assess the correct

construction of the LcU6ZF plasmid, a restriction analysis showed the release of the filler

fragment of 2Kb (Fig. 1D) when digested with the BsmBI restriction enzyme. Additionally

the double digestion with the BsmBI and KpnI restriction enzymes released the U6ZF

promoter and the filler fragment indicating that the U6 cassette was properly constructed

(Fig 1 A,D)

CHSE/F transfected cells expressing both sgRNA and Cas9

The functionality of the U6 and EFS-NS promoters to generate the sgRNA and Cas9

mRNA in the CHSE/F cells, was assessed by detecting RNA expression by RT-PCR. For

the expression of the sgRNAs, it was used the targeting oligos annealing at the 20 pbnts

that are part of the target sequence as a forward primer and the reversed primer was

designed from a sequence of the scaffold sgRNAs. The results showed that CHSE/F cell

transfected with the LcU6ZGsgGFP plasmid is able to generate a sgRNA as compared to

non-transfected cells (Fig. 2A). We also demonstrated that the EFS-NS mammalian

promoter, a constitutive elongation factor promoter in its shorter form, is able to drive the

expression of Cas9 mRNA in the transfected cells assessed by RT-PCR (Fig. 2B). In both

cases the expected sizes of the amplicons were obtained, and expression of the ubiquitin

gene was used as a control.

3.3 CHSE/F transfected cells express mCherry and Cas9 protein.

To further evaluate the functionality of the plasmid, an assessment of mCherry and Cas9

protein expression was carried out by fluorescent microscopy and western blot. CHSE/F
transfected cells with the LcU6ZFgRNAGFP plasmid showed cells conspicuously

expressing the mCherry protein, ninety-six hours after transfection with an efficiency of

10% (Fig. 2C-F). These results were consistent by the expression of mCherry by western

blot analysis (Fig 2G). Similarly, the expression of the Flag tagged Cas9 protein was

detected using the αFLAG antibody obtaining a specific signal at the expected size of 130

kDa in the CHSE/F transfected cells.

3.4 Human cell knocked-out CNDF protein using novel lentiviral vector for fish

Given the low efficiency of the transfection of the CHSE/F cells, and as a function proof of

the CRISPR-cas9 system, a mammalian model HEK293-T cells was transfected with three

plasmids containing three different sgRNAs, in addition to their mock vector. The

sgRNAsS were synthesized against the coding sequence of CDNF, a cerebral dopamine

neurotrophic factor that is expressed endogenously in the HEK293-T cells. After 48 hours

of transfection, cells were homogenized and western blot against CDNF was performed. As

shown in Figure 2H, the knock out for CDNF was effective in one of the three sgRNAsS

(clone 3) since almost no protein levels are observed, compared to the mock control. Taken

together, the plasmid containing Cas9 endonuclease, under EFS promoter, and sgRNA,

under U6 zebrafish promoter, is expressed in CHSE/F cells and the CRISPR-Cas9 system

is functional.

4. DISCUSSION

Several strategies based on CRISPR/Cas9 system have been used to modify genes in

different organisms. This communication presents a novel implementation and validation of

a CRISPR/Cas9 system to conduct genome editing in fish cell lines. This system was

developed in a lentiviral platform to use it to screen fish cell lines to investigate the role of

some genes in development and diseases. Here we demonstrate that both U6 and EFS-NS

promoters are functional in fish cell and surprisingly a bicistronic cassette based on 2A self-

cleaving peptide (2A) derived from porcine teschovirus 1 polyprotein (addgene), that is

widely use in mammalian cells, is able to regulate the simultaneous expression and the

cleavage of Cas9 and mCherry ORFs (addghene). The strategy of a two-cassette system for

the expression of the sgRNAs based on the RNA Pol III promoter U6, and the expression of

the Cas9 nuclease based on constitutive mammalian RNA pol II promoters is widely used

in mammalian [10]. Therefore, the adaptation of a similar system using the proper

promoters plays a critical role, including directing, regulating and targeting expression in

fish [13].

