f u n g a l b i o l o g y 1 2 0 ( 2 0 1 6 ) 9 1 7 e9 3 0

journal homepage: www.elsevier.com/locate/funbio

Ergot species of the Claviceps purpurea group from

South Africa


Elna J. VAN DER LINDEa,*, Kamila PESICOV A b,c, Sylvie PAZOUTOV

 b,
A
Eva STOD ULKOVA b, Miroslav FLIEGERb, Miroslav KOLAR
IKb,**
a
Biosystematics Division, Plant Protection Research Institute, Agricultural Research Council, Private Bag X134,
Pretoria 0121, South Africa
b
Laboratory of Fungal Genetics and Metabolism, Institute of Microbiology, Academy of Sciences of the Czech

ska
Republic, v.v.i., Vıden  1083, 142 20 Praha 4, Czech Republic
c
Department of Botany, Faculty of Science, Charles University in Prague, Bena tska
 2, 128 01 Praha 2, Czech Republic

article info abstract

Article history: Results of a survey and study of the Claviceps purpurea group of species in South Africa are
Received 29 January 2016 being presented and five new species are described. Morphological descriptions are based
Received in revised form on the anamorphs and four nuclear genetic loci. Claviceps fimbristylidis sp. nov. on Fimbris-
13 April 2016 tylis complanata was discovered wide-spread across five provinces of the country associated
Accepted 9 May 2016 with water and represents the fourth Claviceps species recorded from the Cyperaceae. Clav-
Available online 24 May 2016 iceps monticola sp. nov. is described from Brachypodium flexum growing in mountain forests
Corresponding Editor: in Mpumalanga Province, as well as the northern Drakensberg southwards into the Eastern
Kerry O’Donnell Cape Province. Claviceps pazoutovae sp. nov. is recorded from Stipa dregeana var. dregeana
and Ehrharta erecta var. erecta, also associated with these mountain ranges. Claviceps macro-
Keywords: ura sp. nov. is recorded from Cenchrus macrourus from the Eastern Cape and Claviceps capen-
Alkaloids sis sp. nov. from Ehrharta villosa var. villosa is recorded from the Western Cape Province.
Cyperaceae Claviceps cyperi, only recorded from South Africa is included in the study. Ergot alkaloid pro-
Phylogeny files of all species are provided and showed similarity to C. purpurea. Only C. cyperi and in
Plant pathogens lesser degree C. capensis, C. macroura, and C. pazoutovae produced ergot alkaloids in clini-
Poaceae cally significant amounts. Several reported species infect invasive grass species, native
Taxonomy to South Africa, and thus represent potentially invasive species.
ª 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Introduction
Africa is home to numerous invasive grasses which destroyed
natural grass ecosystems over the world (Williams & Baruch
2000; Foxcroft et al. 2010). It was also shown that as a result,
their specific ergot species expanded their host range e.g. Clav-
iceps africana, Claviceps cynodontis, Claviceps fusiformis, and
Claviceps sulcata and are now spread all over the world (viz.
Paz
outova et al. 2011). A crucial step in the monitoring of ergot
host ranges, geographical distribution, and possible invasion
is the characterisation of their host spectrum on native Afri-
can grasses. Although some studies on Zimbabwean species
(previously known as Rhodesia) were performed by authors
such as Loveless (1964a, 1967), Loveless & Herd (1964), and

* Corresponding author. Tel.: þ27 12 808 8288; fax: þ27 12 808 829.
** Corresponding author. Tel.: þ420 29644 2332; fax: þ420 29644 2347.
E-mail addresses: VDLindeE@arc.agric.za (E. J. van der Linde), mkolarik@biomed.cas.cz (M. Kola
rık).
http://dx.doi.org/10.1016/j.funbio.2016.05.006
1878-6146/ª 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.
918
Paz
outova et al. (2008a, 2011), no single comprehensive study
of the South African species has been done; existing research
papers on southern African species mostly describe single or
groups of species, most of which were introduced due to the
introduction of their hosts, usually for forage purposes.
The Claviceps purpurea species group is a phylogenetically
well-defined lineage of the closely related species Claviceps
arundinis, Claviceps grohi, Claviceps humidiphila, Claviceps nigri-
cans, C. purpurea, Claviceps spartinae, and Claviceps zizaniae

outova
(Lorenz et al. 2009; Paz  et al. 2011, 2015). Among all ergot
species, the most potent producers of ergot alkaloids, espe-
cially pharmaceutically and ecotoxicologically important
ergopeptines, form part of this species group (Lorenz et al.
2009). Only two species from this group have been identified
in South Africa to species level namely C. purpurea (with
a wide host range including mostly introduced hosts such as
Lolium), as well as Claviceps cyperi (on Cyperus esculentus). The
conidia seemed to be the only tool for identification of these
old herbarium specimens. Although the conidia of Claviceps
species vary considerably in shape and size, for some species
these features are often quite distinctive; in addition, the
range of size as well as length/width (L/W) ratio is a useful
character as an accessory to shape in the delimiting of species
(Langdon 1954). Loveless (1964b) also demonstrated the use
and value of the morphology of the conidia when examining
herbarium material and concluded that in many cases they
form discriminating taxonomic markers and that these char-
acteristics have to be relied upon especially when examining
old herbarium specimens.
According to Paz
outova et al. (2011), numerous Claviceps
anamorphs are deposited in herbaria, but few were formally
described as the essential teleomorph was lacking. They also
stated that others have found that these conidial dimensions
vary considerably in different collections of the same species
(viz. Muthusubramanian et al. 2005; Paz
outova  &
Frederickson 2005) and that care should be taken to use these
characters in combination with other morphological e and in
recent times, also molecular characters. Paz  et al. (2011)

outova
concluded that the coidentification of dated Claviceps herbar-
ium specimens for which cultures and DNA sequences are
available is crucial for establishing past and recent distribu-
tions and migrations of species. However, despite this vari-
ability, conidial shape and length/width ratio are often the
only useful markers for the identification of recently found
anamorphs by comparison with herbarium specimens of de-
scribed Claviceps species (Paz
outova  et al. 2011).
In a comprehensive study, we screened ergotised grasses
in South Africa which included invasive grass species from
the genus Ehrharta and Cenchrus. In this paper we are describ-
ing five new species from the C. purpurea species complex;
members of this species group were overlooked in South
Africa so far.
Materials and methods
Herbarium specimens
Apart from the collections done over the past 8 y, other
relevant unidentified specimens of ergotised grasses in
E. J. van der Linde et al.
the dried herbarium collection of the South African Na-
tional Collections of Fungi (PREM) have been examined
and are included in this study. Cultures generated have
also been deposited in its live culture collection (PPRI) as
well as in the Culture Collection of Clavicipitaceae at Insti-
tute of Microbiology, Academy of Sciences of the Czech Re-
public (CCC). Isotypes of some specimens have been
deposited in the National Museum in Prague (PRM).
Isolates and their cultivation. Sclerotia were surface sterilized
for 3 min with 1 % sodium hypochlorite, rinsed three times in
sterilized distilled water, and plated onto Potato Dextrose
Agar (PDA) containing antibiotics. Honeydew drops found on
florets of infected grasses were plated onto Water Agar (WA)
agar plates containing antibiotics and agar pieces containing
germinating macroconidia were subsequently transferred
onto PDA (Paz
outova  et al. 2015). Isolates are being maintained
in the PPRI and CCC collection on PDA agar punches covered
with sterile water, PDA slants covered with sterile liquid par-
affin, by ultra-low freezing as well as freeze dried cultures
(Table 1).
Alkaloid analysis
Sample preparation and alkaloid extraction. Pulverized sclerotia
(10 mg) were mixed with extraction mixture consisting of tol-
ueneeethyl alcohol mixture (4:1, v:v, 0.5 mL) and gently stirred
for 1 h. Supernatant was separated by centrifugation and kept
in the freeze until use (M.F., unpubl.).
High-performance liquid chromatography (HPLC) analyses. The
HPLC system consisted of a pump equipped with a 600E sys-
tem controller, auto-sampler 717, and dual UV detector 2487
(Waters, Milford, MA, USA). The data were processed using
Empower 2 software. Water containing mobile phases were
filtered through a 0.22 mM GS filter (Millipore, Billerica, MA,
USA) and degassed in an ultrasonic bath for 10 min before use.
A Luna 5 m C18(2) column (250  4.6 mm, Phenomenex)
with a guard column was used for the analysis. The mobile
phase consisted of: A.) 10 % acetonitrile in water with
KH2PO4 (9.18 g 1 L1; pH adjusted at 3.12) and B.) acetoni-
trile. Gradient elution: 10 % B (0 min), increasing linearly
to 35 % B (40 min), increasing linearly to 65 % B (10 min).
Each analysis was followed by a column washing (65 % B,
10 min) and equilibration step (10 % B, 10 min). Flow rate,
1.0 mL min1. UV detection was performed at 288 and
315 nm, respectively.
Calibration. A standard solution of ergotamine was pre-
pared in methanol at final concentrations of 62.5, 125, 250,
500, and 1000 mg mL1. The calibration graphs were con-
structed by plotting the integrated peak areas of individual
compounds versus concentration. The linear regression equa-
tion ( y ¼ 5946.4x) and correlation coefficient (r ¼ 0.997), were
obtained.
Taxonomy. Following Paz  et al. (2011), we have cho-

