T CELL IMMUNE RESPONSES TO WILMS TUMOR PROTEIN (WT1)

IN MYELODYSPLASIA RESPONSIVE TO IMMUNOSUPPRESSIVE

THERAPY (IST)

Elaine M. Sloand1, MD
J. Joseph Melenhorst1, PhD
Zachary C. G. Tucker1
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

Loretta Pfannes1
Jason M. Brenchley2, PhD
Agnes Yong1, MD PhD
Emma Gostick3
Daniel C. Douek4, MD PhD
David A. Price3, 4, MD PhD
A. John Barrett1, MD
Neal S. Young1, MD

1
Hematology Branch, National Heart, Lung and Blood Institute, National Institutes of
Health (NIH), Bethesda, MD 20892; 2Laboratory of Molecular Microbiology, National
Institute of Allergy and Infectious Diseases, NIH, Bethesda, MD 20892; 3Cardiff University
School of Medicine, Cardiff CF14 4XN, UK; 4Vaccine Research Center, National Institute
of Allergy and Infectious Diseases, NIH, Bethesda, MD 20892.
 Abstract
Clinical observations and laboratory evidence link bone marrow failure in myelodysplastic

syndrome (MDS) to a T cell-mediated immune process that is responsive to immunosuppressive

treatment (IST) in some patients. We previously reported that trisomy 8 MDS was more likely to

respond to IST and was associated with skewed T cell receptor VE profiles with clonally

expanded CD8+ T cells capable of suppressing the growth of aneuploid progenitor cells in vitro.
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

Furthermore, microarray analyses showed that Wilms tumor protein (WT1) was over-expressed

by trisomy 8 hematopoietic progenitor (CD34+) cells as compared to CD34+ cells from healthy

donors. Here we show that WT1 mRNA expression is upregulated by as much as 1,000-fold in

the bone marrow mononuclear cells (BMMNC) of MDS patients with trisomy 8 (p = 0.001);

WT1 protein levels were also significantly elevated. In addition, using a combination of physical

and functional assays to detect the presence and biological reactivity of specific T cells

respectively, we demonstrate that IST-responsive MDS patients exhibit significant CD4+ and

CD8+ T cell responses directed against WT1. Finally WT1-specific CD8+ T cells are present

within expanded VE subfamilies and can inhibit hematopoiesis when added to autologous patient

bone marrow cells in culture. Thus, our results strongly implicate WT1 as one of the antigens

that triggers T cell-mediated myelosuppression in MDS.

2
 Introduction

Clinical and laboratory evidence suggests that bone marrow failure in myelodysplastic

syndrome (MDS) is an immune-mediated process. In particular, analysis of T cell receptor

(TCR) E-chain variable (VE) domain usage and spectratyping of VE families have revealed

oligoclonal expansions of CD8+ T lymphocytes, which are selectively cytotoxic to trisomy 8

cells in patients with this form of MDS1;2. Furthermore, patients with trisomy 8 are more likely
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

to improve hematologically with immunosuppressive treatment (IST) compared to patients with

other forms of MDS2. Following IST, the number of the expanded VE subfamilies declined and

the proportion of trisomy 8 cells in the bone marrow increased. Moreover, in vitro depletion of T

cells from the bone marrow increases the proportion of cultured trisomy 8 cells2.

We hypothesized that either a neoantigen or an over-expressed self-antigen presented by

trisomy 8 cells, and possibly by cells in other forms of MDS, might elicit an MDS-specific

cytotoxic CD8+ T cell response. Immune-mediated suppression of the MDS clone and bystander

damage to normal hematopoietic cells could then induce bone marrow failure3;4. A number of

mRNAs, particularly cyclin D1 and Wilms tumor 1 (WT1), are over-expressed in microarray

analyses of CD34+ cells from trisomy 8 bone marrow as compared to CD34+ cells from healthy

donor bone marrow5. In addition, WT1 appears to be up-regulated in MDS but not in healthy

CD34+ stem cells6, and expression levels increase with disease progression7;8.

The WT1 protein can be immunogenic. For example, CD8+ T cell responses directed

against the immunodominant HLA-A*0201-restricted epitope WT1126-134 (RMFPNAPYL) have

been generated from donor peripheral blood mononuclear cells and can specifically lyse

leukemic but not normal hematopoietic progenitor cells9. Indeed, WT1 peptide vaccines are

currently being evaluated for immunotherapeutic purposes in patients with myeloid

3
 malignancies10-13. Here, we explore the potential role of self-directed T cell responses specific

for WT1 in the myelosuppression that accompanies trisomy 8 MDS. Our data indicate that WT1-

specific T cell responses contribute to an immune-mediated process that underlies the bone

marrow failure observed in trisomy 8 MDS and other forms of MDS that are characterized by

WT1 over-expression.
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

4
 Results

Study population

We studied 61 MDS patients with refractory anemia, 24 of whom had trisomy 8 and 35

healthy donors. All samples were collected prior to IST. Patient characteristics, cytogenetics,

FISH data, and IST responses are summarized in Supplementary Table 1.

Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

Trisomy 8 bone marrow mononuclear cells show increased WT1 expression compared

to healthy donors and other MDS patients

Using real-time quantitative reverse transcription PCR (qRT-PCR), we assessed

expression of WT1 mRNA in bone marrow mononuclear cells (BMMNC) from 24 MDS patients

prior to treatment with IST (including 9 that did not receive IST) and of 22 healthy controls.

Levels of WT1 mRNA were increased in MDS patients with trisomy 8 compared to 22 healthy

controls (p<0.0001) and non-trisomy 8 patients (p=0.003), (Fig 1A) and were greatest in those

individuals who responded to IST (p=0.06). For patients with trisomy 8 MDS, mRNA expression

levels correlated with the percentage of trisomy 8 cells in bone marrow samples (R2=0.71;

p<0.0001) (Fig 1B).

To determine if increased mRNA expression resulted in increased WT1 protein levels,

we examined protein extracts from the bone marrow mononuclear cells (BMMNC) of 12 patients

with trisomy 8 MDS and 8 patients with non-trisomy 8 MDS by immunoblot and compared them

to 8 healthy controls (Fig1C). Actin and WT1 bands were quantified by immunoblot

densitometry and the ratio was calculated to control for differential protein loading. All patients

with trisomy 8 had increased WT1:actin ratios by immunoblot compared to healthy controls; 3/8

5
 non-trisomy 8 MDS patients also demonstrated elevated ratios consistent with increased levels of

WT1 mRNA detected by qRT-PCR.