In this work, we use the EFS-NS promoter that is derived from the core promoter for

human elongation factor 1α to direct the expression of the Cas9 protein

(ADDGENEaddgene). The use of this promoter is based in the reports on salmonid [1] that

show that the long version of this promoter (EF1) efficiently is able to express the Green

Fluorescent Protein (GFP) in transgenic rainbow trout specie [1]. Initial studies with

transgenic fish were undertaken with gene promoters derived from mammalian genes or

viruses (Libro). These non-piscine promoters have been shown to be functional in fish, in

particular the CMV-IE promoter that has been amply used in different types of cell lines

and organism (Betancourt, 1993). However, higher promoter activity can result in higher

doses of gene expression, with an increased toxicity in eukaryotic cells [2,3]. This situation

has been reported for the mammalian CMV promoter, which has a constitute activity in fish

cells (Overtuf). The overexpression of Cas nuclease with strong promoters is not
recommended due to the toxicity and the off-target effect that may results from

overexpression (). The system developed in this paper used the EFS-NS promoter that is

adequate to express the Cas9 protein in fish cell line CHSE/F. The protein levels of Cas9

are clearly detected by Western blot analysis. Also in the cell expressing the mCherry, used

as a reporter of expression, not changes in morphology and viability were observed (data

not shown), major indicators of toxicity ( ). Although the EFS-NS promoter has been used

in several studies to edit genomes in mammalian organism in fish cells the activity of this

promoter should be less potent due to the evolutive distance from mammals, therefore, it

should be quite proper to direct the expression of the Cas9. Interestingly, the activity of the

EFS-NS promoter was also observed directly by mCherry expression that is the product of

the 2A induced cleavage separating it from the Cas9 protein. This proteolytic cleavage sites

between the two proteins is a sequence of 19 amino-acid (aa)-long that mediates the

“cleavage” or “translational skip” of polypeptides during translation in mammalian cells

[15]. Proteins linked by 2A sequence are co-expressed in all cell types, because cleavage

activity only depends on the ribosome, which is highly structurally conserved in eukaryotes

[23]. Although, previous studies have used 2A sequences to study the function of genes in

zebrafish [16], swine [17], fruit fly [18], and sheep species [19], this is the first report in

this fish cell. Indeed, the establishment of a multi-genes expression system (MGES) based

on 2A sequences have been widely applied in gene therapy to treat cancer and other

diseases [20,21] and to genetically modify organisms to create new functional or resistant

plants and animals [22].

The current study also demonstrated that U6ZF RNA pol III promoter is functional in

CHSE/F. This was totally expected as the U6ZF has been used to express shRNAs for

inhibition of gene expression in several fish studies. Although the mammalian U6 promoter
is functional in fish cells, we opted to use the U6ZF promoter due to high versatility to

other fish cell culture. The RNA polymerase type III (Pol-III) promoters such as U6 are

commonly used to express small RNAs, including short hairpin RNAs (shRNAs) and single

guide RNAs (sgRNAs and scaffold) [24]. The sequence (~300 pb) characterization from

Zebrafish was in accordance with the core promoter elements that regulates all U6 genes in

vertebrates, including TATA box, PSE and CCAAT box [25]. Thus, our strategy reveals for

the first time that the U6 promoter could drives the expression of GFP sgRNA and

downstream sequence (scaffold sequence) in CHSE/F cells in a CRISPR/Cas9 system. It

must be pointed out that this fish U6 promoter is also functional in humans, due to a

preliminary assay performed in HEK-293 cell culture, where we were able to corroborate

the knock-out of CNDF CDNF protein. Thus, our results suggest that the zebrafish U6

promoter can be used in functional studies of genes even in different cell lines.

The first approach to gene editing in a fish cell using the CRISPR Cas9 system was

performed by Dehler (2016). In this work the authors genetically engineered a CHSE/F cell

line to express Cas9 nuclease. Interestingly, in this system the sgRNA was delivery by

lipofection targeting the EGFP cell against GFP in which 34.6 % of cells were disrupted

(quenched). However, as stated by the authors, the lower rates of transfection in this cell

(CHSE/F) prevents the assessment of deeper functional studies. Therefore, the low rate of

transfection is a crucial step to tackle down. In this line, enhanced transfection protocols in

salmon cells have been evaluated in different lines of Atlantic salmon including TO, ASK

and SHK-1 with transfection rates ranging from 11.6 to 90.8% [11]. Despite these results,

the sophisticated electroporation technique used (including iAmaxa nucleofector system), is

expensive and laborious [11]. Therefore, the present study proposes a novel development

by using a lentiviral vector encoding the protein spCas9, driven by the EFS-NS
(mammalian) promoter, in a bicistronic cassette along with mCherry used as reporter gene.

A previous report showed that a type of zebrafish melanoma cell line can efficiently be

transduced with lentivirus, they tested and optimized vesicular stomatitis virus glycoprotein

(VSV-G) pseudotyped lentiviral vector transduction protocols [12].

