Evolution and Taxonomy of The Grasses (Poaceae) : A Model Family For The Study of Species-Rich Groups

See discussions, stats, and author profiles for this publication at: https://www.researchgate.
net/publication/324652928
Evolution and Taxonomy of the Grasses (Poaceae): A Model Family for the
Study of Species-Rich Groups
Chapter · April 2018

DOI: 10.1002/9781119312994.apr0622
CITATIONS READS
8 3,744
1 author:
Trevor R Hodkinson
Trinity College Dublin
273 PUBLICATIONS 4,052 CITATIONS
SEE PROFILE
Some of the authors of this publication are also working on these related projects:
SUSTAIN: Endophytes for a Growing World View project
CerealPath View project
All content following this page was uploaded by Trevor R Hodkinson on 24 October 2018.
The user has requested enhancement of the downloaded file.

Annual Plant Reviews (2018) 1, 1–39 http://onlinelibrary.wiley.com
doi: 10.1002/9781119312994.apr0622
EVOLUTION AND TAXONOMY

OF THE GRASSES (POACEAE): A
MODEL FAMILY FOR THE STUDY
OF SPECIES-RICH GROUPS
Trevor R. Hodkinson
Department of Botany, School of Natural Sciences, Trinity College Dublin, The University
of Dublin, Dublin 2, Ireland
Abstract: The grass family Poaceae, with 11 500 species, is economically, eco-
logically, and evolutionarily one of the most successful species-rich groups.
Because of this, it represents a model family for the study of speciose taxa.
Routine DNA sequencing has accelerated progress in the evolutionary study
of grasses, leading to more stable taxonomic classifications; prototype DNA
barcoding systems; and a better understanding of their biogeography, physiology,
and ecology. This article examines the remaining challenges in the evolutionary
and taxonomic study of grasses. These include assessing the monophyly of
genera, improving species-level phylogenetics, establishing a comprehensive
DNA barcoding system, understanding diversification in geological time and
geographical/ecological space, understanding morphological and physiological
trait evolution (such as C4 photosynthesis, polyploidy, and spikelet morphology),
and understanding co-evolution with other organisms such as herbivores and
endophytic/mycorrhizal microbes.
Keywords: biogeography, DNA barcoding, C4 , co-evolution, diversification,

endophytes, grasses, grassland, phylogeny, Poaceae
1 Introduction
The grasses (Poaceae; alternative name Gramineae) are highly successful

from an evolutionary perspective with about 11 000–12 000 species divided
Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

© 2018 John Wiley & Sons, Ltd. Published 2018 by John Wiley & Sons, Ltd.
1
TR Hodkinson
among about 750–770 genera (Kellogg, 2015; Soreng et al., 2017). They
represent winners in the evolution of angiosperms having diversified
throughout the Cenozoic to become the fifth most species-rich family
of flowering plants, ranking only behind the Asteraceae (daisies, 23 000
spp.), Orchidaceae (orchids, 28 000 spp.), Fabaceae (beans, 33 000 spp.), and
Rubiaceae (coffee family, 13 500 spp.) (Hodkinson and Parnell, 2007a,b;
The Plant List, 2013). They are also ecologically dominant, covering, as
grasslands or bamboo forests, an estimated 40% of the Earth’s land surface
(Gibson, 2008).
Economically, grasses are by far the most important plant group, provid-
ing our staple cereals such as Eragrostis, Hordeum, Oryza, Secale, Sorghum,
Triticum, and Zea; sugar crops such as Saccharum and Sorghum; reeds such
as Arundo and Phragmites; and bamboo for food, building, and amenity
materials such as Bambusa and Phyllostachys (Clayton and Renvoize, 1986;
Hodkinson et al., 2000). They also provide many forage and lawn grasses
such as tropical species in Cynodon, Digitaria, Panicum, Paspalum, Pennisetum,
Stenotaphrum, Urochloa, and Zoysia or temperate species in Alopecurus,
Cynosurus, Dactylis, Festuca, Lolium, Phleum, and Poa (Hodkinson et al.,
2007a). Recently, they have become important sources of raw material for the
biomass and bioenergy industry such as Arundo, Miscanthus, and Saccharum
(Hodkinson et al., 2015; Jones et al., 2015) and provide many species of
horticultural value (Table 1).
There has been considerable progress in understanding the evolution of
grasses and applying this knowledge to taxonomy since the advent of cheap
and efficient DNA sequencing in the latter part of the twentieth century.
However, the size of the family in terms of species richness presents a major
obstacle to many research applications. This article therefore reviews the
evolutionary and taxonomic understanding of grasses and highlights the
research priorities including the following:
• Assessing the monophyly of genera and improving species-level phyloge-
netic reconstructions (Sections 2 and 3);
• Establishing accurate DNA barcoding systems (Section 4);
• Understanding diversification of grasses in geological time and geograph-
ical/ecological space, including their relationships with their closest allies
within the order Poales (Sections 5 and 6);
• Understanding the contribution of key innovations/traits to grass diver-
sification and ecological expansion such as savanna and temperate grass-
lands (Sections 7 and 8);
• Understanding co-evolution of grasses with other organisms such as her-
bivores and endophytic and mycorrhizal microbial communities (Sections
9 and 10).

2
Evolution and Taxonomy of the Grasses (Poaceae)
Table 1 Commonly known grasses found in Poaceae subfamilies with species numbers.
Sub-family Species no. Type genus Major genera/economic plants
Early diverging lineages

Anomochlooideae 4 Anomochloa Streptochaeta
Pharoideae 12 Pharus Pharus and Leptasis
Puelioideae 11 Puelia Puelia
BOP
Bambusoideae 1670 Bambusa Chusquea, Dendrocalamus,
Phyllostachys, and Olrya
Oryzoideae 115 Oryza Oryza (rice) and Zizania (wild rice)
Pooideae 3968 Poa Avena (oat), Hordeum (barley), Lolium
(ryegrass), Festuca, Secale (rye), Stipa,
Bromus (brome), Calamagrostis
(reed-grass), and Triticum (wheat)
PACMAD
Panicoideae 3241 Panicum Brachypodium, Digitaria (fonio), Zea
(maize), Saccharum (sugarcane),
Sorghum, Miscanthus, Panicum, and
Paspalum
Aristidoideae 367 Aristida Aristida
Chloridoideae 1602 Chlorus Eragrostis (teff), Eleusine (finger millet),
Muhlenbergia (muhly), and Sporobolus
(dropseeds)
Micrairoideae 184 Micrairia Micrairia
Arundinoideae 40 Arundo Arundo and Phragmites (reeds)
Danthonioideae 292 Danthonia Cortaderia (pampus grass)
2 Phylogeny
Molecular phylogenetic studies strongly support the placement of grasses

in Poales, a grouping of 14 families, of which Poaceae dominate in terms
of species number (APG IV, 2016; Wolowski et al., 2016). Within Poales,
the grasses form a ‘graminoid’ clade in combination with Ecdeiocoleaceae
(3 spp.), Flagellariaceae (5 spp.), Joinvilleaceae (2 spp.), and Restionaceae s.l.
(about 550 spp.). There have been conflicting phylogenetic analyses of rela-
tionships among Anarthriaceae, Centrolepidaceae, and Restionaceae (Briggs
et al., 2014). Thus, to stabilise the taxonomy of Poales, the APG IV (2016)
included Anarthriaceae and Centrolepidaceae in Restionaceae. Cyperaceae
(sedges) group with the Juncaceae (rushes) and Thurniaceae, forming a
‘cyperoid’ clade that is sister to the graminoid clade and are not as closely
related to the grasses as once believed (GPWG, 2001; Simpson et al., 2007).
The monophyly of Poaceae is strongly supported by DNA sequence data
and a number of other synapomorphies including the caryopsis with the
outer integument developmentally fused to the inner wall of the ovary, a
highly differentiated laterally positioned embryo, and the presence of exine

3
TR Hodkinson
channels in the monoporate pollen wall (GPWG, 2001; Kellogg, 2015). The
sister group to Poaceae has been inferred as Ecdeiocoleaceae (Bremer, 2002;
Rudall et al., 2005) or Joinvilleaceae (Doyle et al., 1992; Hilu et al., 1999; Clark
et al., 1995; Givnish et al., 2010). However, several recent studies including
a comprehensive sampling of Poales by Bouchenak-Khelladi et al. (2014a)
showed a combined group of Ecdeiocoleaceae and Joinvilleaceae to be sis-
ter to the grasses (Figure 1). Improved taxonomic sampling of outlying taxa
and more sequence data including plastomes are required to fully establish
the sister group of the grasses, an important task to understand graminoid
character evolution.
The earliest DNA sequence-based phylogenetic studies within Poaceae
were by Hamby and Zimmer (1988) using nuclear ribosomal DNA and
Doebley et al. (1990) using the plastid rbcL gene. Following these, a study by
Clark et al. (1995) using the plastid gene ndhF was the first to include a diverse
range of grass species and many previously poorly sampled Bambusoideae
and Oryzoideae taxa. Many single- and combined-gene analyses of plastid
and nuclear DNA sequences have subsequently been produced, but fewer
studies have used mitochondrial DNA (reviewed in GPWG, 2001; Hodkinson
et al., 2007a,b; Diekmann et al., 2013). The combined data analysis by GPWG
(2001) improved taxonomic sampling and included nuclear (PHYB, ITS2,
and gbssI), plastid (ndhF, rbcL, and rpoC2 sequences), and morphological
data. This was followed by many other studies using combined gene-region
J
E
Anomochlooideae 4
Pharoideae 12
Puelioideae 11
B Bambusoideae 1670
O Oryzoideae 115
P Pooideae 3968
Panicoideae 3241
P
A Aristidoideae 367
C Chloridoideae 1602
M Micrairoideae 184
A Arundinoideae 40
D Danthonioideae 292
(a) (b)
Figure 1 Phylogenetic relationships and species numbers of Poaceae subfamilies. (a)

Phylogenetic relationships of the grass family subfamilies and its closest allies
(PACMAD = Panicoideae, Arundinoideae, Chloridoideae, Micrairoideae, Aristidoideae, and
Danthonioideae; BOP = Bambusoideae, Oryzoideae, and Pooideae; J = Joinvilleaceae and
E = Ecdeiocoleaceae). (b) Species numbers in each subfamily, aligned to the tree.

4
data sets (Bouchenak-Khelladi et al., 2008; Vicentini et al., 2008; GPWG II,
2012; Morrone et al., 2012; Kelchner and BPWG, 2013; Soreng et al., 2015;
Fisher et al., 2016). In addition to these multi-gene studies, the full plastome
of many grasses has been sequenced and analysed in a phylogenetic context
including those from other families within Poales and core and outlying
Poaceae taxa (Diekmann et al., 2009; Cahoon et al., 2010; Morris and Duvall,
2010; Cotton et al., 2015; Saarela et al., 2015; Wysocki et al., 2015; Attigala
et al., 2016; Burke et al., 2016a; Duvall et al., 2016; Arthan et al., 2017). These
plastome studies added support to the internal branching pattern of the
phylogenetic trees and helped understand plastid evolution in the group. For
example, Wysocki et al. (2016) published the plastome of Joinvillea ascendens
and found two novel inversions specific to the Joinvilleaceae lineage and
at least one novel plastid inversion in the Joinvilleaceae–Poaceae lineage.
Comparative analyses also showed the loss and subsequent degradation of
the accD gene in the order Poales (Wysocki et al., 2016).
A strong consensus has emerged (Figure 1) for the relationships of
subfamilies of grasses that recognise the PACMAD clade containing Pan-
icoideae, Arundinoideae, Chloridoideae, Micrairoideae, Aristidoideae,
and Danthonioideae and the BOP clade (Bambusoideae, Oryzoideae, and
Pooideae). Anomochloa and Streptochaeta (Anomochlooideae) are sister to
the rest of the grasses and represent the earliest diverging lineage relative
to the rest of the grasses (hereafter ‘earliest diverging lineage’). These are
distributed in the Neotropics and are broad-leaved forest genera. The next
earliest diverging lineage is Pharoideae and then Puelioideae. Thus, the
relationships of the 12 grass subfamilies can be written as (A, P, Pu, (BOP),
and (PACMAD)) or visualised as a phylogenetic tree (Figures 1–4). Note: the
BOP clade is often quoted as the BEP clade where Oryzoideae is replaced
by Erhartoideae; the former acronym is followed here based on Soreng et al.
(2017). The relationships among these subfamilies have also been largely
resolved and considerable progress made in defining other higher order taxa
such as tribes and subtribes (Bouchenak-Khelladi et al., 2008; Stapleton et al.,
2009; Sungkaew et al., 2009a; Schneider et al., 2011; Kelchner and BPG, 2013;
Kellogg, 2015; Burke et al., 2016b; Soreng et al., 2017). There is still much to
understand at lower taxonomic ranks, especially at generic and subtribal
levels, but phylogenetic analyses now have a strong framework to allow
appropriate sampling of understudied taxa within groups that are known to
be monophyletic.
3 Classification and Taxonomy
The classification of grasses has been improved by the recent molecular phy-
logenetic studies, and a stable taxonomy is emerging especially at higher