outova
sen to describe new species from the asexual stage of develop-
ment in the otherwise teleomorphic genus Claviceps.
Descriptions are based on the appearance of macroconidia
and sclerotia, and a sequence of the nuclear ribosomal DNA
region (nrDNA), minichromosome maintenance complex
component 7 (MCM7) gene, elongation factor-1a gene (EF1-a),
and beta-tubulin gene (Tub2).
 Ergot species of the C. purpurea group from South Africa
Table 1 e Specimens included in the phylogenetic study, with EMBL accession numbers of their DNA sequences. Holotypes are marked with an asterisk.
Species Specimen Culture reference Host Location Lm  Wma Qmb nrDNA (ITS/LSU) MCM7 EF1-a Tub2
reference

capensis *PREM 61148 CCC 1504; PPRI 16249 & Ehrharta villosa var. villosa Constantia Neck, Cape Town, SA 6.7  3.9 1.7 LN846837 LN846890 LN846862 LN846876
16250
cyperi PREM 61132 CCC 1476; PPRI 16223 Cyperus esculentus Bredell, Kempton Park, Gauteng, 13.7  4.2 3.3 LN846842 n.d. n.d. n.d.
SA
cyperi PREM 60647 CCC 1219; PPRI 10436 Cyperus esculentus Kempton Park, Gauteng, SA 9.8  3.5 2.8 LN846852 LN846884 LN846865 LN846879
cyperi PREM 61149 CCC 1215 & 1217; PPRI 10430 Cyperus esculentus Villiers, Free State Province, SA 9.8  3.5 2.8 LN846853 LN846883 LN846866 LN846878
& 10433
fimbristylidis *PREM 61127 CCC 1472 & 1473; PPRI 16239 Fimbristylis complanata Bronkhorstspruit, Gauteng, SA 8.5  3.6 2.4 LN846841 LN846885 LN846859 LN846872
& 16240
fimbristylidis PREM 60662 CCC 1207e1214; PPRI Fimbristylis complanata Retiefklip, Drakensberg, KZN, SA 8.7  3.8 2.3 LN846854 LN846882 LN846867 LN846877
10563e65, 67, 69e72 LN846855
macroura PREM 61135 CCC 1482; PPRI 16245 Cenchrus macrourus Hogsback, Eastern Cape Province, 7.1  3.5 2.0 LN846844 LN846886 LN846863 LN846873
SA
monticola PREM 61280 PPRI 20146, PPRI 20192 Brachypodium flexum Machadodorp, Mpumalanga, SA 7.4  3.2 2.3 LN880551 LN880553 LN880552 n.d.
monticola *PREM 61136 CCC 1483 & 1484; PPRI 16234 Brachypodium flexum Hogsback, Eastern Cape Province, 7.0  3.1 2.3 LN846845 LN846889 LN846860 LN846875
& 16235 SA
monticola PREM 611441 CCC 1496 & 1497; PPRI 16232 Brachypodium flexum Royal Natal National Park, 7.4  3.1 2.4 LN846836 n.d. n.d. n.d.
& 16233 KwaZulu-Natal, SA
monticola PREM 61119 CCC 1421e1423 Brachypodium flexum Royal Natal National Park, n.d. n.d. LN846856 n.d. n.d. n.d.
KwaZulu-Natal, SA
monticola PREM 60852 CCC 1222 & 1229; PPRI 11976 Brachypodium flexum Royal Natal National Park, 6.5  2.3 2.8 LN846851 LN846888 LN846864 LN846881
& 11983 KwaZulu-Natal, SA LN846846 LN846887 LN846857 LN846880
pazoutovae PREM 61143 CCC 1494 & 1495; PPRI 16254 Ehrharta erecta var. erecta Royal Natal National Park, 5.7  2.3 2.5 LN846838 LN846892 LN846861 LN846874
& 16255 KwaZulu-Natal, SA
pazoutovae *PREM 61137 CCC 1485; PPRI 16247 Stipa dregeana var. dregeana Hogsback, Eastern Cape Province, 7.1  3.5 2.0 LN846840 LN846891 LN880554 LN880555
SA
pazoutovae PREM 61134 CCC 1477; PPRI 16246a & b Stipa dregeana var. dregeana Royal Natal National Park, 7.4  3.2 2.3 LN846843 n.d. n.d. n.d.
KwaZulu-Natal, SA
pazoutovae Honeydew CCC 1424e1426 Ehrharta erecta var. erecta Royal Natal National Park, 5.9  2.3 2.6 LN846849 n.d. n.d. n.d.
depleted; KwaZulu-Natal, SA LN846850
no specimen
pazoutovae PREM 61150 CCC 1393; PPRI 9537 Stipa dregeana Hogsback, Eastern Cape Province, 7.2  3.0 2.4 LN846847 n.d. LN846858 LN846871
SA
pazoutovae PREM 61150 CCC 1397; PPRI 9543 Stipa dregeana Hogsback, Eastern Cape Province, 7.1  3.2 2.2 LN846848 n.d. n.d. n.d.
SA

a Lm e mean spore length (arithmetical mean of all spores, mm), Wm e mean spore width (arithmetical mean of all spores, mm).
b Qm e the mean of quotients of spore length and spore width in any one spore.

919
920 E. J. van der Linde et al.

Fig 1 e Bayesian phylogenetic inference based on four gene dataset showing position of species from the Claviceps purpurea
species group. Specimens studied during our study are printed in bold. The outgroup branch is fourth times shortened for
visual reasons. Thick branches indicate Bayesian posterior probabilities [ 1.00.