The CRISPR/Cas9 system developed in this work could may be delivery by a lentivirus at

increasing transduction rates improving the editing of fish cells, which have been reported

to be difficult [8]. Further studies in CHSE/F should aim to edit the fish genome, for this,

after transfection FACS should be used to sort mCherry positive cells in order to obtain

enriched mutants’ cell according to Dehler (2016). Thus, this lentiviral platform could

allow massive screening in fish cell lines to determine the function of multiple gene and

their role in infectious diseases.

5. Acknowledgments

This work was financially supported by grant FONDECYT 3160370 from the National

Research Council Chile (CONICYT, Chile). We wish to express our gratitude to Dra.

Maria Rosa Bono and Leonardo Vargas of the University of Chile for his advice and help

during FACS assays.

6. Bibliography

[1] W.Y. Hwang, Y. Fu, D. Reyon, M.L. Maeder, S.Q. Tsai, J.D. Sander, R.T. Peterson,

J.-R.J. Yeh, J.K. Joung, Efficient In Vivo Genome Editing Using RNA-Guided

Nucleases, Nat. Biotechnol. 31 (2013) 227–229. doi:10.1038/nbt.2501.

[2] J.D. Sander, J.K. Joung, CRISPR-Cas systems for genome editing, regulation and
 targeting, Nat. Biotechnol. 32 (2014) 347–355. doi:10.1038/nbt.2842.

[3] A. Hruscha, P. Krawitz, A. Rechenberg, V. Heinrich, J. Hecht, C. Haass, B. Schmid,

Efficient CRISPR/Cas9 genome editing with low off-target effects in zebrafish,

Development. 140 (2013) 4982 LP-4987.

http://dev.biologists.org/content/140/24/4982.abstract.

[4] Y. Kimura, Y. Hisano, A. Kawahara, S. Higashijima, Efficient generation of knock-

in transgenic zebrafish carrying reporter/driver genes by CRISPR/Cas9-mediated

genome engineering, Sci. Rep. 4 (2014) 6545. doi:10.1038/srep06545.

[5] R.B. Edvardsen, S. Leininger, L. Kleppe, K.O. Skaftnesmo, A. Wargelius, Targeted

Mutagenesis in Atlantic Salmon (Salmo salar L.) Using the CRISPR/Cas9 System

Induces Complete Knockout Individuals in the F0 Generation, PLoS One. 9 (2014)

e108622. https://doi.org/10.1371/journal.pone.0108622.

[6] A. Wargelius, S. Leininger, K.O. Skaftnesmo, L. Kleppe, E. Andersson, G.L.

Taranger, R.W. Schulz, R.B. Edvardsen, Dnd knockout ablates germ cells and

demonstrates germ cell independent sex differentiation in Atlantic salmon, Sci. Rep.

6 (2016) 21284. http://dx.doi.org/10.1038/srep21284.

[7] M. Li, H. Yang, J. Zhao, L. Fang, H. Shi, M. Li, Y. Sun, X. Zhang, D. Jiang, L.

Zhou, D. Wang, Efficient and Heritable Gene Targeting in Tilapia by CRISPR/Cas9,

Genetics. 197 (2014) 591–599. doi:10.1534/genetics.114.163667.

[8] C.E. Dehler, P. Boudinot, S.A.M. Martin, B. Collet, Development of an Efficient

Genome Editing Method by CRISPR/Cas9 in a Fish Cell Line, Mar. Biotechnol.

 (NY). 18 (2016) 449–452. doi:10.1007/s10126-016-9708-6.

[9] L. Naldini, U. Blömer, P. Gallay, D. Ory, R. Mulligan, F.H. Gage, I.M. Verma, D.

Trono, In Vivo Gene Delivery and Stable Transduction of Nondividing Cells by a

Lentiviral Vector, Science (80-. ). 272 (1996) 263 LP-267.

http://science.sciencemag.org/content/272/5259/263.abstract.

[10] F. Dong, K. Xie, Y. Chen, Y. Yang, Y. Mao, Polycistronic tRNA and CRISPR

guide-RNA enables highly efficient multiplexed genome engineering in human cells,

Biochem. Biophys. Res. Commun. 482 (2017) 889–895.

doi:https://doi.org/10.1016/j.bbrc.2016.11.129.

[11] B.L. Schiøtz, E.G. Rosado, E.S. Baekkevold, M. Lukacs, S. Mjaaland, H. Sindre, U.

Grimholt, T. Gjøen, Enhanced transfection of cell lines from Atlantic salmon

through nucoleofection and antibiotic selection, BMC Res. Notes. 4 (2011) 136.

doi:10.1186/1756-0500-4-136.