As non-tandem DNA amplification of the 11q13 region is observed frequently in many

cancers14 and can be identified by fluorescence in situ hybridization (FISH), we examined the

WT1 gene in 6 patients using a probe for FISH analysis (a kind gift from John Crolla)15.

However, we were unable to detect duplication of the WT1 gene in trisomy 8 and diploid
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

BMMNC (Supplementary Fig 1).

WT1-specific T cells are present in patients with trisomy 8 and in patients with MDS who

respond to immunosuppression

We next analyzed functional T cell responses by intracellular cytokine staining after

stimulation of peripheral blood mononuclear cells (PBMC) with a comprehensive WT1 peptide

library. Thirty-eight patients with MDS were studied; 14 of these had trisomy 8 as the sole

cytogenetic abnormality, 19 were responsive to IST, 13 were non-responders and 6 patients were

not treated with IST. Specific T cell responses to WT1 were based on the detection of at least

one intracellular cytokine above background levels after stimulation with the peptide library

(gating strategy shown in Figs 2A). WT1-specific CD4+ and CD8+ T cell responses were

greatest in the patients who responded to IST. For CD8+ T cells, the mean frequencies in

responders and non-responders were 1.8% and 0.4% for TNFD (p=.0039) respectively, 1.5% and

0.66% for IL-2 (p=0.0777), and 0.25% and 0.021% for IFN (p=0.0671) respectively. For CD4+

T cells, the mean frequencies in responders and non-responders were 4.4% and 0.26% for TNFD

(p<0.0001), 1.2% and 0.010% or IL-2 (p<0.0001), and 0.19% and 0.023% for IFN (p=0.002)

6
 respectively (Fig 2B). In trisomy 8 patients, the percentage of trisomy 8 in the sample of bone

marrow correlated with the TNFD response to the peptide library (R2=0.40; p<0.0001) (Fig 2C).

In subsequent experiments, we analyzed functional CD8+ T cell responses to the HLA-

A*0201-binding WT1126-134 peptide by intracellular cytokine staining. This peptide was selected

due to reports of successful vaccination in patients with leukemia’s and solid tumors16;17. Twelve

MDS patients were analyzed, 4 of whom had trisomy 8 as the sole chromosomal abnormality.
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

Responses were considerably less than those generated by the entire WT1 peptide library,

suggesting that this epitope was not a main target of autologous T cells in some patients. The

mean frequency of CD8+ T cells that produced TNFD was only 0.05% in IST responders and

0.007% in healthy controls; whereas the mean frequency of TNFD producing CD4+ T cells was

0.08% in IST responders and 0.02% in healthy controls. Because of the wide variation in

patient response, these means were not significantly different (Fig 2D).

Identification of cognate CD8+ T cells specific for the immunodominant WT1126-134 peptide
restricted by HLA-A*201by tetramer analysis

Unstimulated PBMC samples from 25 HLA-A*0201+ patients with MDS, 9 of whom had

trisomy 8 as the sole cytogenetic abnormality, and 25 HLA-A*0201+ healthy donors were

analyzed for circulating WT1-specific memory CD8+ T cells by flow cytometry using the

cognate WT1126-134/HLA-A*0201 tetrameric complex. Analysis was performed in a double-

blinded fashion. The HIV p17 Gag77-85/HLA-A*0201 and CMV pp65495-503/HLA-A*0201

tetramers were used as a negative and positive controls, respectively (example seen in Fig 3A).

Cognate tetramer binding was significantly greater in the responders when compared to non-

responders (p<0.0001) and normal controls (p<0.0001) (Fig 3B).

7
 Proliferative responses of WT1-specific T cells

In order to further support the hypothesis that IST-responsive MDS patients show

evidence of an immune response against WT1, we examined specific proliferative responses in 5

responders, 1 non-responder, and 8 healthy controls by flow cytometry using a

carboxyfluorescein diacetate succinimidyl ester (CFSE) proliferation assay. The IST-responsive

Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

MDS patients showed evidence of proliferation primarily within the CD4+ T cell compartment;

no significant responses were observed in the healthy controls or non-responding patients.

Representative data are shown in Figure 4.

WT1-specific CD8+ T cells are contained within expanded V subfamilies and suppress

trisomy 8 colony growth

Expanded VE subfamilies within the total CD8+ T cell populations were identified

previously for a subgroup of patients in the present cohort2. We therefore examined these VE

expansions for the presence of WT1-specific CD8+ T cells in a patient with trisomy 8 (patient 4;

Supplementary Table 1; VE distribution profile for patient 4 seen in Fig 5A, upper panel).

Memory CD8+ T cells within the expanded VE subfamilies were identified by flow cytometry

and observed to specifically produce cytokine in response to stimulation with the WT1 peptide

library; whereas no analogous response was observed in the un-stimulated controls (Fig 5A,

middle panel). These V-3 subfamilies were previously sorted and found to be oligoclonal; two

predominant clonotypes (ASSDFRGAGYEQY and ASSGGLEQY), both using TRBJ2-7, were

detected2.

8
 To assess the ability of memory CD8+ T cells from the expanded VE subfamilies to

suppress the growth of trisomy 8 colonies, VE-expanded CD8+ T cells were isolated by flow

cytometric sorting, incubated with BMMNC for 4 hr, and then cultured for 14 days. Erythroid

and myeloid trisomy 8 cells were suppressed significantly by the VE-expanded CD8+ T cell

populations; in contrast, little or no inhibition was observed with the control population of non-

VE-expanded CD8+ T cells despite their 3-fold greater numbers compared with the specific VE-
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

expanded cells (Fig 5A, lower panel).

To confirm that cytotoxic lymphocytes from expanded V subfamilies are specific for

the WT1 cognate antigen, we analyzed one of the expanded VE populations in an IST-responsive

trisomy 8 MDS patient. Representative data is shown here. PBMCs were stained with

WT1/HLA-A*0201 tetramer, and anti-human CD3, CD8, CD27, CD45RO and VE fluorescence

conjugated monoclonal antibodies. We were able to detect the presence of WT1126-134/HLA-

A*0201 tetramer-binding, memory CD8+ T cells within the expanded VE3 subfamily (Fig 5B).