Morphology
Conidia were washed off sclerotia from plant specimens and
used for observations and measurement of conidial size.
Spores were mounted in a drop of water and photographed
and measured using a Zeiss Axio Scope A1. Microscope prep-
arations were made in water and observed with an Axio Scope
A1 microscope (Carl Zeiss, Jena) using differential interference
contrast (DIC) illumination. The measurements were done on
photos recorded with a ProgRes SpeedXTcore 5 digital camera
(Jenoptik Optical Systems, Jena) using the ProgRes image pro-
cessing software. At least 30 conidia measurements per spec-
imen were performed. The statistical treatment of spore size
data was done using KyPlot 2.0 beta 15 (Yoshioka 2002).
DNA extraction, amplification, and sequencing
DNA was purified from 4e7-d old mycelium grown on T2
plates using an ArchivePure DNA Yeast & Gram  Kit (5 PRIME,
Hamburg) as described in Paz
outova  et al. (2015). Nuclear ribo-
somal DNA containing internal transcribed spacers (ITS1 and
ITS2), 5.8S, and the 50 end of the large subunit ribosomal RNA
gene (LSU) was amplified with primer pair ITS1F-KYO2/NL4
(ca. 1.2 kbp) (O’Donnell 1993; Toju et al. 2012). The MCM7
gene (ca. 0.46 kbp) was amplified and sequenced with new
designed primer pair CARCA-F (CARCACAARAAGGCN-
TAYAGC) and M456-5R (TGTTCCATGACTTCGTGGAT). Primers
EF1-983F/EF1-2218R were used for amplification of the EF1-
a gene (ca. 1.0 kbp) (Rehner & Buckley 2005). The same primers
were also used for DNA sequencing. The Tub2 gene (ca. 1.5 kbp)
was amplified with primer pair T1/T22 and it was sequenced
with primers T2 and T12 (O’Donnell & Cigelnik 1997). The
PCR reaction conditions in a Mastercycler Gradient thermocy-
cler (Eppendorf, Hamburg, Germany) were as follows: one cy-
cle of 3 min at 95  C, 30 s at 55  C, and 1 min at 72  C; 30 cycles
of 30 s at 95  C, 30 s at 55  C, and 1 min at 72  C; one cycle 30 s at
95  C, 30 s at 55  C, and 10 min at 72  C. The reaction mixture
consisted of 1 U of PerfectTaq DNA polymerase (5 Prime) or
PerfectTaq Plus DNA polymerase (5 Prime) or Maximo Taq
Polymerase (GeneON), respective PCR buffer, 0.2 mM deoxy-
nucleotides, 2 pmol of each primer, and 5e50 ng of DNA in
25 ml of total volume. Custom sequencing of DNA was per-
formed at Macrogen Inc. (Seoul, Korea).
Phylogenetic analysis
The phylogenetic position of new species in the genus Clavi-
ceps was established using single locus analysis and
Ergot species of the C. purpurea group from South Africa 921

multilocus analysis. The rDNA dataset consisted of 29 isolates

Relative content [%]

(Online Resource 1), from which 12 were selected for multi-
gene analysis (Fig 1). The dataset of nrDNA contained 29 se-
quences and consisted of 1326 positions (87 parsimony

0.03
0.01
0.22
0.95
0.72
2.12
0.02
informative, 204 variable, 115 singleton, and 1067 conserved).
The number of positions after Gblocks curation was 1110 (83 %
of the original 1326 positions) (44 parsimony informative, 134
variable, 90 singleton, and 976 conserved). Sequences were
aligned using MAFFT (Katoh & Toh 2008) and curated in
Total [mg g1]

Gblocks software (Castresana 2000). A suitable model for

0.27
0.15
2.20
9.46
7.23
21.17
0.24
each locus was selected using MEGA6 (Tamura et al. 2013):
K2 þ G (nrDNA, MCM7), TN93 þ G (EF1-a), HKY þ G (Tub2),
TN93 þ G þ I (concatenated dataset). The aligned concate-
nated dataset (20 sequences) consisted of 4301 positions (in-
Rt ¼ 27.63 min

cluding gaps), 322 of them were parsimony informative, 783

of them were variable, 451 of them were singleton, and 3405
129.98
71.48

of them were conserved. The new number of positions after

Gblocks curation was 3982 (92 % of the original 4301 positions).
Two hundred and sixty (260) of them were parsimony infor-
mative, 678 of them were variable, 418 of them were singleton,
Ergocristine

and 3304 of them were conserved. The MCM7, EF1-a, and Tub2
datasets for single locus analysis were created from the con-
catenated curated dataset.
Bayesian phylogenetic analyses were performed by using
MrBayes v3.2.4 (Ronquist et al. 2012). A metropolis-coupled
a-Ergocryptine

Markov chain Monte Carlo search algorithm with 10 000 000

Table 2 e Quantitative and qualitative analysis of ergot alkaloids in six studied Claviceps species.

20 588.14
213.90
31.53
1922.24
575.95
634.47

generations was used. Burnin was determined with Tracer

1.4 (http://tree.bio.ed.ac.uk/software/tracer) and discarded.
Epichlo€e typhina X52616 was used as a sister group to the Clav-
iceps purpurea lineage based on nrDNA phylogeny of the whole
genus (data not shown). All datasets were deposited in Tree-
Ergocornine

BASE database (http://treebase.org), accession number 18831

40.04
14.56
34.18

4.02
234.17
198.58
53.89

(https://treebase.org/treebase-web/search/study/summar-
y.html?id¼18831).
Ergotamine

Results

Phylogeny
Ergosine

20.99
102.43

8645.76
6394.69
393.04
168.24

All studied species can be distinguished based on ITS rDNA, as

well as using single protein coding genes (Online Resource 1,
2). Bayesian analysis of the concatenated multigene dataset
separated species of the Claviceps purpurea species group into
Ergometrine

three main lineages (Fig 1). The first lineage consists of the
247.87

species Claviceps cyperi, Claviceps grohii, Claviceps nigricans,

and the newly described Claviceps fimbristylidis. This lineage
is homogenous in its ecology (growing in wetlands), and its
host specificity to sedges (Poales: Cyperaceae). The second lin-
Specimen no.

eage includes Claviceps arundinis, Claviceps humidiphila, Clavi-

339
361
342
369
337
328
305
165
144

ceps spartinae, and Claviceps zizaniae, of which the species

CS
CS
CS
CS
CS
CS
CS
CS
CS

seem to be host specific to the level of subfamily of grasses

from the Poaceae family. Species from this group live in hu-
mid locations or directly in wetlands. The third lineage is
fimbristylidis
fimbristylidis
fimbristylidis

formed by C. purpurea which is basal to the group of species

pazoutovae
monticola
monticola

macroura

described in this study e Claviceps macroura, Claviceps capensis,

capensis
Species

cyperi

Claviceps pazoutovae, and Claviceps monticola. Ecologically this

lineage infects four subfamilies of Poaceae and contains spe-
C.
C.
C.
C.
C.
C.
C.
C.
C.

cies growing in grasslands including mountainous habitats.