5
TR Hodkinson
taxonomic ranks. These phylogenetic studies have revised the late twentieth
century whole grass family classifications by authors such as Clayton and
Renvoize (1986) and Watson and Dallwitz (1994) that were based mainly on
morphology and anatomy. The most comprehensive and recent treatments
provided by Kellogg (2015) and Soreng et al. (2015, 2017) both recognised
the same 12 subfamilies. The differences among these classifications may at
first appear substantial, but mostly reflect differences in how the phylogeny
is taxonomically divided (and the subsequent naming of groups) and are not
major distinctions in the core phylogenetic patterns. Kellogg (2015) recog-
nised 698 genera compared to 768 in Soreng et al. (2017), 30 tribes compared
to 52 tribes, and 53 subtribes compared to 90. Kellogg (2015) thus chose to
use fewer ranks below subfamily, avoiding all supertribe names, and tribes in
small or single tribe subfamilies, or subtribes in small tribes, whereas Soreng
et al. (2015, 2017) perpetuated tribal names since they are integral ranks in
the botanical code and have been used in the classification of the grasses for
some 200 years.
The species-rich subgroups of Poaceae outlined above are a major chal-
lenge to taxonomy because of their immense size (Hodkinson et al., 2007a).
Figure 1 shows the number of genera per subfamily, Figure 2 shows the
number of species per tribe, and Figure S1 shows the number of genera
per tribe. There are 10 tribes with approximately 500 or more species
(five in the BOP clade – Arundinarieae, Bambuseae, Poeae, Stipeae, and
Triticeae and five in the PACMAD clade – Andropogoneae, Cynodonteae,
Eragrostideae, Paniceae, and Paspaleae; Figure 2, red stars). Within these
species-rich groups, the large genera need to be revised if diversity within
the family is to be fully understood. Some progress is being made with the
largest grass genera including Agrostis (243 spp.), Bambusa (135 spp.), Bromus
(164 spp.), Chusquea (200 spp.), Digitaria (283 spp.), Eragrostis (423 spp.),
Festuca (640 spp.), Poa (583 spp.), Panicum (440 spp.), Paspalum (400 spp.),
and Stipa (149 spp.), although the size of some of these is diminishing
as new taxonomic treatments become available (Simon, 2014). Progress
is being made defining the monophyly of these and other smaller grass
genera. For example, the danthonioid genus Pentameris has been expanded
to include Prionanthium and Pentaschistis, leading to the transfer of over 50
species to Pentameris (Linder et al., 2010). The monophyly of many other
genera has been questioned such as Arundinaria (Stapleton et al., 2009),
Cortaderia (Barker et al., 2003, Eragrostis (Ingram and Doyle, 2004), Mis-
canthus (Hodkinson et al., 2002a), Panicum (Duvall et al., 2001), Pennisetum
(Doust and Kellogg, 2002), Setaria (Doust and Kellogg, 2002), and Sorghum
(Spangler, 2003). Apomicts, such as many species in Poa, also have their
own taxonomic challenges as do polyploids (Hodkinson et al., 2002b; Soltis
et al., 2007), which often include apomixes (Frodin, 2004; Hilu, 2007). Soltis
et al. (2007) suggested that taxonomists are underestimating species number
in angiosperms including grasses because of a failure to recognise many

6
Species
1000
1200
1400
200
400
600
800
0
Anomochloeae
EDL
Streptochaeteae
Phareae
Atractocarpeae
Guaduelleae
Streptogyneae
Ehrharteae
Oryzeae
Arundinarieae
Olyreae
Bambuseae
Brachyelytreae
Nardeae
Lygeeae
BOP
Duthieeae
Phaenospermateae
Brylkinieae
Meliceae
Ampelodesmeae
Stipeae
Diarrheneae
Brachypodieae
Poeae
Littledaleeae
Bromeae
Triticeae
Aristideae
Thysanolaeneae
Cyperochloeae
Centotheceae
Chasmanthieae
Zeugiteae
Steyermarkochloeae
Tristachyideae
Gynerieae
Lecomtelleae
Paniceae
PACMAD
Paspaleae
Arundinellieae
Andropogoneae
Arundineae
Molinieae
Micraireae
Eriachneae
Isachneae
Danthonieae
Centropodieae
Triraphideae
Eragrostideae
Zoysieae
Cynodonteae
Figure 2 Numbers of species per grass tribe. Tribes arranged into outlying lineages and
the major clades BOP and PACMAD. Red star highlights tribes with 500 species or more.

7
TR Hodkinson
distinct autopolyploids as species. Many autopolyploids can be considered

as separate species on several grounds, including separate geographic range,
reproductive isolation, and morphological distinctness (Soltis et al., 2007).
It is therefore clear that grass classification at generic level requires
considerably more work, and it is at this level where grass taxonomy should
now focus its attention. This assertion is supported by Vorontsova and
Simon (2012) who compared the species names accepted by the widely
used and accepted traditional classification system available in GrassBase
(Clayton et al., 2006) with the species names accepted by the recent research
results compiled in GrassWorld (Simon, 2014). They estimated that 10–20%
of Poaceae species will have moved to a different genus by the time the
realignment is complete, to accommodate the present-day circumscription
of grass genera based on monophyly. The average name change required for
species within the family is around 10%, but particularly well-studied and
large groups, such as Paniceae and Paspaleae, will require 17–18% name
change (Vorontsova and Simon, 2012).
There is therefore a pressing need for accelerated monographic work at
generic level (Teerawatananon et al., 2014), but progress is slow, especially
for large genera (Hodkinson et al., 2007a). Stuessy (1993) estimated that a
typical taxonomic PhD monograph-type project of 3–4 years might include
10–40 species, depending on the amount of macromolecular work. Thus,
covering a species-rich group with sufficient scientific rigour is likely to take
a long period of time. However, digitisation of taxonomy has improved the
outlook, and several excellent online resources are now available. Global
initiatives include the Catalogue of Life (www.catalogueoflife.org/), Global
Biodiversity Information Facility (GBIF; www.gbif.org), International Plant
Names Index (IPNI; www.ipni.org), and Tropicos (www.tropicos.org/Home
.aspx). Web-based databases are also available specifically for the grasses
including descriptive treatments of all grass genera, species, and their
synonymy (GrassBase; Clayton et al., 2006); the Grass Genera of the World
Database (Watson et al., 1992); the Catalogue of New World Grasses (CNWG;
www.tropicos.org/Project/CNWG); and GrassWorld (Simon, 2014).
Progress has also been made towards digitising herbarium specimens
in the form of scanned images. Virtual herbaria have many uses and can
be particularly useful for access to type specimens, although a photograph
can never replace a specimen (Bisby et al., 2002). These include the Kew
Herbarium Catalogue (http://apps.kew.org/herbcat/navigator.do), the
US National Herbarium’s Botanical Type Specimen Register (https://
collections.nmnh.si.edu), Tropicos, and the CNWG. Digital floras have also
been produced. For example, AusGrass2 (Simon and Alfonso, 2011) provides
an interactive key with maps, species descriptions, and line illustrations of
Australian grasses. Likewise, the Grasses for North America project (http://
herbarium.usu.edu/grassmanual) have similar information for that region.
In addition to scanned specimens and line drawings, there is huge potential

8
Figure 3 High-quality digital imaging in grass taxonomy. Example of Bromus

danthoniae from the Flora of Iraq project. Source: Courtesy of Sophie Neale and Tony
Miller.
in digital photography of fresh specimens and shape-recognition software

for identification based on morphology (Hall and Miller, 2011). Figure 3 is
an example from the Flora of Iraq project (Miller, personal communication)
showing how digital photography can be used in combination with line
drawings for quick identification of grasses in floras. One challenge to
the global grass taxonomy community will be to produce a standardised
and agreed list of accepted names (and synonyms). For example, Tropicos,
GrassWorld (Simon, 2014), and the GrassBase databases are not fully con-
gruent, although considerable progress is being made to achieve this ideal
(Vorontsova et al., 2015).
4 DNA Barcoding
DNA barcoding (Hebert et al., 2003) offers high potential for species iden-
tification in grasses that can be difficult to identify to species level. This
approach is particularly valuable for non-specialist grass scientists or those
without access to grass specimens in herbarium collections for morpho-
logical comparison. It also offers high value for identification of grasses

9
TR Hodkinson
from environmental samples such as soil/roots, specimens in a vegetative

state without flowers, and for grasses that rarely flower such as bamboos
(Burke et al., 2014; Gamuyao et al., 2017). The same DNA sequences can
also be used for many other applications in grass evolutionary studies such
as phylogenetics and can be added to international databases including
GenBank for global access and ease of searching.
Few doubt the potential of DNA barcoding, but the technology only
offers a partial solution to taxon recognition and identification as it needs
to be combined with morphological based taxonomy (Chase et al., 2007).
A number of limitations and reservations of DNA barcoding have been
raised and include concerns about sequence quality, insufficient sampling
within and among species, pseudogenes, herbarium specimen quality
and availability, type specimen use, common occurrence of inter-specific
hybridisation and introgression, and associated DNA exchange (capture)
between closely related species (Seberg and Peterson, 2007).
The task of developing an efficient DNA barcoding system for grasses is
not trivial and is very much in its infancy for a number of reasons. Firstly,
there are no currently agreed upon DNA barcoding standards for the
grasses. Secondly, insufficient studies have assessed the utility of potential
DNA regions to determine infra- versus inter-specific variation to ensure
that the ‘barcoding gap’ between species is sufficient to discriminate closely
related taxa (CBOL PWG, 2009; Hollingsworth et al., 2009), and thirdly,
a reference collection of well-vouchered sequences is not available for
an agreed checklist of world grasses. The lack of a comprehensive DNA
barcoding reference database for the majority of grass species dictates
that the present-day DNA barcoding identification is often restricted to a
higher taxonomic rank and to genus at best in many cases, unless the grass
species is common and/or economically valuable and hence has much DNA
sequence data available. Kellogg (2015) reports that there is suitable DNA
sequence data available for about a third of all grass species, and a survey
in November 2017 (Hodkinson, unpublished) indicates that approximately
50% are represented with appropriate molecular data, but far fewer with
standard plant barcoding sequences. There is still a long way to go before
a reliable system is available, and there is, therefore, a pressing need to
accelerate barcoding work in grasses. For land plants and angiosperms in
general, two plastid loci (rbcL and matK) have been shown to have high value
as they are routinely retrievable with a single primer pair, are amenable
to bidirectional sequencing, and provide maximum discrimination among
species (Chase et al., 2007; CBOL PWG, 2009). These loci also show good
potential with grasses. Indeed, Drumwright et al. (2011) demonstrated
95% species identification with rbcL and matK loci for 24 grass species. For
maximum utility of barcoding it is essential for the reference database to be
as complete as possible in terms of species coverage, so it would be most
beneficial if barcoding of grasses at least includes these two loci.

10
The matK and rbcL sequences will, in many cases, need to be supplemented
by additional loci for accurate grass species identification (Kress and Erick-
son, 2007; Peterson et al., 2014; Bieniek et al., 2015; Su et al., 2016; Wang et al.,
2017). Hodkinson et al. (2007b) reported that the highest coverage of genes
in GenBank for grass species diversity studies and barcoding included nrITS,
matK, rbcL, ndhF, trnL, gbss1, phB, rps16, rpoA, and rpoc2. The efficacy of some
of these regions has been tested for DNA barcoding purposes in grasses.
Wang et al. (2017) showed matK and several others to be of value, includ-
ing atpF, ETS, and nrITS. López-Alvarez et al. (2012) suggested that plas-
tid trnL-F and nuclear (ITS, GI) combine well for Brachypodium. The plastid
atpB-rbcL spacer has shown high utility for some groups, such as the bam-
boos (Sungkaew et al., 2009a,b) and panicoids (Teerawatananon et al., 2011).
There are some drawbacks posed using the multi-copy nrITS region in plants,
such as the potential presence of paralogous and recombinant copies, and
its predominant concerted evolution towards one of the parental copy types
(López-Alvarez et al., 2012), but combining loci can help detect hybrids and
reduce the risk of misidentification with a single locus (Zimmer and Wen,
2012).
Table 2 provides the recommended primer sequences and reference
information for commonly used DNA barcoding regions that the author’s
research group has found useful for a wide range of Poaceae. Figure S2 from
Diekmann et al. (2009) shows the relative genome positions of the plastid
barcoding regions listed in Table 2. Given the advances in massively par-
allel sequencing (MPS = next-generation sequencing) and third-generation
sequencing approaches Nanopore (MiION; Oxford) and real-time (SMRT)
reviewed in Bleidorn (2016), it is now possible to efficiently and simulta-
neously sequence multiple loci such as matK, rbcL, ITS, trnH-psbA, trnL-F,
and gbss1, as an alternative to standard Sanger sequencing of individual
loci. Using this approach, multiple loci are sampled; regions from nuclear,
plastid, and mitochondrial DNA can be combined, and problems with
multiple copies of regions such as nrITS and ETS are overcome (Hodkinson
et al., 2002b; Zhang et al., 2011; Shokralla et al., 2014), and there is no need
for the molecular cloning of PCR products. There is also the potential to effi-
ciently sequence entire plastomes of grasses (Duvall et al., 2016; Perdereau
et al., 2017), and these entire regions could replace standard barcodes in the
future. MPS and third-generation sequencing-based methods will increase in
popularity, and it is likely that efficient and affordable field-based barcoding
devices will be developed (Campbell et al., 2015; Bleidorn, 2016). Linked to
DNA barcoding, there is also a need for DNA banking of extracted grass
DNA to include as many species as possible. These collections have wide
application and need to be linked to herbarium collections and the voucher
specimens contained therein (Hodkinson et al., 2007c).