Tetramer-sorted CD8+ T cells were not studied in these experiments due to the

confounding activation and apoptotic effects of soluble ligand engagement18.

9
 Discussion

Pancytopenia appears to arise from immune-mediated suppression of hematopoiesis in

some patients with MDS19;20. To further our mechanistic understanding of T cell-mediated

myelosuppression in MDS, we focused our study on patients treated with immunosuppression.

Previously, we demonstrated the presence of CD8+ T cell VE subfamily expansions in these

patients and showed that these cells suppress the growth of trisomy 8 colonies2. Clinically, in
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

addition, this patient population is more likely to respond to IST20. Here, we examined the WT1

gene expression and show that it is higher in MDS, particularly in patients with trisomy 8. While

WT1 acts as a tumor suppressor in the kidney, its over-expression in hematopoietic cells is

associated with leukemia21. The mechanism for over-expression of WT1 in MDS is not well

understood; however, the association between WT1 expression and activation of the anti-

apoptotic genes, specifically A1/BFL122, could favorably affect the survival of cells that over-

express WT1. In this study, we demonstrated that WT1 is over-expressed in MDS and, in

particular, in the trisomy 8 form; indeed, the degree of WT1 over-expression correlated with the

percentage of trisomy 8 cells in the sample. Furthermore, WT1-specific CD8+ T cells, identified

by tetramer analysis and intracellular cytokine assays, suppressed trisomy 8 colony formation

and the presence of these cells correlated with a response to IST. It is likely that the immune

response of patients with MDS is directed against WT1 antigens other than WT1126-134 peptide

since the response of CD8 cells to the peptide library was ten-fold in excess of what it was for

WT1126-134 peptide. At least four native peptide nonamers from human WT1 have been shown to

generate a WT1-specific cytotoxic response capable of killing leukemic cell lines 23-25.

10
 The WT1126-134 epitope, restricted by HLA-A*0201, is the most extensively studied

immunogenic peptide derived from the WT1 protein. CD8+ T cells specific for this peptide are

seen in patients with myeloid malignancies and following allogeneic stem cell transplant26;27.

Antibodies specific for WT1 are also detectable in human leukemia and MDS patients28;29. We

previously demonstrated that WT1-specific CD8+ T cells exhibit a memory phenotype in

patients with leukemia and thus represent autoreactive T cells that have presumably escaped

clonal deletion10. In MDS, over-expression of WT1 may induce the expansion of such antigen-
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

specific CD8+ T cells, thereby leading to an autoimmune suppression of the MDS clone as well

as the residual normal marrow cells; the latter might be mediated by epitope spreading or via a

bystander effect from cytokines released during CD8+ T cell engagement of cognate targets.

Successful IST reduces the WT1-specific CD8+ T cell-induced marrow suppression (Fig 2

supplement) and hence allows hematopoietic recovery. The cytokine elaborated after

lymphocytes were exposed to the peptide library was primarily TNF- in all patients except one

patient who developed MDS after aplastic anemia; this patient’s lymphocyte secreted interferon

. Others have noted that lymphocytes from patients with AA over-express IFN- while those

from patients with MDS secrete TNF30. These findings suggest that despite their similarities,

the immunological processes in MDS and AA are different. Our findings do not exclude other

antigens from playing a role in the MDS-associated immune response. Indeed, in patients with

significant apoptosis, it is likely that apoptotic bodies31 and caspase-cleaved proteins32 might

themselves serve as antigenic stimuli.

The fact that the magnitude of CD4 and CD8 cytokine expression after incubation with

the WT1 peptide library was so much in excess of that directed against the WT1126-134 peptide

suggests that other peptides play a more prominent role immune response in these patients.

11
 This is consistent with the data of other investigators who found WT1 peptide 235–243

immunogenic enough to vaccinate patients with acute leukemia13. At least four native peptide

nonamers from human WT1 have been shown to generate a WT1-specific cytotoxic response

capable of killing leukemic cell lines 23-25. The finding that both CD4 and CD8 cells responded

to WT1 is consistent with data of other investigators who found a pronounced contraction of

naive and central memory cells and accumulation of effector and terminal effector–memory cells
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

within the CD4+ T-cell compartment in younger MDS patients responsive to IST.

MDS clones are not eradicated by the WT1-specific CD8 T cells. Other studies from our

laboratory suggest an explanation: trisomy 8, although susceptible to T cell attack, can avoid

apoptotic death by upregulating survivin and BCL-2, thereby blocking the caspase-dependent

pathway to apoptosis 33. Thus, although partially suppressed, trisomy 8 cells may avoid complete

elimination by CD8+ T cells. Such a mechanism would be in keeping with the hematological

recovery that can follow successful immunosuppression.

Our findings raise questions about the long-term outcome after IST in MDS. Reduction

in T cell auto-reactivity and subsequent unchecked proliferation of the MDS clone could

potentially increase the likelihood of disease progression. Nonetheless, in our experience of over

a decade of observation, patients receiving IST actually have a decreased progression to

leukemia1;2.

Several laboratories have generated WT1-specific CD8+ T cells against epitopes

restricted by HLA-A*0201 and HLA-A*240234-36. It is established that CD8+ T cells generated

against synthetic WT1 peptides lyse both autologous WT1-loaded cells and WT1-expressing

leukemia cell lines. In these studies, lysis of freshly isolated acute leukemia cells was shown to

be HLA-restricted and specific for WT1-expressing cells35, while normal hematopoiesis was not

12
 suppressed34;35. Indeed, WT1 peptide vaccines are currently under investigation by our group and

others as a form of immunotherapy for leukemias in which WT1 is over-expressed13;37. Our

findings suggest that a WT1-based vaccine could have paradoxical effects in MDS with over-

expression of WT1: thus, vaccine-boosted T cells might suppress the MDS clone but accentuate

marrow failure. Of note, it has been reported that 2 patients with hypoplastic MDS developed

severe pancytopenia after vaccination with WT1, necessitating the use of high-dose steroids to

abrogate the WT1-specific immune response38. On the other hand, vaccination might remove the
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

inciting cause of the immune response and eventually restore normal hematopoiesis. Overall,

then, WT1 vaccination in MDS patients should be performed with caution, especially in cases

associated with significant pancytopenia.