922
Fig 2 e Claviceps capensis (PREM 61148T, culture PPRI 16249). (A) Sclerotia on Ehrharta villosa. (B) Sclerotium (bar 10 mm). (C)
Macroconidia (bar 10 mm). (D) Culture on medium PDA (21 d old).
An exception is C. macroura, which infect Cenchrus (Panicoi-
deae), a grass group associated with humid locations.
Alkaloids
Sclerotia of the studied species contained alkaloids typically
found in Claviceps purpurea, a well-studied member of this spe-
cies group (Table 2). Only three species, Claviceps capensis,
Claviceps cyperi, and Claviceps macroura produced alkaloids in
amounts reaching 7 mg g1 or higher. The total amount pro-
duced by other species was minute.
Taxonomy
Claviceps capensis E. van der Linde, K. Pe
sicova
 , M. Kola
rık,
sp. nov.
MycoBank No.: MB815478, Fig 2.
Typification. SOUTH AFRICA. WESTERN CAPE PROVINCE:
Cape Town, Constantia Neck, on Ehrharta villosa var. villosa,
Sep. 2013, Alan Wood, CS 369 (holotype PREM 61148). Isotype
PRM 933998. Ex-type culture CCC 1504, additional cultures
CCC 1505, PPRI 16249, 16250. See Table 1 for accession
numbers.
Etymology. Based on its limited distribution, the Western
Cape Province, South Africa.
Geographic distribution/host range. South Africa: Western
Cape Province on Ehrharta villosa var. villosa.
E. J. van der Linde et al.
Specimens examined. SOUTH AFRICA. CAPE PROVINCE:
Cedarberg, on Ehrharta calycina, Jan. 1948, N.J.G. Smith (as
C. purpurea, PREM 41843); CAPE PROVINCE: Cape Town,
Lions Head, on Ehrharta calycina, Jan. 1921, M.R.H. Thomson
(as C. purpurea, PREM 14266); CAPE PROVINCE: Kirsten-
bosch, on Ehrharta sp., Dec. 1920, I.B. Pole Evans (as C. pur-
purea, PREM 14249).
Diagnosis. Macroconidia hyaline, distinctively ovoid to
broadly cylindric (5.2e)5.7e8.6(e9.1)  (2.5e)
3.0e4.7(e5.2) mm, mean 6.7  3.9 mm. Sclerotia brown to
dark brown, protruding, 15  2 mm. Teleomorph not
observed.
Cultural characteristics. Colonies (21 d, 24  C) on PDA 30 mm
in diameter, aerial mycelium off-white, buff reverse fading
towards the margin; velutinous, with diffuse margin.
Commentary. C. capensis is phylogenetically closest to C.
macroura and is grouped in a clade separate from C. pazou-
tovae. Conidia of C. capensis are distinctively ovoid with an
L/W ratio of 1.7, which clearly distinguishes it from both
these species. It shares its host genus Ehrharta with that
of C. pazoutovae, also described here, which includes iso-
lates and specimens from Ehrharta erecta var. erecta and E.
calycina. Together with its molecular data, C. capensis is dis-
tinct from any other previously described species. Ehrharta
villosa var. villosa is recorded as endemic to South Africa
and noted on the South African National Botanical Insti-
tute’s endangered list (http://redlist.sanbi.org/, accessed
22 Oct. 2015). Closely related Ehrharta villosa var. maximensis
has however been introduced to other parts of the world to
stabilize sand dunes and is now recorded to be a serious
Ergot species of the C. purpurea group from South Africa
Fig 3 e Claviceps cyperi (PREM 61132, culture PPRI 16223). (A) Sclerotia on Cyperus esculentus. (B) Sclerotium (bar 10 mm). (C)
Macroconidia (bar 10 mm). (D) Culture on medium PDA (21 d old).
invasive weed in Australia and New Zealand (CABI 2015).
There is no report of ergotised Ehrharta villosa outside of
South Africa.
Claviceps cyperi Loveless
MycoBank No.: MB328385, Fig 3 e included as species of the
C. purpurea group, only recorded from South Africa.
Typification. SOUTH AFRICA. GAUTENG: Pretoria, on Cyperus
esculentus, Apr. 1944, E.J. Scott (holotype PREM 34102,
Loveless 1967).
Etymology. Referring to the name of the host, Cyperus
esculentus.
Geographic distribution/host range. South Africa: widely dis-
tributed in association with its host which is a common
weed in Gauteng, Free State, KwaZulu-Natal, and Mpuma-
langa Provinces; on Cyperus esculentus and Cy. rotundus.
Specimens examined. SOUTH AFRICA. GAUTENG: Kempton
Park, Bredell, on Cyperus esculentus, Mar. 2014, W.M. Kriel,
CS 328 (PREM 61132), cultures CCC 1476, PPRI 16223; GAU-
TENG: Kempton Park, Bredell, on Cyperus esculentus, Mar.
2013, W.M. Kriel, CS 226 (PREM 61115); GAUTENG: Kempton
Park, on Cyperus esculentus, Mar. 2011, E.J. van der Linde, CS
124 (PREM 60647), cultures CCC 1219, PPRI 10436. FREE
STATE PROVINCE: Villiers, along N3 highway, on Cyperus
esculentus, Mar. 2010, E.J. van der Linde, CS 83 (PREM 61149),
cultures CCC 1215, 1217, PPRI 10430, 10433.
Commentary. Originally described by Loveless (1967) from
Cyperus esculentus and Cy. rotundus and included in this
923
paper to distinguish between species occurring on the
Cyperaceae. Examined material had macroconidia hyaline,
narrowly oblong or narrowly elliptic (5.5e)
8.0e10.5(e13)  2.0e3.5(e4) mm. Sclerotia dark brown to
black, protruding, variable length, most commonly
8e15 mm long, straight to slightly curved, floating on water
for 30 min or sometimes longer. Colonies reaching up to
20 mm in diameter (21 d, 24  C) on PDA, densely growing,
velutinous, buff reverse fading towards the margin; colo-
nies raised and slightly wrinkled in the centre. Teleomorph
described by Loveless (1967).
C. cyperi is sister to C. fimbristylidis based on our phyloge-
netic analysis (Fig 1, Online Resource 2). Sclerotia of C.
cyperi are dark brown to black, 8e15  1.5 mm (Loveless
1967) compared with C. fimbristylidis sclerotia of
4e5  0.5e0.8 mm (mean length and width; up to 7 mm
long). Conidial shape in C. cyperi is narrowly oblong or nar-
rowly elliptical, varying from 8.5e11.0  2.5e3.5 mm (with
a mean of 10.7 and L/W ratio 3.1 in this study for specimens
examined) compared with conidia from C. fimbristylidis that
are oblong (mean 8.5; L/W ratio 2.3). C. grohii and C. nigricans
have never been recorded from South Africa (Paz
outova
et al. 2008b). Cyperus esculentus, and to a lesser degree also
Cy. rotundus, occurs as invasive weed in almost all temper-
ate, tropical, and subtropical regions of the world. Once
established, it is extremely difficult to eradicate (CABI
2015, www.cabi.org/isc, accessed 28 Aug. 2015). The
924
Fig 4 e Claviceps fimbristylidis (PREM 61127T, culture CCC 1472). (A) Sclerotia on Fimbristylis complanata. (B) Sclerotium (bar
1 mm). (C) Conidia (bar 10 mm). (D) Culture on medium PDA (21 d old).
distribution of C. cyperi however, seems to be restricted to
South Africa.
Claviceps fimbristylidis E. van der Linde, K. Pe
sicova  , M.
Kola
rık, sp. nov.
MycoBank No.: MB815479, Fig 4.
Typification. SOUTH AFRICA. GAUTENG: Bronkhorstspruit,
on Fimbristylis complanata, Apr. 2014, W.M. Kriel, CS 305 (ho-
lotype PREM 61127). Isotype PRM 933997. Ex-type culture
CCC 1472, additional cultures CCC 1473, PPRI 16239,
16240. See Table 1 for EMBL accession numbers.
Etymology. Named after its host Fimbristylis complanata, be-
longing to the Cyperaceae.
Geographic distribution/host range. South Africa: Eastern
Cape Province, Free State Province, Gauteng, KwaZulu-
Natal, and Mpumalanga; on Fimbristylis complanata.
Specimens examined. SOUTH AFRICA. GAUTENG: Pretoria,
Rietvlei Nature Reserve, on Fimbristylis complanata, Apr.
2013, S. Pa
zoutova, CS 279 (PREM 61123); Bronkhorstspruit,
on Fimbristylis complanata, Apr. 2011, W.M. Kriel, CS 165
(PREM 60684). MPUMALANGA: Warburton, on Fimbristylis
complanata, Mar. 2011, E.J. van der Linde, CS 144 (PREM
60846). KWAZULU-NATAL: northern Drakensberg, Retief-
klip, on Fimbristylis complanata, Mar. 2010, E.J. van der Linde,
CS 85 (PREM 60662), cultures CCC 1207e1214, PPRI
10563e65, 10567, 10569e10672. FREE STATE PROVINCE:
Warden/Bethlehem, on Fimbristylis complanata, Mar. 2011,
W.M. Kriel, CS 139 (PREM 60661).
Diagnosis. Macroconidia hyaline, varying in shape, most
commonly oblong (5.5e)6.5e10.7(e11.7)  (3.2e)
E. J. van der Linde et al.
3.7e4.5(e5.0) mm, mean 8.5  3.7 mm. Sclerotia smooth,
dark brown to black, protruding, straight to slightly curved,
more or less triangular in cross section, most commonly
4e5 mm long but reaching up to 7 mm, floating for several
days. Teleomorph not observed.
Cultural characteristics. Colonies (21 d, 24  C) on PDA 30 mm
in diameter, aerial mycelium off-white, buff in the centre,
in reverse fading towards the margin; velutinous, with dif-
fuse margin.
Commentary. Three Claviceps species were previously de-
scribed from the Cyperaceae: C. cyperi from Cyperus esculen-
tus and Cy. rotundus (Loveless 1967), Claviceps grohii on Carex
(Groves 1943) and C. nigricans on Eleocharis and Scirpus (Brady
1962). Fimbristylis complanata is associated with water and
commonly found in the Eastern Cape, Free State, Gauteng,
KwaZulu-Natal, and Mpumalanga Provinces. C. fimbristylidis
is phylogenetically close to C. cyperi and other species with
host plants from the Cyperaceae family (Fig 1, Online
Resource 1). Sclerotia of C. fimbristylidis are smaller
(4e5 mm) than those of C. cyperi, conidial shape in C. cyperi
is cylindrical and longer (mean 10.3; L/W ratio 3.2) and ob-
long in C. fimbristylidis (mean 8.5; L/W ratio 2.3). C. grohii
and C. nigricans have never been recorded from South Africa.
Although Fimbristylis complanata has a pantropical distribu-
tion and very common throughout these areas (WCSP
2015), its parasitization by ergot has not yet been reported
outside of South Africa.
Claviceps macroura E. van der Linde, K. Pe
sicova  , M. Kola
rık,
sp. nov.
Ergot species of the C. purpurea group from South Africa 925