[12] M. Fazio, S. Avagyan, E. van Rooijen, W. Mannherz, C.K. Kaufman, R. Lobbardi,

D.M. Langenau, L.I. Zon, Efficient Transduction of Zebrafish Melanoma Cell Lines

and Embryos Using Lentiviral Vectors, Zebrafish. 14 (2017) 379–382.

doi:10.1089/zeb.2017.1434.

[13] Y. Wang, F. Wang, R. Wang, P. Zhao, Q. Xia, 2A self-cleaving peptide-based multi-

gene expression system in the silkworm Bombyx mori, Sci. Rep. 5 (2015) 16273.

http://dx.doi.org/10.1038/srep16273.

[14] Y. Takeuchi, G. Yoshizaki, T. Takeuchi, Green Fluorescent Protein As a Cell-

 Labeling Tool and a Reporter of Gene Expression in Transgenic Rainbow Trout,

Mar. Biotechnol. 1 (1999) 448–457. doi:10.1007/PL00011801.

[15] Z. Liu, O. Chen, J.B.J. Wall, M. Zheng, Y. Zhou, L. Wang, H. Ruth Vaseghi, L.

Qian, J. Liu, Systematic comparison of 2A peptides for cloning multi-genes in a

polycistronic vector, Sci. Rep. 7 (2017) 2193. doi:10.1038/s41598-017-02460-2.

[16] J.H. Kim, S.-R. Lee, L.-H. Li, H.-J. Park, J.-H. Park, K.Y. Lee, M.-K. Kim, B.A.

Shin, S.-Y. Choi, High Cleavage Efficiency of a 2A Peptide Derived from Porcine

Teschovirus-1 in Human Cell Lines, Zebrafish and Mice, PLoS One. 6 (2011)

e18556. https://doi.org/10.1371/journal.pone.0018556.

[17] W. Deng, D. Yang, B. Zhao, Z. Ouyang, J. Song, N. Fan, Z. Liu, Y. Zhao, Q. Wu, B.

Nashun, J. Tang, Z. Wu, W. Gu, L. Lai, Use of the 2A Peptide for Generation of

Multi-Transgenic Pigs through a Single Round of Nuclear Transfer, PLoS One. 6

(2011) e19986. https://doi.org/10.1371/journal.pone.0019986.

[18] R.W. Daniels, A.J. Rossano, G.T. Macleod, B. Ganetzky, Expression of Multiple

Transgenes from a Single Construct Using Viral 2A Peptides in Drosophila, PLoS

One. 9 (2014) e100637. https://doi.org/10.1371/journal.pone.0100637.

[19] Y. Tian, W. Li, L. Wang, C. Liu, J. Lin, X. Zhang, N. Zhang, S. He, J. Huang, B. Jia,

M. Liu, Expression of 2A peptide mediated tri-fluorescent protein genes were

regulated by epigenetics in transgenic sheep, Biochem. Biophys. Res. Commun. 434

(2013) 681–687. doi:https://doi.org/10.1016/j.bbrc.2013.04.009.

[20] A.D. Simmons, M. Moskalenko, J. Creson, J. Fang, S. Yi, M.J. VanRoey, J.P.
 Allison, K. Jooss, Local secretion of anti-CTLA-4 enhances the therapeutic efficacy

of a cancer immunotherapy with reduced evidence of systemic autoimmunity,

Cancer Immunol. Immunother. 57 (2008) 1263. doi:10.1007/s00262-008-0451-3.

[21] J. Fang, J.-J. Qian, S. Yi, T.C. Harding, G.H. Tu, M. VanRoey, K. Jooss, Stable

antibody expression at therapeutic levels using the 2A peptide, Nat. Biotechnol. 23

(2005) 584. http://dx.doi.org/10.1038/nbt1087.

[22] S.-H. Ha, Y.S. Liang, H. Jung, M.-J. Ahn, S.-C. Suh, S.-J. Kweon, D.-H. Kim, Y.-M.

Kim, J.-K. Kim, Application of two bicistronic systems involving 2A and IRES

sequences to the biosynthesis of carotenoids in rice endosperm, Plant Biotechnol. J.

8 (2010) 928–938. doi:10.1111/j.1467-7652.2010.00543.x.

[23] P. Sharma, F. Yan, V.A. Doronina, H. Escuin-Ordinas, M.D. Ryan, J.D. Brown, 2A

peptides provide distinct solutions to driving stop-carry on translational recoding,

Nucleic Acids Res. 40 (2012) 3143–3151. doi:10.1093/nar/gkr1176.

[24] M. Shinya, K. Kobayashi, A. Masuda, M. Tokumoto, Y. Ozaki, K. Saito, T.