11
Table 2 Commonly used loci for DNA barcoding and phylogenetics in the grasses with primer sequences provided for amplification.
Locus Primer Sequence 5′ –3′ Tm (∘ C) Reference(s)

name
Nuclear
ITS 17SE F ACGAATTCATGGTCCGGTGAAGTGTTCG 62 Sun et al. (1994)
26SE R TAGAATTCCCCGGTTCGCTCGCCGTTAC 62 Hodkinson (unpublished)
gbssI (waxy) F F TGCGAGCTCGACAACATGCG 67 Mason-Gamer et al. (1998)
k-bac R GCAGGGCTCGAAGCGGCTGG 72
Plastid
matK 19F F CGTTCTGACCATATTGCACTATG 58 Molvray et al. (2000)
9R R GCTAGAACTTTAGCTCGTA 46 Hilu et al. (1999)
390F F CGATCTATTCATTCAATATTT C 50 Cuenoud et al. (2002)
trnK-2R R AACTAGTCGGATGGAGTAG 48 Johnson and Soltis (1994)
rbcL 1F F ATGTCACCACAAACAGAAAC(TAAAGC) 52 (61) Lledó et al. (1998)
12
724R R TCGCATGTACCYGCAGTTGC 63 Olmstead and Palmer (1994)
627F F CATTTATGCGCTGGAGAGACCG 65
1504R R GAATTACTGATTTCGCAAC 49
trnH-psbA trnH-psbA-F F ACTGCCTTGATCCACTTGGC 61 Hamilton (1999)
trnH-psbA-R R CGAAGCTCCATCTACAAATGG 58 Kress and Erickson (2007)

trnL and trnL-F trnLc F CGA AAT CGG TAG ACG CTACG 59 Taberlet et al. (1991)
trnLd R GGGGATAGAGGGACTTGAAC 56
trnLe F GGTTCAAGTCCCTCTATCCC 56
trnLf R ATTTGAACTGGTGACACGAG 55
atpB-rbcL 2R F GAAGTAGTAGGATTGATTCTC 46 Samuel et al. (1997)
1R R GTTTCTGTTTGTGGTGACAT 52
ndhF 032F F TACCTTTTCTTCCACTTCCAGTT 57 Bouchenak-Khelladi et al. (2014)
1318R R GAAACATATAAAATGCGGTTAATCC 58
1101F F GGAACCTATTGTTGGATATTCACC 59
2110R R CCCCCTATATATTTGATACCTTCTCC 59
rps16 16F F GTGGTAGAAAGCAACGTGCGACTT 64 Oxelman et al. (1997)
2R R TCGGGATCGAACATCAATTGCAAC 67
TR Hodkinson
5 Age of the Grasses
Early Poales fossils date back to the late Cretaceous. For example, pollen
matching Poaceae or Restionaceae (known generically as Monoporites annu-
latus) has been discovered in the Maastrichtian deposits of Africa and South
America greater than 65 million years ago (Ma) (Linder, 1987; Wolowski
et al., 2016). Unfortunately, it was not possible to differentiate these two
families with these grass-like pollen grains because they were insufficiently
preserved to identify grass diagnostic channels in their exine walls. However,
Poaceae microfossils were reported by Prasad (2005) who found epidermal
silica bodies called phytoliths from at least five major subgroups of grasses
on the Indian continent dating from about 70 to 65 Ma (late Cretaceous).
Such phytolith fossils are providing fresh data for dating phylogenetic
trees and documenting the spread/expansion of grasses around the world
(Strömberg, 2011).
Unequivocal macrofossil recordings of Poaceae date from the Palaeocene/
Eocene boundary at 55 Ma (Crepet and Feldman, 1991) and included entire
plants with inflorescences, spikelets, anthers, and pollen. However, it was not
possible to identify these fossils confidently to subfamily level even though
they have two florets per spikelet and raceme-like panicles. These features
could place them in Aveneae (Pooideae) or Arundineae (Arundinoideae), but
it is not certain (Crepet and Feldman, 1991). Among the earliest clearly iden-
tifiable macrofossil is Pharus preserved in amber and trapped in mammalian
hair dating to 45–30 Ma (late Eocene/early Oligocene; Poinar and Columbus,
1992). Fossil grasses suitable for dating are reviewed in Bouchenak-Khelladi
et al. (2010, 2014a), Strömberg (2011), Christin et al. (2014), and Kellogg (2015).
It is possible to conclude that, on the basis of fossil evidence, grasses
including BOP and PACMAD clades can be dated back to 55 and 70 Ma if
grass-like pollen and phytoliths are considered. Despite the early origins
of the family, grass macrofossils and grass pollen, and indirect palaeo-
faunal evidence from herbivore morphology, suggest that widespread
grass-dominated ecosystems did not develop until much later in the Ceno-
zoic and can be dated to the early/middle Miocene (25–15 Ma; Jacobs et al.,
1999; Strömberg, 2011). By this time all the currently recognised subfamilies
of grasses would already have been present.
A number of studies have combined fossil and molecular dating analyses
to estimate the age of major clades in the grasses and Poales (Christin et al.,
2008, 2014; Bouchenak-Khelladi et al., 2009, 2010, 2014a; Hodkinson et al.,
2010; Figure 4). These have been broadly successful but are complicated by
a number of issues including the paucity of the fossil record, the uncertainty
in calibrating reference nodes with fossils, the uncertainty of the proposed
phylogeny, and deviations of its branches from the molecular clock (Christin
et al., 2014). Molecular phylogenetic dating has estimated the origin of Poales
to the mid-Cretaceous (115 ± 11 Ma) and the origin of Poaceae at between 100

13
TR Hodkinson
C4 Cenchrinae
C3 Melinidinae
C3 + C4 Panicinae
Homopholis clade
Dichanthelium clade
Neurachninae
Hylebates
Sacciolepis clade
Acritochaete
Boivinellinae
Anthephorinae
Panicoideae
Andropogoneae
Arundinelleae
Reynaudia
Paspalinae
Otachyrinae
PACMAD
Arthropogoninae
Gynerieae
Zeugiteae
Chasmanthieae
Centotheceae
Cyperochloeae
Thysanolaeneae
Tristachyideae
Eriachneae
Isachneae Micrairoideae
Micraireae
Arundinoideae
Danthonioideae
Centropodia clade
Triraphidieae
Eragrostideae
Zoysieae
Chloridoideae
Cynodonteae
Aristidoideae
Oryzeae
Ehrharteae Oryzoideae
Bambuseae
Olyreae Bambusoideae
Arundinarieae
Brachyelytreae
Nardeae
BOP
Stipeae
Phaenospermateae
Meliceae
Brachypodieae
Pooideae
Bromeae
Triticeae
Poeae 2
Poeae 1
Puelioideae
Pharoideae
Anomochlooideae
70 60 50 40 30 20 10 0 Ma
First C4 fossils C4 dominant grassland
First grasses, forest Open habitat C3 grasslands
Figure 4 Dated phylogenetic tree of the grasses and distribution of C3 and C4 grass
lineages. Multiple origins of C4 photosynthesis are evident. Analysed from the GPWG II
(2012) dataset and dated using MULTIDIVTIME and fossil calibration points outlined in
Christin et al. (2014); Anomochlooideae added for completeness. Source: Courtesy of
Christin, P-A.

14
and 60 Ma, depending on whether the root or crown node is considered for
calibration and which fossils are applied (Bremer, 2002; Christin et al., 2014).
Figure 4 shows a time-calibrated tree based on the molecular dataset of the
GPWG II (2012) and is presented here for the first time (unpublished; anal-
ysed by P. A. Christin using MULTIDIVTIME and with Anomochlooideae
added manually for completeness). It shows the relative ages of clades and
demonstrates with the BOP clade diverging at approximately 50 Ma and the
PACMAD at approximately 40 Ma. These dates might be considered conser-
vatively young because Christin et al. (2014) showed that divergence times
in the grasses are strongly affected by different implementations of fossil
calibration points. Their analyses calibrated with macrofossils estimated the
age of core Poaceae at 51–55 Ma, but the inclusion of microfossil evidence
pushed this age to 82–74 Ma. Thus, there is disagreement among molecular
dated phylogenetic trees of the grasses and scope for improvement with
additional data and fossil calibration. The dates are critical in understanding
and correctly interpreting the biogeographic origins and diversification of
the grasses. However, major progress has been achieved with interpreting
the fossil record of the grasses in a global context (Strömberg, 2011; Sections
8 and 9).
6 Biogeography and Habitat Reconstructions
The biogeographic origins of the grass family are hard to determine from
the complex multi-continental distribution pattern of the early diverging lin-
eages within the family and its close relatives. For example, the sister groups
to the grasses vary considerably in biogeography. Joinvilleaceae is found in
Borneo, New Caledonia, and throughout the Pacific, but Ecdeiocoleaceae
is restricted to Australia. In contrast, the earliest diverging lineage of the
Poaceae (Anomochlooideae) is distributed in Central and South America,
the next earliest diverging lineage (Pharoideae) is pantropical, and the
next (Puelioideae) is restricted to tropical Africa (Hodkinson et al., 2007a,b;
Bouchenak-Khelladi et al., 2010).
Despite these complex distributions and paucity of the fossil record, an
overall Gondwanan origin for the Poales and Poaceae has been inferred with
confidence (Bremer, 2002; Prasad, 2005; Bouchenak-Khelladi et al., 2010,
2014a). Much can be learnt about pre-historical biogeography of grasses
using phylogenetic trees with comprehensive taxon sampling, including rep-
resentatives of clades with broadly differing geographical origins. In these
reconstructions, analyses optimise the geography of taxa on trees (that is on
nodes throughout the tree). Various types of phylogenetic reconstruction and
related methods such as vicariance dispersal analysis are commonly used for
this purpose. Bremer (2002) used vicariance dispersal analysis on phyloge-
netic trees of Poales, and his reconstructions suggest that Poaceae originated

15
TR Hodkinson
in South America and that the graminoid clade and Poales originated in Aus-
tralia. More detailed historical biogeographic patterns have been inferred
using large phylogenetic trees and other methods of biogeographic recon-
struction by Bouchenak-Khelladi et al. (2010). They also inferred a Gond-
wanan origin of Poaceae (dated to the late Cretaceous) but showed the earliest
grasses to be either African or South American, depending on the type of
analysis. This ambiguity is not altogether surprising because despite the sep-
aration of the African and South American continents by the end of the Albian
(mid-Cretaceous, 96 Ma), plant dispersals would have been common between
them across the newly formed Atlantic until the early Cenozoic through a
series of islands (Morley, 2000). Within the grasses, Bouchenak-Khelladi et al.
(2010) dated the crown node of the BOP + PACMAD clade at 57 Ma, in the
early Eocene, and their biogeographic reconstructions showed that grasses
had dispersed to all continents by approximately 60 million years after their
Gondwanan origin in the late Cretaceous.
In a similar way to biogeography, it is also possible to reconstruct the
past broad habitat types of grasses and to date these (Bouchenak-Khelladi
et al., 2010, 2014a,b; Strömberg, 2011; Wolowski et al., 2016; Figure 4).
Anomochlooideae, Pharoideae, and Puelioideae currently inhabit shaded
tropical or warm temperate forest understories (GPWG, 2001; Kellogg,
2001), and their ancestral habitat has been inferred as being closed for-
est canopy (Bouchenak-Khelladi et al., 2010; Edwards and Smith, 2010;
Figure 4). The evidence therefore suggests that proto-grasses first inhabited
moist and forested environments and then expanded into open habitats
including temperate grasslands that are currently dominated by C3 pooid
and oryzoid taxa and tropical grassland/savanna that are currently dom-
inated by C4 PACMAD taxa (see Section 8.3 for the discussion of C3 /C4
evolution; Bouchenak-Khelladi and Hodkinson, 2011). Strömberg (2011)
shows, using multiple fossil datasets from each continent, that the first
open habitat grasslands existed 35 Ma (Oligocene–Eocene), but these taxa
had adapted to open habitats as early as the late Eocene, a date consistent
with recent phytolith fossil data for North America (Strömberg, 2011). The
BOP clade members appear to have adapted to open habitats earlier than
PACMAD grasses (Figure 4); this was inferred to occur in Eurasia in the
Oligocene (Bouchenak-Khelladi et al., 2010). Thus, the emergence of C3
grass-dominated habitats predated C4 habitats by approximately 20 million
years (Strömberg, 2011).
7 Patterns of Diversification
The histograms in Figure 2 show that some subfamilies/tribes are more

species rich than others. Within these, there are 22 genera with over 100

16
250
200
Number of genera
150
100
50
0
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
33
35
36
37
40
45
50
55
60
65
70
80
90
100
110
120
150
160
220
230
250
270
300
330
350
450
470
500
Number of species per genus
Figure 5 Species number of genera in the grass family. Pattern follows a hollow curve
distribution with a predominance of monotypic and small genera and a few genera with
exceptionally high species number. Source: Hilu (2007).
species including Agrostis, Arundinaria, Bambusa, Eragrostis, Festuca, Poa,

Panicum, Paspalum, and Stipa but over 700 genera with less than 10 species
(including 230 monotypic genera) (Watson and Dallwitz, 1994; Hilu, 2007).
The species-rich genera dominate to such an extent that 3% of them contain
50% of all grass species (Hilu, 2007). The frequency distribution pattern
for the number of species within the genera approximates to a logarithmic
curve (the hollow curve; also known as the Willis curve) and is typical of
angiosperm families (Clayton and Renvoize, 1986; Hilu, 2007). Given that
there are an estimated 750–770 genera of grasses (Kellogg, 2015; Soreng et al.,
2017), the distribution is skewed towards monotypic genera and those with
few species (Figure 5). The same is true for subtribes (Figure S1). Therefore,
the concept of average generic size is almost meaningless (Clayton and
Renvoize, 1986).
The biological and evolutionary reasons for these patterns of grass species
richness are not fully understood (Frodin, 2004; Hilu, 2007), but considerable
progress has been made using large phylogenetic trees with comprehensive
levels of sampling (Salamin et al., 2005; Hodkinson et al., 2007a,b). When
phylogenetic trees are viewed, they are generally not symmetrical because
sister clades are not of equal size. It is possible to identify where on the trees
the imbalance lies and hence detect where significant shifts in diversification
have occurred (Chan and Moore, 2005). It is then possible to investigate
the factors that correlate with these shifts to help determine the processes
that may have led to these diversification patterns. The significance of
imbalance in phylogenetic trees can be assessed using topological and
temporal analyses, but both the methods require trees with comprehensive
and representative sampling, which is a major limitation for species-rich
groups. To overcome this in grasses, Hodkinson et al. (2007a,b) used a
supertree approach to include nearly all grass tribes (39) and over 400 genera

17
TR Hodkinson
in a phylogenetic reconstruction. They used the topological M statistics

of Chan and Moore (2005) to assess diversification rate variation on their
supertree. They showed that the tree was imbalanced and that significant
shifts in diversification rate variation had occurred at least six times. The
statistic indicated that a shift in diversification occurred in a group known
as the spikelet clade, following the divergence of Anomochlooideae. Other
shifts included the species-rich subfamilies or parts of subfamilies, including
the chloridoids, a clade within the chloridoids, a clade in the panicoids
(Paniceae), and a clade in the pooids (an Aveneae-Poeae subgroup). Spriggs
et al. (2014) took a similar approach and recorded 18 shifts in diversification
across the Poaceae using a large multi-gene tree with 3600 taxa and related
the shifts to photosynthetic type with radiations occurring in both C3 and
C4 lineages. Pimentel et al. (2017) assessed shifts in diversification in the
Pooideae and found that diversification was especially intense during the
Oligocene–Miocene and that the background diversification rate increased
significantly at the time of the origin of the Poodae + Triticodae clade – a
diversification shift occurring at a time of falling global temperatures
that potentially increased ecological opportunities for grasses adapted
to open habitats. More studies such as these are required to help iden-
tify diversification patterns before the underlying processes can be fully
understood.
8 Processes of Diversification and Key Innovations
Factors influencing diversification rate variation include adaptive radiations,

key innovations, polyploidy, global change, extinction, and co-evolution.
Identifying traits or other factors that might influence the rate of evolution
in grasses is difficult because, although the observed differences in species
richness between certain clades can be correlated with the presence of
particular factors, the hierarchical nature of evolutionary history has to be
taken into account in order to avoid erroneous inferences (Felsenstein, 1985).
Despite this challenge, the relative importance of many factors in grass
diversification and species richness has been explored.
8.1 Spikelet Morphology and Life History Traits