Fig 5 e Claviceps macroura (PREM 61135T, PPRI 16245). (A) Sclerotia on Cenchrus macrourus. (B) Sclerotium (bar 10 mm). (C)
Macroconidia (bar 10 mm). (D) Culture on medium PDA (21 d old).

MycoBank No.: MB815480, Fig 5.
Typification. SOUTH AFRICA. EASTERN CAPE PROVINCE:
Hogsback, on Cenchrus macrourus, Apr. 2014, W.M. Kriel, CS
337 (holotype PREM 61135). Isotype PRM 934000. Ex-type
CCC 1482, additional isolate PPRI 16245. See Table 1 for
EMBL accession numbers.
Etymology. Gr. makros long, oura tail, ‘long-tailed’, with ref-
erence to the name of the hostplant. The specific epithet is
a noun in apposition and hence indeclinable.
Geographic distribution/host range. South Africa: Eastern and
Western Cape Provinces; on Cenchrus macrourus
(¼Pennisetum macrourus) and Cenchrus sphacelatus.

Fig 6 e Claviceps monticola (PREM 61136T, culture PPRI 16234). (A, B) Sclerotia and honeydew on Brachypodium flexum. (C)
Sclerotium (bar 10 mm). (D) Culture on medium PDA (21 d old). (E) Macroconidia (bar 10 mm).
926
Fig 7 e Claviceps pazoutovae (PREM 61137T, culture PPRI 16247). (A) Sclerotia on Stipa dregeana. (B) Sclerotium (bar 10 mm). (C)
Culture on medium PDA (21 d old). (D) Macroconidia (bar 10 mm).
Specimens examined. SOUTH AFRICA. EASTERN CAPE PROV-
INCE: Hogsback, on C. macrourus, Mar. 2011, E.J. van der
Linde, CS 146 (PREM 60668); Hogsback, on C. macrourus,
Apr. 2008, E.J. van der Linde (PREM 61150). CAPE PROVINCE:
Sir Lowrys Pass, on C. macrourus, Feb. 1978, C. J. Rafin
(PREM 45338); Stellenbosch, on C. macrourus, Oct. 1943, Dip-
penaar (PREM 33983); Stellenbosch, on Cenchrus sphacelatus,
Jan. 1941, L. Verwoerd (PREM 32494).
Diagnosis. Macroconidia hyaline, oblong to broad cylindric
(5.3e)5.9e8.5(e9.1)  (2.5e)2.8e4.4(e4.7) mm, mean
7.1  3.5 mm, and L/W ratio 2.0. Sclerotia brown to dark
brown, protruding, up to 22 mm long. Teleomorph not
observed.
Cultural characteristics. Colonies on PDA 25 mm in diameter
(21 d, 24  C), velutinous, aerial mycelium off-white, buff
reverse.
Commentary. C. macroura is phylogenetically closest to, but
morphologically clearly distinct from C. capensis which
has ovoid conidia. Another clade formed by C. pazoutovae
is closest to these two species. C. macroura however, has
oblong to broad cylindric, and a mean L/W ratio of 2.0, op-
posed to the 2.0e2.6 (mean of 2.3 on all hosts) of C. pazouto-
vae. Brewer & Loveless (1977) examined four South African
Claviceps specimens from Cenchrus macrourus collected in
close proximity in the Western Cape Province (one of
which was PREM 32494) and noted mean conidial dimen-
sions of 5.9  2.46 mm (L/W ratio 2.4) which were identified
as C. purpurea. However, re-examination of the specimens
in PREM collected in the Western Cape Province demon-
strated conidial sizes well within the range noted for the
specimens from the Eastern Cape Province. Two other spe-
cies were recorded from Pennisetum and Cenchrus; C. fusifor-
mis and C. tenuispora are phylogenetically not close to the C.
purpurea group and have distinct fusiform and narrowly
allantoid macroconidia respectively (Paz
outova  et al.
E. J. van der Linde et al.
2008a, 2011). Cenchrus macrourus is native to southern and
eastern Africa but widely introduced on all continents, in-
cluding Australia and New Zealand where is reported as
a highly invasive species (CABI 2015, www.cabi.org/isc,
accessed 28 Aug. 2015). There are no records of ergotised
C. macrourus outside of South Africa.
Claviceps monticola E. van der Linde, K. Pe
sicova
 , M. Kola
rık,
sp. nov.
MycoBank No.: MB815481, Fig 6.
Typification. SOUTH AFRICA. EASTERN CAPE PROVINCE:
Hogsback, on Brachypodium flexum, May 2014, W.M. Kriel,
CS 339 (holotype PREM 61136). Isotype PRM 933996. Ex-
type cultures CCC 1483, 1484. See Table 1 for EMBL acces-
sion numbers.
Etymology. Referring to its association with mountain
ranges in South Africa.
Geographic distribution/host range. South Africa: along
mountain ranges, Mpumalanga, KwaZulu-Natal, and East-
ern Cape Provinces; on Brachypodium flexum.
Specimens examined. SOUTH AFRICA. MPUMALANGA PROV-
INCE: Machadodorp, Bermanzi hiking trail, on Brachypo-
dium flexum, May 2015, W.M. Kriel, CS 372 (PREM 61280).
EASTERN CAPE PROVINCE: Hogsback, Amathola hiking
trail, on Brachypodium flexum, May 2014, W.M. Kriel, CS 336
(PREM 61136). KWAZULU-NATAL: northern Drakensberg,
Royal Natal National Park, on Brachypodium flexum, Apr.
2014, W.M. Kriel, CS 361 (PREM 61144), cultures CCC 1496,
1497, PPRI 16232, 16233; KWAZULU-NATAL: northern Dra-
kensberg, Royal Natal National Park, on Brachypodium
flexum, Mar. 2013, S. Pa
zoutova, CS 253 (PREM 61119), cul-
tures CCC 1421, 1422, 1423; KWAZULU-NATAL: northern
Drakensberg, Royal Natal National Park, on Brachypodium
flexum, Mar. 2012, W.M. Kriel, CS 205 (PREM 60852);
KWAZULU-NATAL: northern Drakensberg, Royal Natal Na-
tional Park, on Brachypodium flexum, Mar. 2011, W.M. Kriel,
Ergot species of the C. purpurea group from South Africa
CS 150 (PREM 60672); KWAZULU-NATAL: northern Dra-
kensberg, Royal Natal National Park, on Brachypodium
flexum, Apr. 2010, E.J. van der Linde, CS 88 (PREM 60841);
KWAZULU-NATAL: northern Drakensberg, Royal Natal Na-
tional Park, on Brachypodium flexum, Mar. 2009, E.J. van der
Linde, CS 99 (PREM 60845). NATAL: Cathedral Peak area,
Indumeni Forest, on Brachypodium flexum, Aug. 1944, E.
Schelpe (PREM 34132); NATAL: Donnybrook, Xumeni Forest,
on Brachypodium flexum, Jun. 1938, K.E. Morgan, E.M. Doidge
(PREM 32770).
Diagnosis. Macroconidia hyaline, oblong to broadly cylin-
dric (4.8e)5.7e8.9(e12.2)  (1.9e)2.6e3.6(e4.8) mm, mean
7.2  3.1 mm, L/W 2.3. Sclerotia greyish brown to brown,
protruding, variable in length, up to 50 mm long, slightly
to strongly curved to coiled, not floating on water. Teleo-
morph not observed.
Cultural characteristics. Colonies on PDA reaching
20e30 mm in diameter in 21 d at 24  C, sparsely with dif-
fuse margin, somewhat irregularly raised in the centre, ae-
rial mycelium white, reverse off-white, and yellowish in
the centre.
Commentary. C. monticola is phylogenetically close to one
clade formed by C. pazoutovae (on Ehrharta erecta and Stipa
dregeana) as well as a second clade formed by C. capensis
(on Ehrharta villosa) and C. macroura (on Cenchrus macrourus)
(Fig 1, Online Resource 1). The conidial L/W ratio in C. mon-
ticola varied between 2.3 and 2.9 (mean of 2.6 in specimens
examined) when compared with C. pazoutovae with a conid-
ial ratio of 2.0e2.6 (mean of 2.2 in specimens examined). In
addition, the conidia of C. capensis are distinctively ovoid
with an L/W ratio of 1.7. Brachypodium spp. are also typical
hosts of Claviceps purpurea in Europe (Barger 1931; Langdon
1952; Paz
outova et al. 2015). The potential distribution of C.
monticola is the whole of tropical Africa, where its host is
spread (WCSP 2015, http://apps.kew.org/wcsp/, accessed
28 Aug. 2015).
Claviceps pazoutovae E. van der Linde, K. Pe
sicova  , M.
Kola
rık, sp. nov.
MycoBank No.: MB815482, Fig 7.
Typification. SOUTH AFRICA. EASTERN CAPE PROVINCE:
Hogsback, on Stipa dregeana var. dregeana, May 2014, W.M.
Kriel, CS 342 (holotype PREM 61137). Isotype PRM 933999.
Ex-type CCC 1485, 1486, additional cultures PPRI 16247,
16248. See Table 1 for EMBL accession numbers.
Etymology. In honour of the late Dr Sylvie Paz
outova who
dedicated a lifetime to Claviceps research.
Geographic distribution/host range. South Africa: Eastern
Cape Province, KwaZulu-Natal, and Western Cape Prov-
ince; on Ehrharta erecta var. erecta, Ehrharta calycina, and
Stipa dregeana var. dregeana.
Specimens examined. SOUTH AFRICA. KWAZULU-NATAL:
northern Drakensberg, Royal Natal National Park, on Ehr-
harta erecta var. erecta, Apr. 2014, E.J. van der Linde, CS 360
(PREM 61143), cultures CCC 1494, 1495, PPRI 16254, 16255;
KWAZULU-NATAL: northern Drakensberg, Royal Natal Na-
tional Park, on Ehrharta erecta var. erecta, Mar. 2013, S.
Pa
zoutova , cultures CCC 1424e1426. CAPE PROVINCE:
Cedarberg, on Ehrharta calycina, Jan. 1948, N.J.G. Smith (as
C. purpurea, PREM 41843); CAPE PROVINCE: Cape Town,
Lions Head, on Ehrharta calycina, Jan. 1921, M.R.H. Thomson
927
(as C. purpurea, PREM 14266); CAPE PROVINCE: Kirsten-
bosch, on Ehrharta sp., Dec. 1920, I.B. Pole Evans (as C. pur-
purea, PREM 14249). KWAZULU-NATAL: Royal Natal
National Park, on Stipa dregeana var. dregeana, Apr. 2014,
E.J. van der Linde, CS 332 (PREM 61134), cultures CCC 1477,
PPRI 16246; KWAZULU-NATAL: Royal Natal National Park,
on Stipa dregeana var. dregeana, Mar. 2013, S. Pa
zoutova , CS
255 (PREM 61120). EASTERN CAPE PROVINCE: Hogsback,
on Stipa dregeana var. dregeana, Mar. 2009, E.J. van der Linde,
CS 90 (PREM 60842); EASTERN CAPE PROVINCE: Hogsback,
on Stipa dregeana var. dregeana, Mar. 2008, W.M. Kriel
(PREM 61150), cultures CCC 1392e1394, PPRI 9535e9537;
EASTERN CAPE PROVINCE: Hogsback, on Stipa dregeana
var. dregeana, Mar. 2007, W.M. Kriel, CS 215 (PREM 60860).
Diagnosis. Macroconidia hyaline, oblong or broadly cylin-
dric (4.3e)4.8e7.3(e11.1)  (1.7e)1.9e3.9(e4.5) mm, mean
6.6  2.9 mm, mean L/W ratio from all hosts 2.3. Sclerotia
variable on different hosts: on Ehrharta erecta var. erecta
dark brown to almost black, up to 12 mm long and on Stipa
dregeana var. dregeana sclerotia greyish brown to brown to
dark brown or almost black, slightly curved to spirally
coiled, up to 40 mm long. Teleomorph not observed.
Cultural characteristics. Colonies relatively fast-growing
(21 d, 24  C) on PDA up to 70 mm in diameter, aerial myce-
lium off-white, colonies irregularly raised in the centre, re-
verse buff, velutinous, with diffuse margin.
Commentary. C. pazoutovae is phylogenetically close to the
two other (but separate) clades formed by C. monticola (on
B. flexum) and C. capensis (on E. villosa) respectively. Al-
though the conidial shape is much the same as the latter
two species (i.e. most commonly oblong to broadly cylin-
dric), the conidial L/W ratio of C. pazoutovae varies between
2.0 and 2.6 (mean of 2.3), differing from C. monticola which
varies between 2.3 and 2.9 (mean of 2.6 in specimens exam-
ined); these dimensions also falls outside the range of C.
purpurea (Paz
outova et al. 2015). It also differs from the con-
idia of C. capensis (on Ehrharta villosa) which is distinctively
ovoid with an L/W ratio of 1.7. The conidial shape was the
same on both hosts: oblong or broadly cylindric. On Ehr-
harta the conidia were (4.8e)5.3e7.2(e7.7)  (1.7e)
1.9e2.7(e2.9) mm, mean 5.9  2.3 mm, and L/W 2.6, while
those on Stipa were (5.1e)6.0e10.1(e11.0)  (2.1e)
2.8e3.2(e3.9) mm, mean 6.5  2.8 mm, and L/W 2.3. Although
the conidia on Ehrharta were slightly shorter than those on
Stipa, it is clearly evident from molecular data that these
are the same species. Such differences in size of sclerotia
and conidia had previously been described as phenoplas-
ticity especially observed in C. purpurea from different