13
 Methods

Patients

Patients with MDS classified in accordance with the French-American-British (FAB)39

system were enrolled to receive treatment with horse ATG (Pharmacia, Kalamazoo, IN), ATG

plus cyclosporine (CsA) or CsA alone in sequential protocols 00-H-0169, 04-H-0026 and 95-H-

0189 approved by the Institutional Review Board of the National Heart, Lung and Blood
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

Institute. Patient characteristics are summarized in Supplementary Table 1.

Monoclonal antibodies

The following commercially available fluorochrome-conjugated monoclonal antibodies

(mAbs) were used: (i) DCD3-Alexa 700, DCD3-PECy7, DCD3-FITC, DTCR-FITC, DCD8-

Pacific Blue, DCD8-PerCP, DCD14-PE, DCD19-PE, DTNF-FITC, DIFNJ-Alexa 647, DIFNJ-

PECy7, DIL-2 allophycocyanin (APC) and DMIP1E-PE (BD Pharmingen); (ii) DCD28-FITC,

DCD28-PE, DCD27-PECy5, DCD8-PECy5, DCD4-energy-coupled dye (ECD) and DCD45RO-

Texas Red-PE (Beckman Coulter); (iii) DTCRVE-FITC and DTCRVE-PE (Immunotech); (iv)

DTCRV6.7 (Endogen); (v) DCD4-PECy5.5 (eBioscience); (vi) DTNF-PE, DIL-2-APC, DCD8-

APCAlexa 750, DCD14-Pacific Blue and DCD19-Pacific Blue (Invitrogen); and, (vii) DCD4-

PerCPCy5.5 (BioLegend).

Peptide synthesis

Peptides corresponding to optimal epitopes were prepared by Biosynthesis Inc.

(Lewisville, TX) to a minimum purity of 95%. The identity of each peptide was confirmed by

mass spectral analysis. The following peptides, all restricted by HLA-A*0201, were tested:

14
 WT1126-134 (RMFPNAPYL)34, cytomegalovirus (CMV) pp65495-503 (NLVPMVATV)40, and HIV-

1 p17 Gag77-85 (SLYNTVATL)41. The WT1 peptide library consisted of 127 sequential 15-mer

peptides, each overlapping by 11 amino acid residues (New England Peptide LLC).

Cell separation

Density gradient centrifugation with lymphocyte separation media (Organon) was used to

isolate PBMC and BMMNC as described previously42.

Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

Fluorescence in situ hybridization

Cells were treated with hypotonic buffer comprising KCl, HEPES (N-2-

hydroxyethypiperazine-N'-2-ethanesulfonic acid), EGTA (ethylene-glycotetra-acetic acid), and

NaOH to expose the nucleus at interphase, then fixed onto slides using methanol/acetic acid

(3:1). FISH was performed with probes for chromosomes 5q, 7, 11 and 8 (Vysis Inc.) as

described previously2. Percentage positive staining was based on a 400 cell score. Three different

observers, blinded with respect to sample identity, examined three different sets of slides and the

mean score was recorded. A healthy negative control and a trisomy 8 positive control were

included in each run.

Characterization of the TCR repertoire

Flow cytometry was used to analyze TCRV expression patterns within the circulating T

cell populations of MDS patients as described previously2. Fresh PBMC were stained with

DCD4, DCD8, DCD28 and one of 22 TCRV mAbs for 15 min at room temperature. The

distribution of VE subfamilies was determined within the total CD4+ and CD8+ T cell

15
 populations and also within the corresponding subpopulations that expressed low levels of

CD28. In addition, DTCRDE-FITC was used to determine the contribution of each VE subfamily

to the total DETCR repertoire. Values obtained for individual VE families were expressed as a

percentage of DE TCR-expressing CD4+ or CD8+ cells. Assignment of a VE expansion was

based on the observation of a percentage greater than two standard deviations above the mean

derived from a set of 12 age-matched healthy controls.

Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

Peptide-MHC class I tetrameric complexes

Biotin-tagged HLA-A*0201 heavy chains and recombinant ß2-microglobulin were

expressed as insoluble inclusion bodies in E. coli strain BL21(DE3)pLysS as described

previously Inclusion bodies were released by repeated freeze/thaw cycles and purified by

washing with 0.5% Triton X-100 buffer (Sigma). Soluble biotinylated peptide-MHC class I

(pMHCI) monomers were then produced and tetramerized with fluorochrome-conjugated

streptavidin as described previously10;10.

Flow cytometry for tetramer analysis

Sample staining was performed using 3 x 106 PBMC in 50 μL of PBS/1%FCS.

Fluorochrome-labeled tetramers (1-2 μg per test with respect to the pMHCI component) were

added for 15-30 min at 37°C. Cells were washed once in PBS/1% FCS, and subsequently stained

with pre-titrated DCD3, DCD8, DCD14 and DCD19 mAbs for 20 min at room temperature. After

a further wash in PBS containing 0·5 mM EDTA and 1% BSA, the cells were re-suspended in

1% paraformaldahyde. Data were acquired on a FACSCalibur or LSRII (BD BioSciences) flow

cytometer. A minimum of 0.5 x 106 cells was acquired in each case. The HIV/HLA-A*0201

16
 tetramer, refolded around the p17 Gag77-85 (SLYNTVATL) peptide, was used as a negative

control. The CMV/HLA-A*0201 tetramer, refolded around the pp65495-503 (NLVPMVATV)

peptide, was used as a positive or negative control according to serostatus.

Flow cytometry for intracellular cytokines production

To assess T cell immunoreactivity to WT1, 106 cells were suspended in RPMI 1640
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

supplemented with 10% heat-inactivated human AB serum (Gemini Bio-Product, Woodland,

CA), 2 mM L-glutamine, 100 U/mL penicillin and 100 μg/mL streptomycin (Invitrogen) (R10)

together with the co-stimulatory mAbs DCD28 and DCD49d (1 Pg/mL each; BD Pharmingen).