Grasses, with the exception of a few such as Anomochloa, some Olyra and
Pariana, and Streptochaeta (Soderstrom and Calderon, 1971; Sajo et al., 2009;
Kellogg, 2015; Wolowski and Freitas, 2015), are wind pollinated and have
flowers arranged in spikelets with structures homologous to glumes, lemmas,
paleas, and lodicules (Clayton and Renvoize, 1986). There is a huge diversity
of spikelet types among the subfamilies, and it is a structure with tremendous

18
scope for adaptive variation. Indeed, the deepest shift identified in diversi-
fication studies in the grasses (Hodkinson et al., 2007a,b) corresponds to the
group recognised as the spikelet clade. This is a shift above the earliest diverg-
ing lineage of the grasses (Anomochlooideae). Higher diversification rates
are therefore associated with genera that have typical grass spikelets, and
these include Pharoideae, Puelioideae, and the BOP and PACMAD clades
(Figures 1 and 4). Therefore, the appearance of one of the most striking char-
acteristics of grasses today, grass spikelets, occurred early in the evolution of
the grasses. Current understanding of the molecular and evolutionary devel-
opment of the spikelet has been discussed in detail by Rudall et al. (2005) and
Kellogg (2015). Adaptation of spikelet morphology is highly diverse, and it
is these characters that are used most often by taxonomists to describe and
classify grasses (Clayton and Renvoize, 1986). From an evolutionary perspec-
tive, spikelet and inflorescence morphology (Whipple, 2017) has adapted for
wind pollination and seed dispersal. There is clearly much scope to explore
the influence of these key traits on grass species richness and diversification
in space and time. For example, the evolutionary significance of bi-stigmatic
versus tri-stigmatic florets has not been fully explored (Kellogg, 2015).
Several other traits have been investigated by assessing their correlations
with species richness. Among these, sister clade comparison tests have
proven useful where comparisons are made between sister taxa, one pos-
sessing a trait (or factor) and the other not. For example, Salamin and Davies
(2004) mapped traits from Watson and Dallwitz (1994) on to a grass supertree
and identified all sister clades with contrasting traits (e.g. bisexual versus
monoecious breeding system). They then made a comparison between the
number of species in each sister clade against the null hypothesis of equal
speciation rates (following the methods of Goudet, 1999). Their results
indicated that herbaceous habit and an annual life cycle have a significant
correlation with species richness. They postulated that annuals might be
better able to fit new niches and become more species rich and that gener-
ation time is a factor influencing species richness in the grasses like some
other angiosperm groups (Bousquet et al., 1992). Recombination and genetic
change will be facilitated by the short generation time of annuals. Woodiness
is also linked to generation time in grasses with many of the woody bamboos
that have long generation times in comparison to other grasses (Clayton and
Renvoize, 1986; Hodkinson et al., 2010). However, a link between speciation
rates and nucleotide substitution rates has been studied but is inconclusive
in the grasses (Gaut et al., 1997) even though it has been demonstrated in
other taxonomic groups (Barraclough and Savolainen, 2001). Extending
the limited sampling of Gaut et al. (1997) could change this outcome. The
study of Salamin and Davies (2004) did not show any connection between
a number of other characters and speciation rate including bisexual versus
unisexual breeding system, the ability to resist drought, the ability to tolerate
saline environments, or open versus forest habitat preference.

19
TR Hodkinson
8.2 Polyploidy
Grasses are frequently polyploid, and some studies have examined links
between polyploidy/other chromosome transformations, such as loss and
gain of chromosomes, on diversification. Hilu (2007) assessed the patterns
of species richness in grass genera and concluded that polyploidy and
hybridisation are associated with diversification with polyploidy increasing
diversification. However, other studies have failed to show any connection
between polyploidy and diversification in the grasses. For example, Estep
et al. (2014) studied diversification in Andropogoneae using multiple nuclear
genes and showed that independent allopolyploidisation events lead to
the formation of at least a third of the species. However, they found that
although allopolyploidy itself could be the major mode of speciation, diver-
sification after polyploidy is limited. Likewise, Pimentel et al. (2017) could
not find evidence for a connection between polyploidy and diversification in
Pooideae. They studied patterns of chromosome transformation and found
that loss of chromosomes was the most common type of transition. They also
found that the base haploid chromosome number (n = 7) remained stable
throughout the phylogenetic history of the core pooids and that chromosome
transitions including polyploidy were not linked to the major diversification
events. Kellogg (2016) stressed that putative links between polyploidy and
diversification in many plant groups have not been adequately tested, and
the role of polyploidy in grass evolution remains a key research question.
8.3 C3 and C4 Photosynthesis

One of the most frequently and well-studied physiological traits in grasses
is photosynthetic type. C4 photosynthesis is known to have evolved in 19
angiosperm families but first in the grass family at approximately 35 Ma
(Sage, 2004; Christin et al., 2014). The grasses are particularly rich in C4
species (about 4500 species, representing 60% of all C4 plants; Sage, 2017).
Thus, just under half of the grasses are C4 (including maize, sugarcane,
and sorghum) and just over half are C3 (all BOP grasses including wheat,
barley, and rice). C3 grasses use CO2 via the Calvin cycle directly from the
atmosphere, and the first organic compound produced is a three-carbon
molecule called 3-phosphoglyceric acid. C4 plants have the PEP-C enzyme
that fixes CO2 into a four-carbon compound instead of 3-PGA. This gives
the distinction between C3 and C4 types (Sage, 2004). PEP-C fixes CO2 in the
mesophyll, and malate and/or aspartate shuttles CO2 to the Calvin Cycle in
a nearby bundle sheath cell. This pattern of mesophyll and bundle sheath
cells gives C4 plants the characteristic ‘Kranz’ anatomy (Christin et al., 2013).
All grasses known to have C4 metabolism belong to the PACMAD clade, and
the trait allows those grasses to survive and compete in warmer climates
(both hot and humid and hot and dry) with higher light intensities than C3

20
grasses (Christin et al., 2013; Christin and Osborne, 2014; Moreno-Villena

et al., 2017). They are also more tolerant of CO2 limitation than C3 grasses.
Conversely, C3 grasses generally have an advantage in cooler climates, with
less CO2 limitation. C4 grasses therefore dominate grasslands in hot and
dry climates but are replaced by C3 species as the climate cools or becomes
wetter. This can be seen clearly with mountain vegetation in the tropics
that shows a cline from C4 grass species composition and dominance at sea
level to C3 species in cooler and wetter mountain top conditions (Sage, 2004;
Hodkinson et al., 2007a).
Thus, it is likely that the differing photosynthetic types, C3 and the C4
subtype variants (namely phosphoenolpyruvate carboxylase, NAD malic
enzyme, NADP malic enzyme, and phosphoenolpyruvate carboxykinase),
are linked to the evolutionary success and diversification of those groups,
and there is some evidence to support this. Spriggs et al. (2014) showed
via sister group comparisons that C4 lineages are statistically more species
rich than their respective C3 sister clades, indicating that within any given
lineage background, the evolution of C4 photosynthesis tends to increase the
number of descendant species. C4 photosynthesis is a convergent trait in the
grasses (Kellogg, 2001), and many phylogenetic studies have attempted to
estimate the number of times lineages of C4 grasses have evolved (Christin
et al., 2008; Vicentini et al., 2008; Bouchenak-Khelladi et al., 2009; Edwards
and Smith, 2010; Strömberg, 2011). Christin et al. (2008) estimated that C4
photosynthesis might have evolved 17 or 18 times over the course of grass
evolution, but Bouchenak-Khelladi et al. (2009) inferred 12 independent
origins, and the GPWG II (2012) estimated 10 such shifts. Discrepancy among
these studies is due to the differences in taxon sample size and strategy, but
most studies agree that C4 photosynthesis evolved in parallel at least 10–20
times.
8.4 Ecological Expansion of Grasses and Triggers for C4 Photosynthesis

Evolution
C4 photosynthesis first arose in grasses during the early Oligocene (Figure 4;
35 Ma), suggesting that the CO2 decline in the Oligocene (Tipple and Pagani,
2007) was correlated, and possibly a triggering or contributing factor, for
the origin of C4 photosynthesis (Christin et al., 2008; Bouchenak-Khelladi
et al., 2009). However, as explained by Sage (2004, 2017) the low CO2 levels at
the Oligocene transition are not necessarily the sole driver for C4 evolution.
It is noteworthy that there is a long time period between the first appear-
ance of C4 grasses (35 Ma) and the origin of the savanna biome (10–15 Ma).
Based on the plant carbon isotopes, soil carbonates, and herbivore teeth, Cer-
ling et al. (1997) dated the origin of the savanna biome to the late Miocene
(about 8 Ma). However, Jacobs (2004) showed, using pollen and carbon iso-
topes from western and eastern Africa, that the grass-dominated savannas

21
TR Hodkinson
began to expand by the mid-Miocene (16 Ma) and became widespread in the
late Miocene (around 8 Ma). Strömberg (2011), using continental wide com-
parisons of multiple evidence sources, showed open habitat C3 grassland
expansion in the early Miocene/late Oligocene (20–25 Ma) and expansion of
C4 savanna by the late Miocene, consistent with Cerling et al. (1997) at about
8 Ma. In summary, these data suggest that C4 grass lineages may have diver-
sified as early as the Miocene but only became ecologically dominant by the
late Miocene through to the Pleistocene with at least a 10 million year tem-
poral offset between radiation and ecological expansion on each continent
(Strömberg, 2011; Bouchenak-Khelladi et al., 2014b).
Increasing aridity coupled with greater rainfall seasonality is also thought
to be a major factor driving the evolution of C4 photosynthesis in grasses
(Beerling and Osborne, 2006; Edwards and Still, 2008; Osborne, 2008;
Osborne and Freckleton, 2009). Strömberg (2011) suggested that a shift to
open, more arid habitats provided the key selective pressure favouring C4
grasses in many areas because CO2 was still high in the earliest Oligocene
(Urban et al., 2010). It is also likely that fire played a major role in savanna
expansion and the success of its C4 grasses (Osborne, 2008; Bond, 2014;
Simpson et al., 2016). Evidence from palaeoecological charcoal sediment
profiles suggests a higher intensity of fire in the Miocene, which may be the
result of increased combustible fuel loads due to an elevated productivity
of C4 grasses (Keeley and Rundel, 2005). Fire accelerates forest loss and C4
grassland expansion through multiple positive feedback loops that each
promotes drought and more fire. C4 grasses are well adapted to fire because
of their high below-ground biomass allocation, fast primary growth, low
decomposition rates, and above-ground ‘biofuel’ accumulation (Bond, 2014).
9 Coevolution with Mammal Grazers
Throughout the Cenozoic grasses have co-evolved in complex interactions

with other organisms, such as grazing mammals. Grasses have an extraordi-
nary ability to respond to grazing, a feature that is best explained by adap-
tive co-evolutionary processes. Savannas, dominated by C4 grasses, hold the
largest ungulate diversity on Earth (Bouchenak-Khelladi et al., 2009). This
tremendous diversity of grazers co-occurring with browser ungulates makes
the ecological and evolutionary aspects of the relationship between grasses
and megaherbivores central to understanding the evolution and function-
ing of savanna ecosystems (Stebbins, 1981). However, few studies have tried
to specifically test a possible co-evolutionary scenario between grasses and
grazers.
Silica bodies are thought to reduce palatability and digestibility of
grasses (Coughenour, 1985; Massey and Hartley, 2006; Piperno, 2006), and

22
although phytoliths have been recorded from as early as the late Cretaceous,
there is a shortage of direct evidence for mammalian grazing at this time
(Bouchenak-Khelladi and Hodkinson, 2011; Strömberg, 2011). However,
the phytolith evidence of Prasad (2005) shows the presence of both diverse
silica-rich grasses and sudamericid gondwanatherian herbivores in India. It
is plausible that hypsodonty in these herbivores was an adaptation to feeding
on abrasive grasses (high-crowned teeth enable herbivores to deal with more
fibrous vegetation). It seems that the phytolith types characteristic of the
main grass subfamilies were present long before the major diversification
of the grasses and that silica production in grasses comparable with that
observed in extant taxa appeared to have evolved by the late Cretaceous. This
evidence might reject the view that modern levels of phytolith production
were an evolutionary response to grazing during the Cenozoic and suggests
that the high silica levels of grasses are the result of co-evolution with late
Cretaceous herbivores (such as gondwanatherians or insects) or of a process
unrelated to plant/herbivore interaction (Strömberg, 2005, 2006, 2011).
Despite the large temporal mismatch between savanna expansion through
the Miocene and the radiation of ungulates, it is still likely that herbivory is
a major factor promoting the expansion of C4 grasslands at the expense of
trees (Coughenour, 1985; MacFadden and Ceding, 1994; Cerling et al., 1997;
Janis et al., 2002; Bouchenak-Khelladi et al., 2009). The shifts from low- to
high-crowned teeth in ungulates seem to be related to a shift in their diets,
the appearance of more fibrous vegetation (Jernvall and Fortelius, 2002),
and a change from browsing to grazing (Janis et al., 2002). The evolution of
anti-herbivore defence mechanisms and the diversification of these grasses
may have occurred in response to the levels of megaherbivore faunal her-
bivory in an ‘evolutionary arms race’ scenario. One study used silica density
of grass epidermal cells as a proxy for leaf palatability (Bouchenak-Khelladi
et al., 2009). They measured silica density indices for 90 grass species,
reconstructed ancestral values onto a phylogenetic tree, and found that
increases in silica densities were significantly correlated with the appearance
of C4 grass lineages. Using molecular dating techniques, the results showed
that there was an increase in the silica densities of C4 grasses in the late
Miocene (Bouchenak-Khelladi et al., 2009), coincident with an increase in the
abundance of hypsodont fossils (Jernvall and Fortelius, 2002).
10 Coevolution with Microbial Endophytes and Mycorrhizal