hosts (Paz
outova  et al. 2015). Only Langdon (1952) referred
to Claviceps on Ehrharta calycina and Ehrharta capensis, as
sp. indet. Ehrharta erecta is native to a large part of eastern
Africa, whereas E. calycina is native to South Africa. Both
Ehrharta species have spread to various countries on all
continents and often behave as strong competitors and in-
vasive species (CABI 2015, www.cabi.org/isc, accessed 28
Aug. 2015). There are no records of ergot on these two hosts
outside of South Africa. Stipa dregeana occurs only in Africa
is commonly found in South Africa associated with for-
ested mountainous areas (http://eol.org/pages/, http://red-
list.sanbi.org/, accessed 22 Oct. 2015).
928
Discussion
Most of the almost 50 species in the genus Claviceps (Paz
outova 
2001; Alderman 2003; Paz
outova  et al. 2008a) have a defined,
narrow host range representing single plant species or several
related genera. Among them some species of the Claviceps pur-
purea species group are unique by way of their host range. An
extreme example is C. purpurea infecting various unrelated lin-
eages of Pooideae or Claviceps humidiphila and Claviceps arundi-
nis with hosts belonging to both to Arundinoideae and
Pooideae (Neg ard et al. 2015; Paz
outova  et al. 2015). The same
is true for Claviceps pazoutovae which was found on Ehrhartoi-
deae as well as Pooideae. Consequently, the wide host spec-
trum of the whole species group includes all lineages of ergot
hosts covering Arundinoideae, Chloridoideae, Cyperaceae, Ehr-
hartoideae, Pooideae, and Panicoideae (Fig 1, Paz
outova  et al.
2015). Surprisingly, all species outside of the C. purpurea species
group possess a much less diverse set of hosts, infecting vari-
ous lineages of Panicoideae and Chloridoideae only
(Paz
outova  2001; Lorenz et al. 2009; Paz
outova  et al. 2011).
It is evident that species of the C. purpurea species group
have great evolutionary adaptability and tendency for the
rapid spreading and subsequent cosmopolitan distribution is
seen at least in C. purpurea which is thought to be spread by
humans over the world as well as Claviceps spartinae recently
invading various areas of Northern America and Europe
(Boestfleisch et al. 2015). With this in mind, it is important to
study the diversity, host, and geographical ranges of these er-
gots. African grasses are often reported as invasive; in our
study we identified ergot parasitizing a number of these inva-
sive grass species. Ehrharta erecta (erect veldt grass, panic veldt
grass) native to Africa has been introduced to Europe
(Holverda & Denters 2006), China (Weber et al. 2008), Australia,
and New Zealand. Introduced to the USA as experimental
grass, it is now commonly found along California’s coastline
in disturbed areas, including riparian areas, scrub, grassland,
woodland, urban areas, and turf (Steers et al. 2013, http://
www.cal-ipc.org/ip/management/plant_profiles/Ehrharta_er-
ecta.php, accessed 22 Oct. 2015). Its congeneric species, Ehr-
harta villosa var. villosa is endemic to SA; E. villosa var.
maximensis is reported as invasive in both Australia and New
Zealand (Hilton et al. 2007). Ehrharta calycina native to southern
Africa has been introduced to at least 17 countries around the
world (North and South America, Europe, and Australasia;
Calflora 2015, http://www.calflora.org/, accessed 28 Aug.
2015) including western Australia, with most records in the
Perth area (CABI 2015, http://www.cabi.org/isc, accessed 28
Aug. 2015), as well as in four other states (Blood 2001). It
should be noted that E. calycina is, at least regionally, a species
of greatest concern (http://wiki.bugwood.org, accessed 22 Oct.
2015). Cenchrus macrourus (African fountain grass or feather
grass) is a perennial grass native to South Africa. It has been
introduced to New Zealand and Australia, where it has estab-
lished and is known to replace desirable stock grass with grass
of low palatability in pastoral areas and has the potential to
become a major weed of production forestry, roadsides, coast-
lines, wetlands, amenity, and urban areas in New Zealand and
Australia (Global invasive species database, http://www.iss-
g.org/database/, accessed 22 Oct. 2015). As far as the
E. J. van der Linde et al.
Cyperaceae is concerned, Cyperus esculentus has a worldwide
distribution and often considered a noxious weed, often asso-
ciated with disturbed soils including farming activities any
crop. Native to the Mediterranean, it was cultivated in ancient
Egypt for its taste tubers. The only other host to Claviceps from
this family now recorded from South Africa is Fimbristylis com-
planata; Claviceps cyperi and Claviceps fimbristylidis are phyloge-
netically closely related but infection of Cyperus by C.
fimbristylidis was not confirmed during our study.
Ergot alkaloids and their derivatives are used worldwide as
therapeutic agents. The capacity for the alkaloid production
differs widely within the genus in dependence to the complex-
ness of the ergot synthesis gene cluster. Only the species from
the C. purpurea group have complete gene cascade and pro-
duce the ‘high-end’ ergopeptines including pharmaceutically
important ergotamine (Paz
outova  et al. 2008b; Lorenz et al.
2009). The new species described in our study contained alka-
loids typically found in C. purpurea (Table 2) including ergo-
peptines and apart from the biotechnological relevance (i.e.
discovery of new alkaloids) represents interesting models in
the study of the alkaloid gene cluster evolution. Four of
them, Claviceps capensis, C. cyperi, Claviceps macroura, and C.
pazoutovae produced alkaloids in amounts ranging from 2 to
9.5 mg g1 which is comparable to the maximal values re-
ported in the wild populations of C. purpurea sensu lato (it
means C. arundinis, C. humidiphila, C. purpurea, and C. spartinae)
(Paz
outova et al. 2000; Uhlig et al. 2007). Total alkaloid content
found in C. capensis (9.46 mg g1) even exceeds the highest
value so far reported in C. purpurea s.l. (Uhlig et al. 2007).
Naude  et al. (2005) studied C. cyperi sclerotia responsible for
the ergotism of cattle and found total alkaloid values reaching
4 mg g1 with dominance of ergocryptine. In our study, we
confirmed C. cyperi as extremely potent alkaloid producer
with dominance of ergocryptine in sclerotia (Table 2). The to-
tal amount produced by other species was minute. This brings
to five the total number of mycotoxigenic Claviceps species in
South Africa: C. capensis, C. cyperi, C. macroura, and C. purpurea.
In 1993, Schneider et al. (1996) diagnosed in cattle in the West-
ern Cape Province, after feeding barley screenings (broken and
undersized barley and grass seeds) heavily contaminated with
annual ryegrass (Lolium sp.) seeds and C. purpurea sclerotia. A
similar syndrome in dairy cattle occurred in 1996/97 following
feeding of maize silage or teff hay contaminated with Cy. escu-
lentus containing numerous sclerotia of C. cyperi (Naude  et al.
2005). One other clavicipitaceous fungus reported to cause
gangrenous ergotism in South Africa is Neotyphodium coeno-
phialum, in an endophyte of Festuca elatior producing high
levels of ergovaline (Botha et al. 2004) which, in combination
with C. purpurea, caused the syndrome.
Acknowledgements
Funding for this research has been provided through grants
from:
Czech Science Foundation (GACR,
13-00788S). European
Regional Development Fund BIOCEV (CZ.1.05/1.1.00/02.0109).
South African National Department of Science and Tech-
nology and the Professional Development Programme of the
Ergot species of the C. purpurea group from South Africa
Agricultural Research Council for financial support and
facilities.
Ms Wilmarie Kriel is acknowledged for technical assis-
tance, photography, and field work, and Mr Riaan Stals for
his assistance with species etymologies.
Appendix A. Supplementary data
Supplementary data related to this article can be found at
http://dx.doi.org/10.1016/j.funbio.2016.05.006.
references
Alderman SC, 2003. Diversity and speciation in Claviceps. In:
White JF, Bacon CW, Hywel-Jones NL, Spatafora JW (eds),
Clavicipitalean Fungi: evolutionary biology, chemistry, biocontrol
and cultural impacts. Mycology, vol. 19. Marcel Dekker, New
York, pp. 195e246.
Barger G, 1931. Ergot and Ergotism. Gurney and Jackson, London.
Blood K, 2001. Environmental Weeds: a field guide for SE Australia. C.
H. Jerram Science Publishers, Mt. Waverley, Victoria,
Australia.
Boestfleisch C, Drotleff AM, Ternes W, Nehring S, Paz
outova  S,
Papenbrock J, 2015. The invasive ergot Claviceps purpurea var.
spartinae recently established in the European Wadden Sea on
common cord grass is genetically homogeneous and the
sclerotia contain high amounts of ergot alkaloids. European
Journal of Plant Pathology 141: 445e461.
Botha CJ, Naude  TW, Moroe ML, Rottinghaus GE, 2004. Gangre-
nous ergotism in cattle grazing fescue (Festuca elatior L.) in
South Africa. Journal of the South African Veterinary Association
75: 45e48.
Brady LR, 1962. Phylogenetic distribution of parasitism by Clavi-
ceps species. Lloydia 25: 1e36.
Brewer J, Loveless AR, 1977. Ergot of Pennisetum macrourum in
South Africa. Kirkia 10: 589e600.
Castresana J, 2000. Selection of conserved blocks from multiple
alignments for their use in phylogenetic analysis. Molecular
Biology and Evolution 17: 540e552.
Foxcroft LC, Richardson DM, Rejmanek M, Pysek P, 2010. Alien
plant invasions in tropical and sub-tropical savannas: pat-
terns, processes and prospects. Biological Invasions 12:
3913e3933.
Groves JW, 1943. A new species of Claviceps on Carex. Mycologia 35:
604e609.
Hilton M, Harvey N, James K, 2007. The impact and management
of exotic dune grasses near the mouth of the Murray River,
South Australia. Australasian Journal of Environmental Manage-
ment 14: 220e228.
Holverda W, Denters T, 2006. Ehrharta erecta Lam., another cos-
mopolitan grass spreading in our direction? Gorteria 32: 34e36.
Katoh K, Toh H, 2008. Recent developments in the MAFFT mul-
tiple sequence alignment program. Briefings in Bioinformatics 9:
286e298.
Langdon RFN, 1952. Studies on Ergot Dissertation. University of
Queensland, Brisbane, Australia.
Langdon RFN, 1954. The origin and differentiation of Claviceps
species. University of Queensland Papers 3: 61e68.
Loveless AR, 1964a. Studies of Rhodesian ergots 1. Claviceps max-
imensis Theis and Claviceps pusilla Cesati. Kirkia 4: 35e40.
Loveless AR, 1964b. Use of the honeydew state in the identifica-
tion of ergot species. Transactions of the British Mycological So-
ciety 47: 205e213.
929
Loveless AR, 1967. A new species of Claviceps on Cyperaceae.
Transactions of the British Mycological Society 50: 19e23.
Loveless AR, Herd GW, 1964. Studies of Rhodesian ergots 2. A re-
description of Claviceps sulcata Langdon. Kirkia 4: 41e43.
Lorenz N, Haarmann T, Paz  S, Jung M, Tudzynski P, 2009.