Stimulation was performed with pooled peptides constituting the WT1 peptide library (1 Pg/mL

final concentration for each individual peptide) or staphylococcal enterotoxin B (SEB, 1Pg/mL;

Sigma-Aldrich) as the positive control; medium alone was used as the negative control.

Following incubation for 1 hr at 37qC/5% CO2, brefeldin A (10 Pg/mL; Sigma-Aldrich) was

added and the cells were incubated for a further 5 hr. In some experiments, the cells were

stimulated with antigen from the start in the presence of brefeldin A and monensin (GolgiPlug

and GolgiStop, respectively; both from BD Pharmingen). Following stimulation, cells were first

stained with the live-dead cell discrimination dye Aqua-blue or violet (ViViD) amine-reactive

fluorescent dye (both from Invitrogen) to eliminate the dead cells and then with mAbs specific

for surface markers. In other experiments, the cells were stained with DTCRVE mAbs following

antigen stimulation, then stained with mAbs specific for CD3, CD4, CD8, CD27 and CD45RO.

Next, the cells were fixed and permeabilized with cytofix/cytoperm solution (BD Pharmingen)

and stained intracellularly for cytokines. Lastly, the cells were washed, fixed, and analyzed using

17
 a custom-built LSRII or FACSAria flow cytometer (BD). At least 200,000 events were acquired

per tube.

Data analysis was performed using FlowJo software (Tree Star Inc). The gating strategy

is depicted in Figure 2. First, live T cells were discriminated from dead cells, monocytes and B

cells by a CD3 versus ViViD/CD14/CD19 gate. In some experiments Aqua Blue was used

instead of ViViD, and CD14 and CD19 were not included in the analysis. Next, single cells were
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

identified in a forward scatter-area (FSC-A) versus FSC-height plot, followed by a FSC-A versus

side scatter-area plot to identify the lymphocyte population. Next, CD4+ and CD8+ T cells were

gated in a CD4 versus CD8 bivariate plot. Cytokines were identified directly in these T cell

subsets, or after the identification of central and effector memory CD4+ and CD8+ T cells

defined on the basis of CD27 and CD45RO expression.

Immunoblotting

Protein extracts were prepared from BMMNC as described previously43 and quantified

using the Micro BCA Protein Assay kit (Pierce, Rockford, IL). Electrophoresis at 125V was used

to resolve proteins (10g/lane) in 12% Tris-glycine SDS gels (Invitrogen). Resolved proteins

from the gel were then transferred to polyvinylidene difluoride (PVDF) membranes (Invitrogen,

Carlsbad, CA). The membrane was blocked for 2 hr with 5% BSA in PBS and 0.05% Tween-20,

then incubated with the primary mAb. Subsequently, membranes were incubated with the HRP-

conjugated secondary mAb and the bands of interest were detected using the ECL Plus system

(Amersham Pharmacia Biotech). Membranes were stripped after the first blotting in

ImmunoPure IgG elution buffer (Pierce), then re-blocked and re-blotted with another mAb. To

evaluate equal loading of the lanes, membranes were re-blotted with anti-actin polyclonal Ab.

18
 Densitometry analysis of the bands of interest was performed using ImageQuant analysis

software (Amersham Biosciences). Anti-WT1 mAb was purchased from Calbiochem; the anti-

actin polyclonal Ab and the HRP-conjugated mAbs were purchased from Santa Cruz

Biotechnology.

Measurement of WT1 mRNA by real-time quantitative reverse-transcription polymerase chain

Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

reaction (qRT-PCR)

RNA was treated with DNase I (Invitrogen) to eliminate genomic DNA, and random

hexamer primed cDNA was synthesized using the Advantage RT-for-PCR kit (Clontech). ABL

expression was used as the endogenous cDNA quantity control for all samples44; conditions for

the measurement of ABL expression were reported previously45. Expression of WT1 was

measured using 500 nM primers and 200 nM probe as described previously46. All qRT-PCR

reactions were performed in triplicate on 10 PL samples. The ABI PRISM 7900 sequence

detection system (Applied Biosystems) was used with standard conditions and 40 cycles of

amplification; primer and probe sequences for qRT-PCR are listed in Supplementary Table 2.

Carboxyfluorescein diacetate succinimidyl ester proliferation assay

PBMC from MDS patients and controls (1 x 106 viable cells) were pulse-labeled at a

concentration of 0.25 PM carboxyfluorescein diacetate succinimidyl ester (CFSE;

Invitrogen/Molecular probes) at 37q C, 5% CO2 for 6 min, followed by rapid quenching with

sterile R10. After repeated washes in R10, cells were re-suspended at a final concentration of 1 x

19
 106 cells/mL in R10 and placed in 48-deep well plates with 5 U of recombinant human IL-2

(PeproTech) and the co-stimulatory mAbs DCD28 and DCD49d (1.0 Pg/mL each). Cells were

stimulated with SEB (1Pg/mL; Sigma-Aldrich), the WT1 peptide library (1Pg/mL) or the

optimal WT1 126-134 peptide; R10 alone was used as the negative control in each case. Cells were

then incubated for 6 days in a light-protected environment at 37qC 5% CO2. After incubation,

cells were stained with Aqua-blue amine-reactive fluorescent dye and surface marker-specific
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

mAbs, fixed and acquired on a LSRII flow cytometer (BD). At least 200,000 events were

acquired per condition.

Trisomy 8 colony inhibition assay

To assess the effect of autologous CD8+ T cells on trisomy 8 hematopoiesis, we

performed short-term (14 day) colony culture after incubation of BMMNC for 4 hr with

autologous CD8+ T cells from the expanded V subfamily purified by flow cytometry as

described previously2. The ratio of BMMNC to CD8+ T cells during the incubation phase was

1:6 for the V-expanded CD8+ T cells and 1:18 for the non-V-expanded CD8+ T cells.

Statistics

Summary statistics were used to describe patient characteristics, baseline variables, and

treatment responses. Kaplan-Meier estimates were used to estimate the time-to-event

distributions of overall disease free survival and cumulative probability of response. Statistical

tests based on T-tests, likelihood ratio tests and Chi-squared tests were used to compare the

response rates, overall survival and leukemia evaluation between subgroups. Data analysis was

performed using the GraphPad Prism software package.