Fungi
Grasses have evolved mutualisms with microbes and have a highly diverse
microbiome (Bouffaud et al., 2014). For example, Murphy et al. (2015)
detected 114 culturable taxa in 12 families of fungi in the roots of a wild

23
TR Hodkinson
relative of barley, Hordeum murinum. Endophytes live in a diverse range

of commensal and mutualistic relationships with plants and include the
Clavicipitaceae fungi of the pooid grasses and arbuscular mycorrhizal fungi
within the fungal order Glomerales that infect most grasses (Brundrett, 2002,
2009). Endophytes can improve mineral nutrition, abiotic stress tolerance,
and pathogen/herbivore resistance (Murphy et al., 2015). For instance, the
basidiomycete Piriformospora indica has value as a biocontrol and biofertil-
ising organism in barley (Murphy et al., 2014). Mutualistic plant–microbe
interactions predate the origin of grasses by as much as 350–400 million years
as glomalean spores (Glomerales) have been recorded from 400 to 460 Ma
(Redecker et al., 2000). Little is known about the co-evolution of endophytes
and grasses, but the Epichloë genus (=Neotyphodium) of Clavicipitaceae
endophytes associated within the Pooideae is of particular note (Saikkonen
et al., 2016). Grass-Epichloë symbioses occur in most tribes of Pooideae, but
not all Epichloë species are specialised to individual host species (Schardl
et al., 2005). It is reasonable to hypothesise a history of Pooideae/Epichloë
co-evolution extending back to the origin of this grass subfamily. Some
studies have indicated co-divergence of endophyte and grass species and
also some host species transfers (Jackson, 2004; Schardl et al., 2005, 2008).
The phylogenetic analysis of Schardl et al. (2008) on Epichloë species
and their pooid grass hosts indicated host–endophyte co-divergence, and
since then, an explosion of genome sequences for Epichloë species and
related Clavicipitaceae has allowed more detailed phylogenetic analysis
(Leuchtmann et al., 2014; Schardl et al., 2014; Chen et al., 2015). Strikingly, the
deepest split identified in the Clavicipitaceae phylogenetic tree is to a clade
of two species symbiotic with Achnatherum species belonging to the Stipeae
tribe of grasses that itself splits early from most of the other pooid tribes.
Furthermore, the branching of Epichloë glyceriae is associated with another
early diverging pooid tribe (Meliceae). This contrasts with a clade that
includes Epichloë bromicola and Epichloë elymi, of which the former is found in
members of sister tribes Hordeeae (=Triticeae) and Bromeae, and the latter
is found just in Hordeeae. Similarly, another clade encompasses several
Epichloë species that are found only in Poeae, namely, E. amarillans, E. baconii,
E. festucae, E. mollis, and E. stromatolonga. Co-divergence is not consistently
indicated for all species and clades (particularly not for the broad host range
species Epichloë typhina), but there is evidence for a significant amount of
co-divergence.
11 Conclusion
There are few groups of plants that challenge the importance of grasses
from an ecological and evolutionary perspective. They are so important that

24
large habitats and even biomes are named after them. The world has major
grasslands but does not have ‘orchidlands’, ‘beanlands’, or ‘daisylands’,
despite the speciose nature of all these taxa. Furthermore, grassland domi-
nance is increasing with climate change and human land management. We
are removing trees, the main competitor of grasses, and growing cereals
and forage grasses for food security. Evolutionary and taxonomic studies
provide the basis for the sustainable utilisation of grasses and, despite the
enormous taxonomic scale of the problem, there have been huge advances
in knowledge facilitated by high-throughput DNA sequencing, enhanced
fossil recordings, and improved data availability. However, many achievable
challenges remain, such as assessing the monophyly of genera, improving
species-level phylogenetics, establishing a comprehensive DNA barcoding
system, understanding the ages of grass clades and their biogeography,
comprehending morphological and physiological trait evolution, and inves-
tigating the co-evolution of grasses with other organisms. Plant collections
are essential enablers of this work, as too are online taxonomic, ecological,
and molecular DNA resources.
Acknowledgements
I thank Pascal-Antoine Christin for providing the time-calibrated phyloge-

netic tree of the grass family and Brian R. Murphy for discussion on endo-
phyte co-evolution.
Related Articles
Phylogenetic Analyses and Morphological Innovations in Land Plants

Identifying Key Features in the Origin and Early Diversification of
Angiosperms
Genomics, Adaptation, and the Evolution of Plant Form
Comparative Evolutionary Genomics of Land Plants
References
APG IV (2016). An update of the angiosperm phylogeny group classification for the
orders and families of flowering plants: APG IV. Botanical Journal of the Linnean Soci-
ety 181 (1): 1–20. doi: 10.1111/boj.12385.
Arthan, W., McKain, M.R., Traiperm, P. et al. (2017). Phylogenomics of Andro-
pogoneae (Panicoideae: Poaceae) of mainland Southeast Asia. Systematic Botany 42
(3): 418–431.

25
TR Hodkinson
Attigala, L., Wysocki, W.P., Duvall, M.R., and Clark, L.G. (2016). Phylogenetic esti-
mation and morphological evolution of Arundinarieae (Bambusoideae: Poaceae)
based on plastome phylogenomic analysis. Molecular Phylogenetics and Evolution
101: 111–121. doi: 10.1016/j.ympev.2016.05.008.
Barker, N.P., Linder, H.P., Morton, C.M., and Lyle, M. (2003). The paraphyly of Cor-
taderia (Danthonioideae; Poaceae): evidence from morphology and chloroplast and
nuclear DNA sequence data. Annals of the Missouri Botanical Garden 90 (1): 1–24. doi:
10.2307/3298522.
Barraclough, T.G. and Savolainen, V. (2001). Evolutionary rates and species diver-
sity in flowering plants. Evolution 55 (4): 677–683. doi: 10.1111/j.0014-3820.2001.
tb00803.x.
Beerling, D.J. and Osborne, C.P. (2006). The origin of the savanna biome. Global Change
Biology 12 (11): 2023–2031. doi: 10.1111/j.1365-2486.2006.01239.x.
Bieniek, W., Mizianty, M., and Szklarczyk, M. (2015). Sequence variation at the three
chloroplast loci (matK, rbcL, trnH-psbA) in the Triticeae tribe (Poaceae): comments
on the relationships and utility in DNA barcoding of selected species. Plant System-
atics and Evolution 301 (4): 1275–1286. doi: 10.1007/s00606-014-1138-1.
Bisby, F.A., Shimura, J., Ruggiero, M. et al. (2002). Taxonomy, at the click of a mouse.
Nature 418: 367. doi: 10.1038/418367a.
Bleidorn, C. (2016). Third generation sequencing: technology and its potential impact
on evolutionary biodiversity research. Systematics and Biodiversity 14 (1): 1–8. doi:
10.1080/14772000.2015.1099575.
Bond, W.J. (2014). Fires in the Cenozoic: a late flowering of flammable ecosystems.
Frontiers in Plant Science 5 (749): 1–11. doi: 10.3389/fpls.2014.00749.
Bouchenak-Khelladi, Y. and Hodkinson, T.R. (2011). Savanna biome evolution, climate
change and the ecological expansion of C4 grasses. In: Climate Change, Ecology and
Systematics (Systematics Association Special Volume Series) (ed. T.R. Hodkinson et al.),
156–175. UK: Cambridge University Press.
Bouchenak-Khelladi, Y., Salamin, N., Savolainen, V. et al. (2008). Large multi-gene
phylogenetic trees of the grasses (Poaceae): progress towards complete tribal and
generic level sampling. Molecular Phylogenetics and Evolution 47 (2): 488–505. doi:
10.1016/j.ympev.2008.01.035.
Bouchenak-Khelladi, Y., Verboom, G.A., Hodkinson, T.R. et al. (2009). The origins and
diversification of C4 grasses and savanna-adapted ungulates. Global Change Biology
15 (10): 2397–2417. doi: 10.1111/j.1365-2486.2009.01860.x.
Bouchenak-Khelladi, Y., Verboom, G.A., Savolainen, V., and Hodkinson, T.R. (2010).
Biogeography of the grasses (Poaceae): a phylogenetic approach to reveal evolu-
tionary history in geographical space and geological time. Botanical Journal of the
Linnean Society 162 (4): 543–557. doi: 10.1111/j.1095-8339.2010.01041.x.
Bouchenak-Khelladi, Y., Muasya, A.M., and Linder, H.P. (2014a). A revised evolution-
ary history of Poales: origins and diversification. Botanical Journal of the Linnean
Society 175 (1): 4–16. doi: 10.1111/boj.12160.
Bouchenak-Khelladi, Y., Slingsby, J.A., Verboom, G.A., and Bond, W.J. (2014b). Diver-
sification of C4 grasses (Poaceae) does not coincide with their ecological dominance.
American Journal of Botany 101 (2): 300–307. doi: 10.3732/ajb.1300439.
Bouffaud, M.L., Poirier, M.A., Muller, D., and Moënne-Loccoz, Y. (2014). Root micro-
biome relates to plant host evolution in maize and other Poaceae. Environmental
Microbiology 16 (9): 2804–2814. doi: 10.1111/1462-2920.12442.

26
Bousquet, J., Strauss, S.H., Doerksen, A.H., and Price, R.A. (1992). Extensive variation
in evolutionary rate of rbcL gene sequences among seed plants. Proceedings of the
National Academy of Sciences 89 (16): 7844–7848. doi: 10.1073/pnas.89.16.7844.
Bremer, K. (2002). Gondwanan evolution of the grass alliance of families (Poales). Evo-
lution 56 (7): 1374–1387.
Briggs, B.G., Marchant, A.D., and Perkins, A.J. (2014). Phylogeny of the restiid clade
(Poales) and implications for the classification of Anarthriaceae, Centrolepidaceae
and Australian Restionaceae. Taxon 63: 24–46. doi: 10.12705/631.1.
Brundrett, M.C. (2002). Coevolution of roots and mycorrhizas of land plants. New Phy-
tologist 154 (2): 275–304. doi: 10.1046/j.1469-8137.2002.00397.x.
Brundrett, M.C. (2009). Mycorrhizal associations and other means of nutrition of vas-
cular plants: understanding the global diversity of host plants by resolving con-
flicting information and developing reliable means of diagnosis. Plant and Soil 320
(1–2): 37–77. doi: 10.1007/s11104-008-9877-9.
Burke, S.V., Clark, L.G., Triplett, J.K. et al. (2014). Biogeography and phylogenomics
of new world Bambusoideae (Poaceae), revisited. American Journal of Botany 101 (5):
886–891. doi: 10.3732/ajb.1400063.
Burke, S.V., Lin, C.-S., Wysocki, W.P. et al. (2016a). Phylogenomics and plastome evolu-
tion of tropical forest grasses (Leptaspis, Streptochaeta: Poaceae). Frontiers in Plant
Science 7: 1–12. doi: 10.3389/fpls.2016.01993.
Burke, S.V., Wysocki, W.P., Zuloaga, F.O. et al. (2016b). Evolutionary relationships in
Panicoid grasses based on plastome phylogenomics (Panicoideae; Poaceae). BMC
Plant Biology 16 (1): 140, 1–11. doi: 10.1186/s12870-016-0823-3.
Cahoon, A.B., Sharpe, R.M., Mysayphonh, C. et al. (2010). The complete chloroplast
genome of tall fescue (Lolium arundinaceum; Poaceae) and comparison of whole
plastomes from the family Poaceae. American Journal of Botany 97 (1): 49–58. doi:
10.3732/ajb.0900008.
Campbell, N.R., Harmon, S.A., and Narum, S.R. (2015). Genotyping-in-thousands by
sequencing (GT-seq): a cost effective SNP genotyping method based on custom
amplicon sequencing. Molecular Ecology Resources 15 (4): 855–867.
CBOL Plant Working Group, Hollingsworth, P.M., Forrest, L.L. et al. (2009). A DNA
barcode for land plants. Proceedings of the National Academy of Sciences of the United
States of America 106 (31): 12794–12797. doi: 10.1073/pnas.0905845106.
Cerling, T.E., Harris, J.M., MacFadden, B.J. et al. (1997). Global vegetation change
through the Miocene/Pliocene boundary. Nature 389: 153. doi: 10.1038/38229.
Chan, K.M.A. and Moore, B.R. (2005). SYMMETREE: whole-tree analysis of differen-
tial diversification rates. Bioinformatics 21 (8): 1709–1710. doi: 10.1093/bioinformat-
ics/bti175.
Chase, M.W., Cowan, R.S., Hollingsworth, P.M. et al. (2007). A proposal for a
standardised protocol to barcode all land plants. Taxon 56 (2): 295–299. doi:
10.2307/25065788.
Chen, L., Li, X., Li, C. et al. (2015). Two distinct Epichloë species symbiotic with
Achnatherum inebrians, drunken horse grass. Mycologia 107 (4): 863–873. doi:
10.3852/15-019.
Christin, P.-A. and Osborne, C.P. (2014). The evolutionary ecology of C4 plants. New
Phytologist 204 (4): 765–781. doi: 10.1111/nph.13033.