outova
The ergot alkaloid gene cluster: functional analyses and evo-
lutionary aspects. Phytochemistry 70: 1822e1832.
Muthusubramanian V, Bandyopadhyay R, Tooley PW, Reddy DJ,
2005. Inoculated host range and effect of host on morphology
and size of macroconidia produced by Claviceps africana and
Claviceps sorghi. Journal of Phytopathology 153: 1e4.
Naude  TW, Botha CJ, Vorster JH, Roux C, Van der Linde EJ, Van
der Walt SI, Rottinghaus GE, Van Jaarsveld L, Lawrence AN,
2005. Claviceps cyperi, a new cause of severe ergotism in
dairy cattle consuming maize silage and teff hay contami-
nated with ergotised Cyperus esculentus (nut sedge) on the
Highveld of South Africa. Onderstepoort Journal of Veterinary
Research 72: 23e37.
Negard M, Uhlig S, Kauserud H, Andersen T, Høiland K,
Vralstad T, 2015. Links between genetic groups, indole alkaloid
profiles and ecology within the grass-parasitic Claviceps pur-
purea species complex. Toxins 7: 1431e1456.
O’Donnell K, 1993. Fusarium and its near relatives. In:
Reynolds DR, Taylor JW (eds), The fungal holomorph: mitotic,
meiotic and pleomorphic speciation in fungal systematics. CAB In-
ternational, Wallingford, UK, pp. 225e233.
O’Donnell K, Cigelnik E, 1997. Two divergent intragenomic rDNA
ITS2 types within a monophyletic lineage of the fungus Fusa-
rium are nonorthologous. Molecular Phylogenetic Evolution 7:
103e116.