20
 Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

21
 Figure Legends

Figure 1. Increased WT1 mRNA and protein expression in trisomy 8 MDS. (A) qRT-PCR for

WT1 mRNA expression was performed on BMMNC from patients with trisomy 8 (N =11),

MDS patients with other cytogenetic abnormalities (N=13) and healthy donors (n=22) as

described in the Methods. Patients with trisomy 8 had significantly increased WT1 mRNA
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

expression levels compared to non-trisomy 8 MDS patients (p=0.003) and healthy donors

(p<0.0001). (B) The extent of WT1 over-expression was proportional to the percentage of

trisomy 8 cells in the BMMNC sample (p<0.0001) (R2 =0.71). (C) Immunoblots were performed

on samples of nuclear and cytoplasmic protein extracted from the BMMNC of 12 trisomy 8

patients, 8 patients with non-trisomy 8 MDS and 8 healthy controls; representative examples are

shown with densitometry readings expressed as ratio of WT1 protein:actin protein. All patients

with trisomy 8 showed significantly increased protein ratios of WT1:actin.

Figure 2. Functional WT1-specific T cells are present in IST-responsive MDS patients. (A)

PBMC from 38 patients with MDS were stimulated with a comprehensive WT1 peptide library

as described in the Methods. Cells cultured in R10 alone were used as negative controls. Gating

strategy: Live T cells were discriminated from dead cells, B cells and monocytes in a dump vs

CD3 bivariate plot. Next, single cells were selected in a forward scatter-area (FSC-A) versus

FSC-height (FSC-H) plot, and small lymphocytes in a FSC-A versus side scatter-area plot.

Fluorochrome aggregates were then excluded (not shown) prior to selection of the CD4+ and

CD8+ T cells. (B) Cytokine production after stimulation for 6 hours with the WT1 peptide

library or positive control (SEB); un-stimulated cells were used as a negative control. The

22
 percentage of cytokine producing CD4+ (bottom) and CD8+ (top) T cells for a representative

IST responder is indicated in these plots. (C) A composite figure for cytokine expression in

response to stimulation with the comprehensive WT1 peptide library in IST responders and non-

responders. (D) CD4 TNF production correlated with the percentage of trisomy 8 in BMMNCs

(p<0.0001) (R2 =0.40). (E) Functional CD8+ T cell responses to the immunodominant WT1126-

134 peptide were measured by intracellular cytokine staining. Responses were considerably less
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

than those generated by the entire WT1 peptide library.

Figure 3. Frequency of memory CD8+ cognate WT1126-134 HLA-A*0201 tetramer binding is

greater in IST responders than non-responders. (A) Gating strategy and an example of tetramer

binding is seen for patient 4. This demonstrates binding of the CMV tetramer to CD8 cells in this

CMV-seropositive patient and shows no binding to the HIV gag tetramer. The WT1126-134

tetramer binding is seen in memory CD8+ T cells (upper right), and is absent in both naïve and

memory-CD8 negative populations (bottom). (B) The mean frequency of memory CD8+ T cells

binding the WT1126-134 tetramer in IST responders was significantly higher than was observed in

IST non-responders (p<0.0001) and healthy controls (p<0.0001).

Figure 4. Responding patients show increased proliferation in response to the WT1126-134

peptide. Representative plots showing proliferation of CD4+ and CD8+ T cells in response to

stimulation with the WT1126-134 peptide. Proliferation was assessed in a flow cytometric assay

based upon staining and carboxyfluorescein diacetate succinimidyl ester (CFSE) titrations

described in the Methods. The percentage of divided cells is indicated in the top left corner in

each case. Gates were drawn with reference to the un-stimulated controls in each case.

23
 Figure 5. CD8+ T cells within expanded V subfamilies respond functionally to WT1 peptides

and suppress trisomy 8 colony growth. Functional and tetrameric analyses of CD8+ T cells

within expanded V subfamilies were performed in patient 4. (A) Expanded CD8+ T cell

subfamilies were identified by flow cytometry using directly conjugated V-specific mAbs

(upper panel). PBMC from patient 4 were stimulated with a comprehensive WT1 peptide library
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

and stained as described in the Methods. CD8+ T cells within the expanded V subfamilies

showed substantial intracellular IFN and TNF production compared to un-stimulated controls

(middle panel). Expanded CD8+ T cell subfamilies were sorted by flow cytometry using directly

conjugated V-specific mAbs, incubated with autologous marrow for 4 hours, and placed in

semisolid media for short-term culture (14 days). Suppression of trisomy 8 colony growth was

observed, relative to both controls in the absence of CD8+ T cells and in the presence of 3x the

number of CD8+ T cells from V subfamilies that were not expanded (lower panel). (B) Cognate

WT1126-134/HLA-A*0201 tetramer-binding memory CD8+ T cells are within the expanded V3+

subfamily.

24
 Supplementary Data

Supplementary Figure 1. FISH with probes directed at the WT1 gene and chromosome 8
show normal numbers of the WT1 allele. Samples of blood from trisomy 8 patients were
hybridized with probe to WT1 (orange) and chromosome 8 (green). WT1 gene duplication was
not detected with this technique.

Supplementaty Fig 2 Samples obtained from patients pre and post treatment show increasing
numbers of trisomy 8 cells and decreasing numbers of cytotoxic T cells directed at WT1.
Samples obtained from patients following a successful response to IST demonstrate that tetramer
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

binding cells decrease with treatment while the number of target trisomy 8 cells increases.

Supplementary Table 2: Primers for qRT-PCR

Gene Designation Sequence (5’Æ3’)

ABL Forward primer GATACGAAGGGAGGGTGTACCA

ABL Reverse primer CTCGGCCAGGGTGTTGAA

ABL TaqManTM probe TGCTTCTGATGGCAAGCTCTACGTCTCCT

WT1 Forward primer GATAACCACACAACGCCCATC

WT1 Reverse primer CACACGTCGCACATCCTGAAT

WT1 TaqManTM probe ACACCGTGCGTGTGTATTCTGTATTGG

25
 Reference List

1. Maciejewski JP, Risitano A, Sloand EM, Nunez O, Young NS. Distinct clinical outcomes

for cytogenetic abnormalities evolving from aplastic anemia. Blood 2002;99:3129-3135.