27
TR Hodkinson
Christin, P.-A., Besnard, G., Samaritani, E. et al. (2008). Oligocene CO2 decline
promoted C4 photosynthesis in grasses. Current Biology 18 (1): 37–43. doi:
10.1016/j.cub.2007.11.058.
Christin, P.-A., Osborne, C.P., Chatelet, D.S. et al. (2013). Anatomical enablers and the
evolution of C4 photosynthesis in grasses. Proceedings of the National Academy of
Sciences 110 (4): 1381–1386.
Christin, P.A., Spriggs, E., Osborne, C.P. et al. (2014). Molecular dating, evolutionary
rates, and the age of the grasses. Systematic Biology 63 (2): 153–165. doi: 10.1093/sys-
bio/syt072.
Clark, L.G., Zhang, W., and Wendel, J.F. (1995). A phylogeny of the grass family
(Poaceae) based on ndhF sequence data. Systematic Botany 20 (4): 436–460. doi:
10.2307/2419803.
Clayton, W.D. and Renvoize, S.A. (1986). Genera Graminum: Grasses of the World. UK:
Royal Botanic Gardens. HMSO Books.
Clayton, W.D., Vorontsova, M.S., Harman, K.T. and Williamson, H. (2006) Grass-
Base – The Online World Grass Flora, http://www.kew.org/data/grasses-db
.html (accessed 10 December 2017).
Cotton, J.L., Wysocki, W.P., Clark, L.G. et al. (2015). Resolving deep relationships of
PACMAD grasses: a phylogenomic approach. BMC Plant Biology 15 (1): 178. doi:
10.1186/s12870-015-0563-9.
Coughenour, M. (1985). Graminoid responses to grazing by large herbivores: adapta-
tions, exaptations, and interacting processes. Annals of the Missouri Botanical Garden
72: 852–863.
Crepet, W.L. and Feldman, G.D. (1991). The earliest remains of grasses in the fossil
record. American Journal of Botany 78: 1010–1014.
Cuenoud, P., Savolainen, V., Chartrou, L.W. et al. (2002). Molecular phylogenetics of
Caryophyllales based on nuclear 18S rDNA and plastid rbcL, atpB, and matK DNA
sequences. American Journal of Botany 89: 132–144.
Diekmann, K., Hodkinson, T.R., Wolfe, K.H. et al. (2009). Complete chloroplast
genome sequence of a major allogamous forage species, perennial ryegrass (Lolium
perenne L.). DNA Research 16 (3): 165–176. doi: 10.1093/dnares/dsp008.
Diekmann, K., Hodkinson, T.R., Wolfe, K.H., and Barth, S. (2013). First insights into the
mitochondrial genome of perennial ryegrass (Lolium perenne). In: Breeding Strategies
for Sustainable Forage and Turf Grass Improvement (ed. S. Barth and D. Milbourne).
Netherlands: Springer.
Doebley, J., Durbin, M., Golenberg, E.M. et al. (1990). Evolutionary analysis of
the large subunit of carboxylase (rbcL) nucleotide sequence among the grasses
(Gramineae). Evolution 44 (4): 1097–1108. doi: 10.1111/j.1558-5646.1990.tb03828.x.
Doust, A.N. and Kellogg, E.A. (2002). Inflorescence diversification in the panicoid
“bristle grass” clade (Paniceae, Poaceae): evidence from molecular phylogenies
and developmental morphology. American Journal of Botany 89 (8): 1203–1222. doi:
10.3732/ajb.89.8.1203.
Doyle, J.J., Davis, J.I., Soreng, R.J. et al. (1992). Chloroplast DNA inversions and the
origin of the grass family (Poaceae). Proceedings of the National Academy of Sciences
of the United States of America 89: 7722–7726. doi: 10.1073/pnas.89.16.7722.
Drumwright, A.M., Allen, B.W., Huff, K.A. et al. (2011). Survey and DNA barcoding
of Poaceae in flat rock cedar glades and barrens state natural area, Murfreesboro,
Tennessee. Castanea 76 (3): 300–310. doi: 10.2179/11-005.1.

28
Duvall, M.R., Noll, J.D., and Minn, A.H. (2001). Phylogenetics of Paniceae (Poaceae).
American Journal of Botany 88 (11): 1988–1992. http://www.ncbi.nlm.nih.gov/
pubmed/21669632.
Duvall, M.R., Fisher, A.E., Columbus, J.T. et al. (2016). Phylogenomics and plastome
evolution of the Chloridoid grasses (Chloridoideae: Poaceae). International Journal
of Plant Sciences 177 (3): 235–246. doi: 10.1086/684526.
Edwards, E.J. and Smith, S.A. (2010). Phylogenetic analyses reveal the shady history
of C4 grasses. Proceedings of the National Academy of Sciences 107 (6): 2532–2537. doi:
10.1073/pnas.0909672107.
Edwards, E.J. and Still, C.J. (2008). Climate, phylogeny and the ecological distribution
of C4 grasses. Ecology Letters 11 (3): 266–276. doi: 10.1111/j.1461-0248.2007.01144.x.
Estep, M.C., McKain, M.R., Diaz, D.V. et al. (2014). Allopolyploidy, diversification, and
the Miocene grassland expansion. Proceedings of the National Academy of Sciences 111
(42): 15149–15154.
Felsenstein, J. (1985). Phylogenies and the comparative method. The American Natu-
ralist 125: 1–15.
Fisher, A.E., Hasenstab, K.M., Bell, H.L. et al. (2016). Evolutionary history of chlori-
doid grasses estimated from 122 nuclear loci. Molecular Phylogenetics and Evolution
105: 1–14. doi: 10.1016/j.ympev.2016.08.011.
Frodin, D.G. (2004). History and concepts of big plant genera. Taxon 53 (3): 753–776.
doi: 10.2307/4135449.
Gamuyao, R., Nagai, K., Ashikari, M., and Reuscher, S. (2017). A new outlook on
sporadic flowering of bamboo. Plant Signaling & Behavior 12 (7): e1343780. doi:
10.1080/15592324.2017.1343780.
Gaut, B.S., Clark, L.G., Wendel, J.F., and Muse, S.V. (1997). Comparisons of the molec-
ular evolutionary process at rbcL and ndhF in the grass family (Poaceae). Molecular
Biology and Evolution 14 (7): 769–777. doi: 10.1093/oxfordjournals.molbev.a025817.
Gibson, D.J. (2008). Grasses and Grassland Ecology. UK: Oxford University Press.
Givnish, T.J., Ames, M., McNeal, J.R. et al. (2010). Assembling the tree of the mono-
cotyledons: plastome sequence phylogeny and evolution of Poales. Annals of the
Missouri Botanical Garden 97 (4): 584–616. doi: 10.3417/2010023.
Goudet, J. (1999). An improved procedure for testing the effects of key innovations on
rate of speciation. American Naturalist 153: 549–555.
GPWG (2001). Phylogeny and subfamilial classification of the grasses (Poaceae).
Annals of the Missouri Botanical Garden 88: 373–457.
GPWG II (2012). New grass phylogeny resolves deep evolutionary relationships and
discovers C4 origins. New Phytologist 193: 304–312. doi: 10.1111/j.1469-8137.2011.
03972.x.
Hall, M. and Miller, G. (2011). Documenting plant species in a changing climate: a case
study from Arabia. In: Climate Change, Ecology and Systematics (Systematics Asso-
ciation Special Volume Series) (ed. T.R. Hodkinson et al.), 365–379. UK: Cambridge
University Press.
Hamby, R.K. and Zimmer, E.A. (1988). Ribosomal RNA sequences for inferring phy-
logeny within the grass family (Poaceae). Plant Systematics and Evolution 160 (1):
29–37. doi: 10.1007/BF00936707.
Hamilton, M. (1999). Four primer pairs for the amplification of chloroplast intergenic
regions with intraspecific variation. Molecular Ecology 8: 521–523.

29
TR Hodkinson
Hebert, P.D.N., Cywinska, A., Ball, S.L., and deWaard, J.R. (2003). Biological identifi-
cations through DNA barcodes. Proceedings of the Royal Society B: Biological Sciences
270 (1512): 313–321. doi: 10.1098/rspb.2002.2218.
Hilu, K.W. (2007). Skewed distribution of species number in grass genera: is it a taxo-
nomic artifact? In: Reconstructing the Tree of Life: Taxonomy and Systematics of Species
Rich Taxa (ed. T.R. Hodkinson and J.A.N. Parnell), 165–176. FL: CRC Press.
Hilu, K.W., Alice, L.A., and Liang, H. (1999). Phylogeny of Poaceae inferred from
matK sequences. Annals of the Missouri Botanical Garden 86 (4): 835–851. doi:
10.2307/2666171.
Hodkinson, T.R. and Parnell, J.A.N. (2007a). Introduction to the systematics of species
rich groups. In: Reconstructing the Tree of Life: Taxonomy and Systematics of Species Rich
Taxa (ed. T.R. Hodkinson and J.A.N. Parnell), 3–20. FL: CRC Press.
Hodkinson, T.R. and Parnell, J.A.N. (2007b). Reconstructing the Tree of Life: Taxonomy
and Systematics of Species Rich Taxa, 351. Boca Raton, FL: CRC Press.
Hodkinson, T.R., Renvoize, S.A., Chonghaile, G.N. et al. (2000). A comparison of ITS
nuclear rDNA sequence data and AFLP markers for phylogenetic studies in Phyl-
lostachys (Bambusoideae, Poaceae). Journal of Plant Research 113 (3): 259–269.
Hodkinson, T., Chase, M., Lledó, D. et al. (2002a). Phylogenetics of Miscanthus, Sac-
charum and related genera (Saccharinae, Andropogoneae, Poaceae) based on DNA
sequences from ITS nuclear ribosomal DNA. Journal of Plant Research 115: 381–392.
Hodkinson, T.R., Chase, M.W., Takahashi, C. et al. (2002b). The use of DNA sequencing
(ITS and trnL-F), AFLP, and fluorescent in situ hybridization to study allopolyploid
Miscanthus (Poaceae). American Journal of Botany 89 (2): 279–286.
Hodkinson, T.R., Salamin, N., Chase, M.W. et al. (2007a). Large trees, supertrees, and
diversification of the grass family. Aliso 23: 248–258.
Hodkinson, T.R., Savolainen, V., Jacobs, S.W.L. et al. (2007b). Supersizing: progress
in documenting and understanding grass species richness. In: Reconstructing the
Tree of Life: Taxonomy and Systematics of Species Rich Taxa (ed. T.R. Hodkinson and
J.A.N. Parnell), 276–290. Boca Raton, FL: CRC Press.
Hodkinson, T.R., Waldren, S., Parnell, J.A. et al. (2007c). DNA banking for plant breed-
ing, biotechnology and biodiversity evaluation. Journal of Plant Research 120 (1):
17–29. doi: 10.1007/s10265-006-0059-7.
Hodkinson, T.R., Ní Chonghaile, G., Sungkaew, S. et al. (2010). Phylogenetic analyses
of plastid and nuclear DNA sequences indicate a rapid late Miocene radiation of
the temperate bamboo tribe Arundinarieae (Poaceae, Bambusoideae). Plant Ecology
and Diversity 3 (2): 109–120. doi: 10.1080/17550874.2010.521524.
Hodkinson, T., Klaas, M., Jones, M. et al. (2015). Miscanthus: a case study for the uti-
lization of natural genetic variation. Plant Genetic Resources 13 (3): 219–237. doi:
10.1017/S147926211400094X.
Hollingsworth, M.L., Andra Clark, A., Forrest, L.L. et al. (2009). Selecting barcoding
loci for plants: evaluation of seven candidate loci with species-level sampling in
three divergent groups of land plants. Molecular Ecology Resources 9 (2): 439–457.
doi: 10.1111/j.1755-0998.2008.02439.x.
Ingram, A. and Doyle, J. (2004). Is Eragrostis (Poaceae) monophyletic? Insights
from nuclear and plastid sequence data. Systematic Botany 29 (3): 545–552. doi:
10.1600/0363644041744392.
Jackson, A.P. (2004). A reconciliation analysis of host switching in plant-fungal sym-
bioses. Evolution 58: 1909–1923.

30
Jacobs, B.F. (2004). Palaeobotanical studies from tropical Africa: relevance to the evo-
lution of forest, woodland and savannah biomes. Philosophical Transactions of the
Royal Society of London. Series B, Biological Sciences 359: 1573–1583.
Jacobs, B.F., Kingston, J.D., and Jacobs, L.L. (1999). The origin of grass-dominated
ecosystems. Annals of the Missouri Botanical Garden 86 (2): 590–643. doi:
10.2307/2666186.
Janis, C.M., Damuth, J., and Theodor, J.M. (2002). The origins and evolution
of the North American grassland biome: the story from the hoofed mam-
mals. Palaeogeography, Palaeoclimatology, Palaeoecology 177 (1–2): 183–198. doi:
10.1016/S0031-0182(01)00359-5.
Jernvall, J. and Fortelius, M. (2002). Common mammals drive the evolution-
ary increase of hypsodonty in the Neogene. Nature 417 (6888): 538–540. doi:
10.1038/417538a.
Johnson, L.A. and Soltis, D.E. (1994). matK DNA sequences and phylogenetic
reconstruction in Saxifragaceae s. Str. Systematic Botany 19 (1): 143–156. doi:
10.2307/2419718.
Jones, M.B., Finnan, J., and Hodkinson, T.R. (2015). Morphological and physiological
traits for higher biomass production in perennial rhizomatous grasses grown on
marginal land. GCB Bioenergy 7 (2): 375–385. doi: 10.1111/gcbb.12203.
Keeley, J.E. and Rundel, P.W. (2005). Fire and the Miocene expansion of C4 grasslands.
Ecology Letters 8 (7): 683–690. doi: 10.1111/j.1461-0248.2005.00767.x.
Kelchner, S.A. and Bamboo Phylogeny Group (2013). Higher level phylogenetic rela-
tionships within the bamboos (Poaceae: Bambusoideae) based on five plastid mark-
ers. Molecular Phylogenetics and Evolution 67 (2): 404–413.
Kellogg, E.A. (2001). Evolutionary history of the grasses. Plant Physiology 125 (3):
1198–1205.
Kellogg, E.A. (2015). Flowering plants. Monocots: Poaceae. In: The Families and Genera
of Vascular Plants, vol. 13 (ed. K. Kubitski), 1–416. Cham: Springer International.
Kellogg, E.A. (2016). Has the connection between polyploidy and diversifica-
tion actually been tested? Current Opinion in Plant Biology 30: 25–32. doi:
10.1016/j.pbi.2016.01.002.
Kress, W.J. and Erickson, D.L. (2007). A two-locus global DNA barcode for land plants:
the coding rbcL gene complements the non-coding trnH-psbA spacer region. PLoS
One 2 (6): doi: 10.1371/journal.pone.0000508.
Leuchtmann, A., Bacon, C.W., Schardl, C.L. et al. (2014). Nomenclatural realignment
of Neotyphodium species with genus Epichloë. Mycologia 106 (2): 202–215. doi:
10.3852/13-251.
Linder, H.P. (1987). The evolutionary history of the Poales/Restionales: a hypothesis.
Kew Bulletin 42: 297–318.
Linder, H.P., Baeza, M., Barker, N.P. et al. (2010). A generic classification of the Dan-
thonioideae (Poaceae). Annals of the Missouri Botanical Garden 97 (3): 306–364. doi:
10.3417/2009006.
Lledó, M.D., Crespo, M.B., Cameron, K.M. et al. (1998). Systematics of Plumbagi-
naceae based upon cladistic analysis of rbcL sequence data. Systematic Botany 23
(1): 21–29. doi: 10.2307/2419571.
López-Alvarez, D., López-Herranz, M.L., Betekhtin, A., and Catalán, P. (2012). A
DNA barcoding method to discriminate between the model plant Brachypodium