Kawasaki, Y. Sado, N. Sakai, Properties of gene knockdown system by vector-based

siRNA in zebrafish, Dev. Growth Differ. 55 (2013) 755–765.

doi:10.1111/dgd.12091.

[25] S. Boonanuntanasarn, S. Panyim, G. Yoshizaki, Characterization and organization of

the U6 snRNA gene in zebrafish and usage of their promoters to express short

hairpin RNA, Mar. Genomics. 1 (2008) 115–121.

doi:https://doi.org/10.1016/j.margen.2008.10.001.
[26] B.D. Hornstein, D. Roman, L.M. Arévalo-Soliz, M.A. Engevik, L. Zechiedrich,

Effects of Circular DNA Length on Transfection Efficiency by Electroporation into

HeLa Cells, PLoS One. 11 (2016) e0167537. doi:10.1371/journal.pone.0167537.

FIGURE LEGENDS

Figure 1. A simplified diagram of the development of a new lentiviral CRISPR Cas9

vector in fish cells. (A) In the left panel and in colors are represented the names and size of
the regulatory elements including RNA pol III U6 (U6), EFS-NS-NF promoters, the
antibiotic resistance cassette (Puromycin) and mCherry gene. The novel fish U6 promoter
ligated in the new vector is represented in yellow. In orange are highlighted the recognition
sequences of the restriction enzymes used in this work (BsiWI, SacII, KpnI and BsmBI
respectively). Arrows indicate the downstream activity of U6 (yellow) and EFS-NS-NF
(violet) promoters. Note that lentiviral elements were omitted in this representation. (B)
Molecular characterization and isolation of mCherry gene from FU-mCherry-w plasmid
(lane 1). In lane 2, a single 0,7 kb fragment (red frame) corresponding to mCherry sequence
was obtained by double digestion (BsiWI and SacII). Lane 3 represents the LentiCRISPR-
cas9 PuroV2 (14 kb) vector, whereas the isolation and removal of Puromycin cassette 1,3
kb fragment (red frame) was obtained using the same enzymes mentioned above. (C) PCR
product of U6 promoter from Zebrafish genomic DNA; and (D) the new vector LCU6ZF
containing the new fish promoter (0,3 kb) highlighted in red, as well as filler fragment (2
kb).

Figure 2. Expression of the sgRNA, Cas9 and mCherry in CHSE/F transfected cells.
(A) and (B): RT-PCR analysis of the sgRNA (300 bp) and Cas9 and (131 bp) expression,
respectively. Expression were normalized with the ubiquitin housekeeping gene (image
located below). Distilled water was used instead of template as the negative control (Data
not shown). (C) to (F): Microscopy of fluorescence imaging. Arrow depicts the mCherry
expressing cells at 96 hours post-transfection. Bar = 25 and 50 µm. (G) Western blot
analysis of Cas9 and mCherrry in CHSE/F transfected cells. The Cas9 and mCherry
proteins were immunodetected using a FLAG antibody (130 kDa) and mCherry antibody
(35 kDa) respectively. H2B serves as a loading control (14 kDa). (H) HEK293-T cells were
transfected with LcU6ZF (mock) and three different plasmids containing sgRNAs against
CDNF, a neurotrophic factor. Forty-eight hours later western blot was performed to detect
protein levels of CDNF. GAPDH was used as loading control.
Fig.1
Fig. 2
Supplemental data 1

Table 1. Oligo and sequences

Name Sequence 5´- 3´

U6ZF_F GTGTGGTACCACCTCAACAAAAGCTCCTCGATGT

U6F_R CAACCGTCTCCGGTGTGGGAGTCTGGAGGACGGCTATATA

sgRNA_GFPA CACCGGGTGAACCGCATCGAGCTGA

sgRNA_GFPB AAACTCAGCTCGATGCGGTTCACCC

Ubq_F (214) GGAAAACCATCACCCTTGAG

Ubq_R (214) ATAATGCCTCCACGAAGACG

FwdGFPPCR GGTGAACCGCATCGAGCTGA

RvgRNAscaffold ACCGACTCGGTGCCACTTTT

sgRNA1CDNF-A CACCGA CTT GGC GTC GGT GGA CCT G

sgRNA1CDNF-B AAACCAGGTCCACCGACGCCAAGTC C

sgRNA2CDNF-A CACCTTGTATCTCGAACCCTGTGC

sgRNA2CDNF-B AAACGCACAGGGTTCGAGATACAAC
Supplemental data 2

Cell sorting of CHSE/F transfected with pGFP plasmid at 96 hours post tranfection