2. Sloand EM, Mainwaring L, Fuhrer M et al. Preferential suppression of trisomy 8

compared with normal hematopoietic cell growth by autologous lymphocytes in patients

Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

with trisomy 8 myelodysplastic syndrome. Blood 2005;106:841-851.

3. Sato T, Selleri C, Anderson S, Young NS, Maciejewski JP. Expression and modulation of

cellular receptors for interferon-gamma, tumour necrosis factor, and Fas on human bone

marrow CD34+ cells. Br.J Haematol. 1997;97:356-365.

4. Maciejewski J, Selleri C, Anderson S, Young NS. Fas antigen expression on CD34+

human marrow cells is induced by interferon gamma and tumor necrosis factor alpha and

potentiates cytokine-mediated hematopoietic suppression in vitro. Blood 1995;85:3183-

3190.

5. Chen G, Zeng W, Miyazato A et al. Distinctive gene expression profiles of CD34 cells

from patients with myelodysplastic syndrome characterized by specific chromosomal

abnormalities. Blood 2004;104:4210-4218.

6. Tsuboi A, Oka Y, Ogawa H et al. Constitutive expression of the Wilms' tumor gene WT1

inhibits the differentiation of myeloid progenitor cells but promotes their proliferation in

response to granulocyte-colony stimulating factor (G-CSF). Leuk.Res. 1999;23:499-505.

26
 7. Cilloni D, Gottardi E, Messa F et al. Significant correlation between the degree of WT1

expression and the International Prognostic Scoring System Score in patients with

myelodysplastic syndromes. J.Clin.Oncol. 2003;21:1988-1995.

8. Inoue K, Tamaki H, Ogawa H et al. Wilms' tumor gene (WT1) competes with

differentiation-inducing signal in hematopoietic progenitor cells. Blood 1998;91:2969-

2976.
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

9. Weber G, Karbach J, Kuci S et al. WT1 peptide-specific T cells generated from

peripheral blood of healthy donors: possible implications for adoptive immunotherapy

after allogeneic stem cell transplantation. Leukemia 2009;23:1634-1642.

10. Rezvani K, Grube M, Brenchley JM et al. Functional leukemia-associated antigen-

specific memory CD8+ T cells exist in healthy individuals and in patients with chronic

myelogenous leukemia before and after stem cell transplantation. Blood 2003;102:2892-

2900.

11. Rezvani K, Brenchley JM, Price DA et al. T-Cell Responses Directed against Multiple

HLA-A*0201-Restricted Epitopes Derived from Wilms' Tumor 1 Protein in Patients with

Leukemia and Healthy Donors: Identification, Quantification, and Characterization. Clin

Cancer Res 2005;11:8799-8807.

12. Oka Y, Tsuboi A, Elisseeva OA, Udaka K, Sugiyama H. WT1 as a novel target antigen

for cancer immunotherapy. Curr.Cancer Drug Targets. 2002;2:45-54.

27
 13. Oka Y, Tsuboi A, Taguchi T et al. Induction of WT1 (Wilms' tumor gene)-specific

cytotoxic T lymphocytes by WT1 peptide vaccine and the resultant cancer regression.

PNAS 2004;101:13885-13890.

14. Gibcus J, Kok K, Menkema L et al. High-resolution mapping identifies a commonly

amplified 11q13.3 region containing multiple genes flanked by segmental duplications.

Human Genetics 2007;121:187-201.

Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

15. Crolla JA, van H, V. Frequent chromosome aberrations revealed by molecular

cytogenetic studies in patients with aniridia. Am.J Hum.Genet. 2002;71:1138-1149.

16. Keilholz U, Letsch A, Busse A et al. A clinical and immunologic phase 2 trial of Wilms

tumor gene product 1 (WT1) peptide vaccination in patients with AML and MDS. Blood

2009;113:6541-6548.

17. Rezvani K, Yong ASM, Mielke S et al. Leukemia-associated antigen-specific T-cell

responses following combined PR1 and WT1 peptide vaccination in patients with

myeloid malignancies. Blood 2008;111:236-242.

18. Wooldridge L, Lissina A, Cole DK et al. Tricks with tetramers: how to get the most from

multimeric peptide-MHC. Immunology 2009;126:147-164.

19. Kordasti SY, Ingram W, Hayden J et al. CD4+CD25high Foxp3+ regulatory T cells in

myelodysplastic syndrome (MDS). Blood 2007;110:847-850.

20. Sloand EM, Rezvani K. The Role of the Immune System in Myelodysplasia: Implications

for Therapy. Seminars in Hematology 2008;45:39-48.

28
 21. Wagner KD, Wagner N, Schedl A. The complex life of WT1. J Cell Sci 2003;116:1653-

1658.

22. Simpson LA, Burwell EA, Thompson KA et al. The antiapoptotic gene A1/BFL1 is a

WT1 target gene that mediates granulocytic differentiation and resistance to

chemotherapy. Blood 2006;107:4695-4702.

23. Asemissen AM, Keilholz U, Tenzer S et al. Identification of a highly immunogenic HLA-
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

A*01-binding T cell epitope of WT1. Clin Cancer Res 2006;12:7476-7482.

24. Gao L, Xue SA, Hasserjian R et al. Human cytotoxic T lymphocytes specific for Wilms'

tumor antigen-1 inhibit engraftment of leukemia-initiating stem cells in non-obese

diabetic-severe combined immunodeficient recipients. Transplantation 2003;75:1429-

1436.

25. May RJ, Dao T, Pinilla-Ibarz J et al. Peptide epitopes from the Wilms' tumor 1

oncoprotein stimulate CD4+ and CD8+ T cells that recognize and kill human malignant

mesothelioma tumor cells. Clin Cancer Res 2007;13:4547-4555.

26. Rezvani K, Yong AS, Savani BN et al. Graft-versus-leukemia effects associated with

detectable Wilms tumor-1 specific T lymphocytes after allogeneic stem-cell

transplantation for acute lymphoblastic leukemia. Blood 2007;110:1924-1932.

27. Melenhorst JJ, Scheinberg P, Chattopadhyay PK et al. High avidity myeloid leukemia-

associated antigen-specific CD8+ T cells preferentially reside in the bone marrow. Blood

2009;113:2238-2244.