outova
Paz  S, Ol
sovska  J, Linka M, Kolınska R, Flieger M, 2000.
Chemoraces and habitat specialization of Claviceps purpurea
populations. Applied and Environmental Microbiology 66:
5419e5425.

outova
Paz  S, 2001. The phylogeny and evolution of the genus
Claviceps. Mycological Research 105: 275e283.

outova
Paz  S, Frederickson DE, 2005. Genetic diversity of Claviceps
africana on sorghum and Hyparrhenia. Plant Pathology 54:
749e763.

outova
Paz  S, Kola
rık M, Odvody GN, Frederickson DE, Ol
sovska J,
Man P, 2008a. A new species complex including Claviceps fu-
siformis and Claviceps hirtella. Fungal Diversity 31: 95e110.

outova
Paz  S, Ol
sovska

 J, Sulc
kova
M, Chudıc  M, Flieger M, 2008b.
Claviceps nigricans and Claviceps grohii: their alkaloids and
phylogenetic placement. Journal of Natural Products 71:
1085e1088.

outova
Paz  S, Odvody GN, Frederickson DE, Chudıc
kova M,
Ol
sovska J, Kola
rık M, 2011. New Claviceps species from warm-
season grasses. Fungal Diversity 49: 145e165.

outova
Paz  S, Pe
sicova  K, Chudıc
kova

 M, Sr utka P, Kola
rık M, 2015.
Delimitation of cryptic species inside Claviceps purpurea. Fungal
Biology 119: 7e26.
Rehner SA, Buckley E, 2005. A Beauveria phylogeny inferred from
nuclear ITS and EF1-a sequences: evidence for cryptic diver-
sification and links to Cordyceps teleomorphs. Mycologia 97:
84e98.
Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A,
Ho€ hna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP, 2012.
MrBayes 3.2: efficient Bayesian phylogenetic inference and
model choice across a large model space. Systematic Biology 61:
539e542.
Schneider DJ, Miles CO, Garthwaite I, Van Halderen A, Wessels JC,
Lategan HJ, 1996. First report of field outbreaks of ergot alka-
loid toxicity in South Africa. Onderstepoort Journal of Veterinary
Research 63: 97e108.
Steers RJ, Fritzke SL, Rogers JJ, Cartan J, Hacker K, 2013. Invasive
pine tree effects on northern coastal scrub structure and
composition. Invasive Plant Science and Management 6: 231e242.
930
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S, 2013.
MEGA6: molecular evolutionary genetics analysis version 6.0.
Molecular Biology and Evolution 30: 2725e2729.
Toju H, Tanabe AS, Yamamoto S, Sato H, 2012. High-coverage ITS
primers for the DNA-based identification of ascomycetes and
basidiomycetes in environmental samples. PloS One 7: e40863.
Uhlig S, Vikøren T, Ivanova L, Handeland K, 2007. Ergot alkaloids
in Norwegian wild grasses: a mass spectrometric approach.
Rapid Communications in Mass Spectrometry 21: 1651e1660.
E. J. van der Linde et al.
Weber E, Sun S-G, Li B, 2008. Invasive alien plants in China: diversity
and ecological insights. Biological Invasions 10: 1411e1429.
Williams DG, Baruch Z, 2000. African grass invasion in the
Americas: ecosystem consequences and the role of ecophysi-
ology. Biological Invasions 2: 123e140.
Yoshioka K, 2002. KyPlot: a user-oriented tool for statistical data
analysis and visualization. Computational Statistics 17:
425e437.