31
TR Hodkinson
distachyon and its close relatives B. stacei and B. hybridum (Poaceae). PLoS One 7
(12): doi: 10.1371/journal.pone.0051058.
MacFadden, B.J. and Ceding, T.E. (1994). Fossil horses, carbon isotopes and
global change. Trends in Ecology & Evolution 9 (12): 481–486. doi: 10.1016/0169-
5347(94)90313-1.
Mason-Gamer, R.J., Weil, C., and Kellogg, E.A. (1998). Granule-bound starch syn-
thase: structure, function, and phylogenetic utility. Molecular Biology and Evolution
15: 1658–1673.
Massey, F.P. and Hartley, S.E. (2006). Experimental demonstration of the antiherbivore
effects of silica in grasses: impacts on foliage digestibility and vole growth rates.
Proceedings of the Royal Society B: Biological Sciences 273 (1599): 2299–2304.
Molvray, M.P., Kores, P.J., and Chase, M.W. (2000). Polyphyly of mycoheterotrophic
orchids and functional influences on floral and molecular characters. In: Monocots:
Systematics and Evolution (ed. K.L. Wilson and D.A. Morrison), 441–448. Melbourne,
Australia: CSIRO.
Moreno-Villena, J.J., Dunning, L.T., Osborne, C.P., and Christin, P.A. (2017). Highly
expressed genes are preferentially co-opted for C4 photosynthesis. Molecular Biology
and Evolution doi: 10.1093/molbev/msx269/4457558/.
Morley, R.J. (2000). Origin and Evolution of Tropical Rainforest. Chichester: John Wiley
& Sons, Ltd.
Morris, L.M. and Duvall, M.R. (2010). The chloroplast genome of Anomochloa maran-
toidea (Anomochlooideae; Poaceae) comprises a mixture of grass-like and unique
features. American Journal of Botany 97 (4): 620–627. doi: 10.3732/ajb.0900226.
Morrone, O., Aagesen, L., Scataglini, M.A. et al. (2012). Phylogeny of the Paniceae
(Poaceae: Panicoideae): integrating plastid DNA sequences and morphology into a
new classification. Cladistics 28: 333–356. doi: 10.1111/j.1096-0031.2011.00384.x.
Murphy, B.R., Doohan, F.M., and Hodkinson, T.R. (2014). Yield increase induced by
the fungal root endophyte Piriformospora indica in barley grown at low temperature
is nutrient limited. Symbiosis 62 (1): 29–39.
Murphy, B.R., Martin Nieto, L., Doohan, F.M., and Hodkinson, T.R. (2015). Profundae
diversitas: the uncharted genetic diversity in a newly studied group of fungal root
endophytes. Mycology 6: 139–150. doi: 10.1080/21501203.2015.1070213.
Olmstead, R. and Palmer, J. (1994). Chloroplast DNA systematics: a review of methods
and data analysis. American Journal of Botany 81 (9): 1205–1224.
Osborne, C.P. (2008). Atmosphere, ecology and evolution: what drove the
Miocene expansion of C4 grasslands? Journal of Ecology 96 (1): 35–45. doi:
10.1111/j.1365-2745.2007.01323.x.
Osborne, C.P. and Freckleton, R.P. (2009). Ecological selection pressures for C4 pho-
tosynthesis in the grasses. Proceedings of the Royal Society B: Biological Sciences 276:
1753–1760.
Oxelman, B., Lidén, M., and Berglund, D. (1997). Chloroplast rps16 intron phylogeny
of the tribe Sileneae (Caryophyllaceae). Plant Systematics and Evolution 206 (1):
393–410. doi: 10.1007/BF00987959.
Perdereau, A., Klaas, M., Barth, S., and Hodkinson, T.R. (2017). Plastid genome
sequencing reveals biogeographical structure and extensive population genetic
variation in wild populations of Phalaris arundinacea L. in north-western Europe.
GCB Bioenergy 9 (1): 46–56. doi: 10.1111/gcbb.12362.

32
Peterson, P.M., Romaschenko, K., and Soreng, R.J. (2014). A laboratory guide for gen-
erating DNA barcodes in grasses: a case study of Leptochloa s.l. (Poaceae: Chlori-
doideae). Webbia 69 (1): 1–12. doi: 10.1080/00837792.2014.927555.
Pimentel, M., Escudero, M., Sahuquillo, E. et al. (2017). Are diversification rates
and chromosome evolution in the temperate grasses (Pooideae) associated with
major environmental changes in the Oligocene-Miocene? PeerJ 5: e3815. doi:
10.7717/peerj.3815.
Piperno, D.R. (2006). Phytoliths. A Comprehensive Guide for Archaeologists and Paleoecol-
ogists. Lanham, New York, Toronto, Oxford: AltaMira Press.
Poinar, G.O. and Columbus, J.T. (1992). Adhesive grass spikelet with mammalian hair
in Dominican amber: first fossil evidence of epizoochory. Experientia 48 (9): 906–908.
doi: 10.1007/BF02118433.
Prasad, V. (2005). Dinosaur coprolites and the early evolution of grasses and grazers.
Science 310 (5751): 1177–1180. doi: 10.1126/science.1118806.
Redecker, D., Morton, J.B., and Bruns, T.D. (2000). Ancestral lineages of arbuscular
mycorrhizal fungi (Glomales). Molecular Phylogenetics and Evolution 14 (2): 276–284.
doi: 10.1006/mpev.1999.0713.
Rudall, P.J., Stuppy, W., Cunniff, J. et al. (2005). Evolution of reproductive structures
in grasses (Poaceae) inferred by sister-group comparison with their putative closest
living relatives, Ecdeiocoleaceae. American Journal of Botany 92 (9): 1432–1443. doi:
10.3732/ajb.92.9.1432.
Saarela, J.M., Wysocki, W.P., Barrett, C.F. et al. (2015). Plastid phylogenomics of the
cool-season grass subfamily: clarification of relationships among early-diverging
tribes. AoB PLANTS 7 (1): doi: 10.1093/aobpla/plv046.
Sage, R.F. (2004). The evolution of C4 photosynthesis. New Phytologist 161 (2): 341–370.
doi: 10.1111/j.1469-8137.2004.00974.x.
Sage, R.F. (2017). A portrait of the C4 photosynthetic family on the 50th anniversary
of its discovery: species number, evolutionary lineages, and hall of fame. Journal of
Experimental Botany 68 (2): e11–e28. doi: 10.1093/jxb/erx005.
Saikkonen, K., Young, C.A., Helander, M., and Schardl, C.L. (2016). Endophytic
Epichloë species and their grass hosts: from evolution to applications. Plant
Molecular Biology 90 (6): 665–675. doi: 10.1007/s11103-015-0399-6.
Sajo, M.D.G., Furness, C.A., and Rudall, P.J. (2009). Microsporogenesis is simultane-
ous in the early-divergent grass Streptochaeta, but successive in the closest grass
relative, Ecdeiocolea. Grana 48 (1): 27–37. doi: 10.1080/00173130902746466.
Salamin, N. and Davies, J. (2004). Using supertrees to investigate species richness in
grasses and flowering plants. In: Phylogenetic Supertrees. Computational Biology, vol.
4 (ed. O.R.P. Bininda-Emonds). Dordrecht: Springer.
Salamin, N., Hodkinson, T.R., and Savolainen, V. (2005). Towards building the tree of
life: a simulation study for all angiosperm genera. Systematic Biology 54 (2): 183–196.
doi: 10.1080/10635150590923254.
Samuel, R., Pinsker, W., and Kiehn, M. (1997). Phytogeny of some species of Cyrtandra
(Gesneriaceae) inferred from the atpB/rbcL cpDNA intergene region. Botanica Acta
110 (6): 503–510. doi: 10.1111/j.1438-8677.1997.tb00669.x.
Schardl, C.L., Leuchtmann, A., Dighton, J. et al. (2005). The Epichloë Endophytes of
Grasses and the Symbiotic Continuum, the Fungal Community: its Organization and Role
in the Ecosystem, 475–503. Boca Raton, FL: CRC Press.

33
TR Hodkinson
Schardl, C.L., Craven, K.D., Speakman, S. et al. (2008). A novel test for host-symbiont
codivergence indicates ancient origin of fungal endophytes in grasses. Systematic
Biology 57 (3): 483–498. doi: 10.1080/10635150802172184.
Schardl, C.L., Young, C.A., Moore, N. et al. (2014). Genomes of plant-associated
Clavicipitaceae. Advances in Botanical Research 70: 291–327. doi: 10.1016/B978-0-12-
397940-7.00010-0.
Schneider, J., Winterfeld, G., Hoffmann, M.H., and Röser, M. (2011). Duthieeae,
a new tribe of grasses (Poaceae) identified among the early diverging lineages
of subfamily Pooideae: molecular phylogenetics, morphological delineation,
cytogenetics and biogeography. Systematics and Biodiversity 9 (1): 27–44. doi:
10.1080/14772000.2010.544339.
Seberg, O. and Peterson, G. (2007). Assembling the tree of life: magnitude, shortcuts
and pitfalls. In: Reconstructing the Tree of Life: Taxonomy and Systematics of Species Rich
Taxa (ed. T.R. Hodkinson and J.A.N. Parnell), 33–46. Boca Raton, FL: CRC Press.
Shokralla, S., Gibson, J.F., Nikbakht, H. et al. (2014). Next-generation DNA barcod-
ing: using next-generation sequencing to enhance and accelerate DNA barcode
capture from single specimens. Molecular Ecology Resources 14 (5): 892–901. doi:
10.1111/1755-0998.12236.
Simon, B.K. (2014) GrassWorld, http://grassworld.myspecies.info/ (accessed 10
December 2017).
Simon, B.K. and Alfonso, Y. (2011) AusGrass2, http://ausgrass2.myspecies.info/
(accessed 10 December 2017).
Simpson, D.A., Muasya, A.M., Alves, M.V. et al. (2007). Phylogeny of Cyperaceae
based on DNA sequence data—a new rbcL analysis. Aliso: A Journal of Systematic
and Evolutionary Botany 23 (1): 72–83.
Simpson, K.J., Ripley, B.S., Christin, P.A. et al. (2016). Determinants of flamma-
bility in savanna grass species. Journal of Ecology 104 (1): 138–148. doi:
10.1111/1365-2745.12503.
Soderstrom, T.R. and Calderon, C.E. (1971). Insect pollination in tropical rain forest
grasses. Biotropica 3: 1–16. doi: 10.2307/2989701.
Soltis, D.E., Soltis, P.S., Schemske, D.W. et al. (2007). Autopolyploidy in angiosperms:
have we grossly underestimated the number of species? Taxon 56 (1): 13–30. doi:
10.2307/25065732.
Soreng, R.J., Peterson, P.M., Romaschenko, K. et al. (2015). A worldwide phylogenetic
classification of the Poaceae (Gramineae). Journal of Systematics and Evolution 53 (2):
117–137. doi: 10.1111/jse.12150.
Soreng, R.J., Peterson, P.M., Romaschenko, K. et al. (2017). A worldwide phyloge-
netic classification of the Poaceae (Gramineae) II: an update and a comparison of
two 2015 classifications. Journal of Systematics and Evolution 55 (4): 259–290. doi:
10.1111/jse.12262.
Spangler, R.E. (2003). Taxonomy of Sarga, Sorghum, Vacoparis (Poaceae: Andro-
pogoneae). Australian Systematic Botany 16 (3): 279–299. doi: 10.1071/SB01006.
Spriggs, E.L., Christin, P.A., and Edwards, E.J. (2014). C4 photosynthesis promoted
species diversification during the miocene grassland expansion. PLoS One 9 (5):
doi: 10.1371/journal.pone.0097722.
Stapleton, C.M.A., Ní Chonghaile, G., and Hodkinson, T.R. (2009). Molecular phy-
logeny of Asian woody bamboos: review for the Flora of China. Bamboo science
and culture. The Journal of the American Bamboo Society 22 (1): 5–25.

34
Stebbins, G.L. (1981). Coevolution of grasses and herbivores. Annals of the Missouri
Botanical Garden 68 (1): 75–86. doi: 10.2307/2398811.
Strömberg, C.A.E. (2005). Decoupled taxonomic radiation and ecological expansion
of open-habitat grasses in the Cenozoic of North America. Proceedings of the
National Academy of Sciences of the United States of America 102 (34): 11980–11984.
doi: 10.1073/pnas.0505700102.
Strömberg, C.A.E. (2006). Evolution of hypsodonty in equids: testing a hypothesis of
adaptation. Paleobiology 32 (2): 236–258.
Strömberg, C.A.E. (2011). Evolution of grasses and grassland ecosystems. Annual
Review of Earth and Planetary Sciences 39 (1): 517–544. doi: 10.1146/annurev-earth-
040809-152402.
Stuessy, T. (1993). The role of creative monography in the biodiversity crisis. Taxon 42:
313–321. doi: 10.2307/1223140.
Su, X., Liu, Y.P., Chen, Z., and Chen, K.L. (2016). Evaluation of candidate barcod-
ing markers in Orinus (Poaceae). Genetics and Molecular Research 15 (2): 1–14. doi:
10.4238/gmr.15027714.
Sun, Y., Skinner, D.Z., Liang, G.H., and Hulbert, S.H. (1994). Phylogenetic analysis of
Sorghum and related taxa using internal transcribed spacers of nuclear ribosomal
DNA. Theoretical and Applied Genetics 89 (1): 26–32. doi: 10.1007/BF00226978.
Sungkaew, S., Stapleton, C.M.A., Salamin, N., and Hodkinson, T.R. (2009a).
Non-monophyly of the woody bamboos (Bambuseae; Poaceae): a multi-gene
region phylogenetic analysis of Bambusoideae s.s. Journal of Plant Research 122 (1):
95–108. doi: 10.1007/s10265-008-0192-6.
Sungkaew, S., Teerawatananon, A., Parnell, J.A.N. et al. (2009b). Phuphanochloa, a
new bamboo genus (Poaceae: Bambusoideae) from Thailand. Kew Bulletin 63 (4):
669–673. doi: 10.1007/s12225-008-9071-5.
Taberlet, P., Gielly, L., Pautou, G., and Bouvet, J. (1991). Universal primers for ampli-
fication of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17
(5): 1105–1109. doi: 10.1007/BF00037152.
Teerawatananon, A., Jacobs, S., and Hodkinson, T. (2011). Phylogenetics of Pani-
coideae (Poaceae) based on chloroplast and nuclear DNA sequences. Telopea 13:
115–142.
Teerawatananon, A., Boontia, V., Chantarasuwan, B. et al. (2014). A taxonomic revision
of the genus Dimeria (Poaceae: Panicoideae) in Thailand. Phytotaxa 186 (3): 137–147.
The Plant List (2013) Version 1.1. Published on the Internet, http://www.theplantlist
.org/ (accessed 10 December 2017).
Tipple, B.J. and Pagani, M. (2007). The early origins of terrestrial C4 photo-
synthesis. Annual Review of Earth and Planetary Sciences 35 (1): 435–461. doi:
10.1146/annurev.earth.35.031306.140150.
Urban, M., Nelson, D., Jiménez-Moreno, G. et al. (2010). Isotopic evidence of C4
grasses in southwestern Europe during the early Oligocene-middle Miocene.
Geology 38 (12): 1091–1094.
Vicentini, A., Barber, J.C., Aliscioni, S.S. et al. (2008). The age of the grasses and clus-
ters of origins of C4 photosynthesis. Global Change Biology 14 (12): 2963–2977. doi:
10.1111/j.1365-2486.2008.01688.x.
Vorontsova, M.S. and Simon, B.K. (2012). Updating classifications to reflect mono-
phyly: 10 to 20 percent of species names change in Poaceae. Taxon 61 (4): 735–746.