29
 28. Elisseeva OA, Oka Y, Tsuboi A et al. Humoral immune responses against Wilms tumor

gene WT1 product in patients with hematopoietic malignancies. Blood 2002;99:3272-

3279.

29. Gaiger A, Carter L, Greinix H et al. WT1-specific serum antibodies in patients with

leukemia. Clin.Cancer Res 2001;7:761s-765s.

30. Maciejewski JP, Risitano AM, Sloand EM et al. A pilot study of the recombinant soluble
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

human tumour necrosis factor receptor (p75)-Fc fusion protein in patients with

myelodysplastic syndrome. Br.J.Haematol. 2002;117:119-126.

31. Cocca BA, Cline AM, Radic MZ. Blebs and Apoptotic Bodies Are B Cell Autoantigens.

J Immunol 2002;169:159-166.

32. Rawson PM, Molette C, Videtta M et al. Cross-presentation of caspase-cleaved apoptotic

self antigens in HIV infection. Nat Med 2007;13:1431-1439.

33. Sloand EM, Pfannes L, Chen G et al. CD34 cells from patients with trisomy 8

myelodysplastic syndrome (MDS) express early apoptotic markers but avoid

programmed cell death by up-regulation of antiapoptotic proteins. Blood 2007;109:2399-

2405.

34. Gao L, Bellantuono I, Elsasser A et al. Selective elimination of leukemic CD34(+)

progenitor cells by cytotoxic T lymphocytes specific for WT1. Blood 2000;95:2198-

2203.

30
 35. Ohminami H, Yasukawa M, Fujita S. HLA class I-restricted lysis of leukemia cells by a

CD8(+) cytotoxic T-lymphocyte clone specific for WT1 peptide. Blood 2000;95:286-

293.

36. Oka Y, Elisseeva OA, Tsuboi A et al. Human cytotoxic T-lymphocyte responses specific

for peptides of the wild-type Wilms' tumor gene (WT1 ) product. Immunogenetics

2000;51:99-107.
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

37. Mailander V, Scheibenbogen C, Thiel E et al. Complete remission in a patient with

recurrent acute myeloid leukemia induced by vaccination with WT1 peptide in the

absence of hematological or renal toxicity. Leukemia 2004;18:165-166.

38. Oka Y, Tsuboi A, Murakami M et al. Wilms tumor gene peptide-based immunotherapy

for patients with overt leukemia from myelodysplastic syndrome (MDS) or MDS with

myelofibrosis. Int.J.Hematol. 2003;78:56-61.

39. Bennett JM, Catovsky D, Daniel MT et al. Proposals for the classification of the

myelodysplastic syndromes. Br.J.Haematol. 1982;51:189-199.

40. Diamond DJ, York J, Sun JY, Wright CL, Forman SJ. Development of a candidate HLA

A*0201 restricted peptide-based vaccine against human cytomegalovirus infection.

Blood 1997;90:1751-1767.

41. Ogg GS, Jin X, Bonhoeffer S et al. Quantitation of HIV-1-specific cytotoxic T

lymphocytes and plasma load of viral RNA. Science 1998;279:2103-2106.

31
 42. Sloand EM, Fuhrer M, Keyvanfar K et al. Cytogenetic abnormalities in paroxysmal

nocturnal haemoglobinuria usually occur in haematopoietic cells that are

glycosylphosphatidylinositol-anchored protein (GPI-AP) positive. Br.J.Haematol.

2003;123:173-176.

43. Solomou EE, Keyvanfar K, Young NS. T-bet, a Th1 transcription factor, is up-regulated

in T cells from patients with aplastic anemia. Blood 2006;107:3983-3991.

Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

44. Beillard E, Pallisgaard N, van dV, V et al. Evaluation of candidate control genes for

diagnosis and residual disease detection in leukemic patients using 'real-time' quantitative

reverse-transcriptase polymerase chain reaction (RQ-PCR) - a Europe against cancer

program. Leukemia 2003;17:2474-2486.

45. Yong AS, Szydlo RM, Goldman JM, Apperley JF, Melo JV. Molecular profiling of

CD34+ cells identifies low expression of CD7, along with high expression of proteinase

3 or elastase, as predictors of longer survival in patients with CML. Blood 2006;107:205-

212.

46. Ogawa H, Tamaki H, Ikegame K et al. The usefulness of monitoring WT1 gene

transcripts for the prediction and management of relapse following allogeneic stem cell

transplantation in acute type leukemia. Blood 2003;101:1698-1704.

32
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010
Fig 1A
 LogWT1:Ablx100
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010
Fig 1B

%trisomy8
p<0.0001
 Fig 1C

Nuclear WT1

Healthy MDS-Normal MDS-Trisomy 8

Control Cytogenetics
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

60kDa

actin

WT1:actin ratio 0.58 0.49 0.81 2.06 2.08 1.26 1.01 0.86

Cytoplasmic WT1

60kDa

actin

WT1:actin ratio 0.1 0.08 0.82 0.95 1.35 1.17 0.48 0.42
 A
Fig 2

Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

B
 Fig 2C

Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

 % CD4 TNF+

Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

Fig 2D

% trisomy 8
p<0.0001
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010
Fig 2E
 Fig 3A
(Patient 4)

Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

 Fig 3B

Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

 Fig 4

Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

 14
V subfamilydistribution
Fig 5A 12

Normalized%
(Patient 4) 10 Patient4
8 Healthy controls
6
4

2
Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010

0
14 2 17 7 3 1 5.1 22 8 21.3 6.7 20 9 23 16 13.1 12 13.6 5.3 5.2 11 18

WT1inducedCytokineexpressioninexpandedVsubfamilies
6 14

5 12 +WT1PeptideLibrary
10 Unstimulated

%TNF
%IFN

4
8
3
6
2
4
1 2
0 0
VE3 VE5.3 VE22 VE5.4 VE22

Suppressionoftri8coloniesbythesecombinedV subfamilies
60
Numbertri8Colonies

Control
45 NonSelected
Selected
30

15

0
 Fig 5B
(Patient 4)

Nature Precedings : hdl:10101/npre.2010.4154.1 : Posted 12 Jan 2010