35
TR Hodkinson
Vorontsova, M.S., Clayton, D., and Simon, B.K. (2015). Grassroots e-floras in the
Poaceae: growing GrassBase and GrassWorld. PhytoKeys 48: 73–84. https://doi
.org/10.3897/phytokeys.48.7159.
Wang, A., Gopurenko, D., Wu, H., and Lepschi, B. (2017). Evaluation of six candidate
DNA barcode loci for identification of five important invasive grasses in eastern
Australia. PLoS One 12 (4): 1–14. doi: 10.1371/journal.pone.0175338.
Watson, L. and Dallwitz, M.J. (1994). The Grass Genera of the World, 2e. Wallingford:
CAB International.
Watson, L., Macfarlane, T.D. and Dallwitz, M.J. (1992) The grass genera of the world:
descriptions, illustrations, identification, and information retrieval; including syn-
onyms, morphology, anatomy, physiology, phytochemistry, cytology, classification,
pathogens, world and local distribution, and references. Online Version.
Whipple, C.J. (2017). Grass inflorescence architecture and evolution: the origin of
novel signaling centers. New Phytologist 216: 367–372. doi: 10.1111/nph.14538.
Wolowski, M. and Freitas, L. (2015). An overview on pollination of the Neotropical
Poales. Rodriguesia 66 (2): 329–336. doi: 10.1590/2175-7860201566204.
Wolowski, M., Freitas, L., Rudall, P.J. et al. (2016). A revised evolutionary history of
Poales: origins and diversification. Annals of the Missouri Botanical Garden 105 (1):
217–238. doi: 10.3732/ajb.92.9.1432.
Wysocki, W.P., Clark, L.G., Attigala, L. et al. (2015). Evolution of the bamboos (Bambu-
soideae; Poaceae): a full plastome phylogenomic analysis. BMC Evolutionary Biology
15 (1): 50. doi: 10.1186/s12862-015-0321-5.
Wysocki, W.P., Burke, S.V., Swingley, W.D., and Duvall, M.R. (2016). The first complete
plastid genome from Joinvilleaceae (J. ascendens; Poales) shows unique and unpre-
dicted rearrangements. PLoS One 11 (9): 1–10. doi: 10.1371/journal.pone.0163218.
Zhang, Y.J., Ma, P.F., and Li, D.Z. (2011). High-throughput sequencing of six bam-
boo chloroplast genomes: phylogenetic implications for temperate woody bamboos
(Poaceae: Bambusoideae). PLoS One doi: 10.1371/journal.pone.0020596.
Zimmer, E.A. and Wen, J. (2012). Using nuclear gene data for plant phylogenetics:
progress and prospects. Molecular Phylogenetics and Evolution 65 (2): 774–785. doi:
10.1016/j.ympev.2012.07.015.

36
Supplementary Figures
Genera
100
120
20
40
60
80
Anomochloeae
0
EDL
Streptochaeteae
Phareae
Atractocarpeae
Guaduelleae
Streptogyneae
Ehrharteae
Oryzeae
Arundinarieae
Olyreae
Bambuseae
Brachyelytreae
Nardeae
Lygeeae
BOP
Duthieeae
Phaenospermateae
Brylkinieae
Meliceae
Ampelodesmeae
Stipeae
Diarrheneae
Brachypodieae
Poeae
Littledaleeae
Bromeae
Triticeae
Aristideae
Thysanolaeneae
Cyperochloeae
Centotheceae
Chasmanthieae
Zeugiteae
Steyermarkochloeae
Tristachyideae
Gynerieae
Lecomtelleae
Paniceae
PACMAD
Paspaleae
Arundinellieae
Andropogoneae
Arundineae
Molinieae
Micraireae
Eriachneae
Isachneae
Danthonieae
Centropodieae
Triraphideae
Eragrostideae
Zoysieae
Cynodonteae

37
TR Hodkinson
atpF Exon2
atpF Exon1
atpA
atpH
atpI
rps2
2
rpoC
trn L U trn
trn
trn
L U AA F
SG
C1
AA E GA
rpo
GA
trnR UCU
rps14
Ex xon A
psaB
oB
p sa A
on 2
rp
ycf3 Exon
1
ycf3 Exon
ycf3
trn
rps T G
Exo 2
UC
trn
M
bM G UC
4 UG
CA
n3
U ps nD G UC U
tr rnY E U G
nd dhKC
1 t rn G
n dh
hJ
t rnT
n
pe CA
tr
t nV t
tN
G
at rnV U C
C
rb at pE UA AC GC
trn
cL pB G
C Ex trnsbZ
Ex on 1 p
on 2 43.33kb on 2
ps 1 Ex n C
ycf4al 21.67kb C Exo AU ps
b
UC CC fM C GA D
cem
A
G U n U
trn nG tr rnS psb
tr t
petA
I
psbbK
U ps
psb GC
psb J trnS
psb L UUG
petL psbEF trnQ xon1
E
petG rps16 xon2
E
psaJ trnW-CCA rps16 Exon1
U
rpl33 trnP-UG
G trnk UU
rps18 matK
rpl20
rps12 5end
65.00kb
Lolium perenne L. trnK UUU Exon2
psbA
clpP 0.00kb rps19
trnH GUG
rpl2 Exon2
psbB 135282 bp rpl2 Exon1
psbT psbN rpl23
trnI CAU
psbH
Ex on1
petB
-A
E xon2
petB Exon1 trnL C
tD AA
IR
pe A
Exon
2 rpo 11 ndhB
petD rpsl36 Exon
2
rp fA
inps8 n2 ndh
r l14 Exo n1 IR rp
BE
xon
rp l16 Exo trn
rp s7
rp 6
p l1
r ps3 2
-B trn
tr trn I G
VG
A rpss12 3
1
r l2 9 on2 1 86.67kb trn nA I GA AU rrn C 12 end

3en Ex
rpps1 Ex on A UG U Ex 16 d E on3
r l2 Ex UG C E on xon
rp l2 C Ex xon 1 2
rp l23 CAU 108.33kb
Ex on 2
on 1
rp nI
UG 2
2
tr
xo n3
rrn
Ex A
on
G
n2
hB A
d E xo
23
2 3 en 1
H
nd L C
trn
n
en d E
trn
rrn rrn G
rp s12 Exo
trn
4. 5
nd
AC
5
rp s7 B
ndh
s1 3
hA
rp h
rps H
nd
nd n1
A E ndhG
Ex
15
h
ATP-synthase
o
xon I
trnN GUU
ndhhE
trn
nd
Cytochrome-related
psaC
2
ndhD
N
GU
NADH dehydrogenase
ndhF
Other
AC
16
VG
Photosystem I protein
trnA GAU xon1
trnA UGC E xon2
rrn
UGC xon1
2
Exon
trn
Photosystem II protein
rrn23
ccsA AG
trnL U
rrn4.5
rrn5
trnI GAU E
trnR ACG
rpl32
E
rps15
ndhH
Plastid-encoded RNA polymerase

Ribosomal protein subunit
trnI
Ribosomal RNA
Rubisco subunit
Transfer RNA
Unnamed

38
100
200
300
400
500
600
LOLIINAE
ARUNDINARIINAE
POINAE
STIPEAE
ANDROPOGONINAE
TRITICEAE
PASPALINAE
ERAGROSTIDINAE
AGROSTIDINAE
ARISTIDEAE
AVENINAE
BAMBUSINAE
ANTHEPHORINAE
DANTHONIEAE
CENCHRINAE
ELEUSININAE
SPOROBOLINAE
ARTHROSTYLIDIINAE
MUHLENBERGIINAE
SACCHARIINAE
CHUSQUEINAE
MELINIDINAE
BROMEAE
MELICEAE
PANICINAE
COLEANTHINAE
ISCHAEMINAE
BOIVINELLINAE
ISACHNEAE
ROTTBOELLIINAE
MELOCANNINAE
OLYRINAE
TRISTACHYIDEAE
ARUNDINELLIEAE
DICHANTHELIINAE
ARTHROPOGONINAE
TRIODIINAE
TRIPOGONINAE
BOUTELOUINAE
TRIPSACINAE
DINOCHLOINAE
GUADUINAE
ARISTAVENINAE
ERIACHNEAE
ALOPECURINAE
ORYZINAE
AIRINAE
ANTHOXANTHINAE
SESLERIINAE
EHRHARTEAE
PARIANINAE
OTACHYRIINAE
HICKELIINAE
RACEMOBAMBOSINAE
GERMAINIINAE
COTTEINAE
ZIZANIINAE
ARTHRAXONINAE
HUBBARDOCHLOINAE
PARAPHOLIINAE
PAPPOPHORINAE
BRACHYPODIEAE
CALOTHECINAE
VENTENATINAE
NEURACHNINAE
GOUINIINAE
ECHINOPOGONINAE
DACTYLOCTENIINAE
ORININAE
CTENIINAE
PEROTIDINAE
PHALARIDINAE
ZEUGITEAE
ARUNDINEAE
DUTHIEEAE
TORREYOCHLOINAE
PHLEINAE
TRAGINAE
CHINONACHNINAE
MICRAIREAE
TRIRAPHIDEAE
SCLEROPOGONINAE
CINNINAE
PHAREAE
ZOYSIINAE
HOLCINAE
MONANTHOCHLOINAE
CYNOSURINAE
CRINIPINAE
UNIOLINAE
HILARIINAE
ORCUTTIINAE
TRICHONEURINAE
CHASMANTHIEAE
MOLINIINAE
AELUROPODINAE
GUADUELLEAE
HOLTTUMOCHLOINAE
BRIZINAE
BECKMANNIINAE
CENTROPODIEAE
ATRACTOCARPEAE
DIARRHENEAE
MILIINAE
DACTYLIDINAE
LITTLEDALEEAE
COICINAE
FARRAGININAE
STREPTOCHAETEAE
BRACHYELYTREAE
SCOLOCHLOINAE
AMMOCHLOINAE
CENTOTHECEAE
ANOMOCHLOEAE
STREPTOGYNEAE
GRESLANIINAE
CYPEROCHLOEAE
STEYERMARKOCHLOEAE
BUERGERSIOCHLOINAE
TEMBURONGIINAE
NARDEAE
LYGEEAE
PHAENOSPERMATEAE
BRYLKINIEAE
AMPELODESMEAE
THYSANOLAENEAE
GYNERIEAE
LECOMTELLEAE
ZAQIQAHINAE

39
View publication stats

Evolution and Taxonomy of The Grasses (Poaceae) : A Model Family For The Study of Species-Rich Groups

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Evolution and Taxonomy of The Grasses (Poaceae) : A Model Family For The Study of Species-Rich Groups

Uploaded by

Copyright:

Available Formats

See discussions, stats, and author profiles for this publication at: https://www.researchgate.

Chapter · April 2018

SUSTAIN: Endophytes for a Growing World View project

CerealPath View project

The user has requested enhancement of the downloaded file.

EVOLUTION AND TAXONOMY

Keywords: biogeography, DNA barcoding, C4 , co-evolution, diversification,

The grasses (Poaceae; alternative name Gramineae) are highly successful

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

Sub-family Species no. Type genus Major genera/economic plants

Early diverging lineages

Molecular phylogenetic studies strongly support the placement of grasses

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

Figure 1 Phylogenetic relationships and species numbers of Poaceae subfamilies. (a)

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

3 Classiﬁcation and Taxonomy

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

distinct autopolyploids as species. Many autopolyploids can be considered

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

Figure 3 High-quality digital imaging in grass taxonomy. Example of Bromus

in digital photography of fresh specimens and shape-recognition software

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

from environmental samples such as soil/roots, specimens in a vegetative

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

Locus Primer Sequence 5′ –3′ Tm (∘ C) Reference(s)

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

5 Age of the Grasses

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

First C4 fossils C4 dominant grassland

First grasses, forest Open habitat C3 grasslands

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

6 Biogeography and Habitat Reconstructions

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

The histograms in Figure 2 show that some subfamilies/tribes are more

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

species including Agrostis, Arundinaria, Bambusa, Eragrostis, Festuca, Poa,

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

in a phylogenetic reconstruction. They used the topological M statistics

8 Processes of Diversiﬁcation and Key Innovations

Factors influencing diversification rate variation include adaptive radiations,

8.1 Spikelet Morphology and Life History Traits

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

8.3 C3 and C4 Photosynthesis

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

grasses (Christin et al., 2013; Christin and Osborne, 2014; Moreno-Villena

8.4 Ecological Expansion of Grasses and Triggers for C4 Photosynthesis

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

9 Coevolution with Mammal Grazers

Throughout the Cenozoic grasses have co-evolved in complex interactions

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

10 Coevolution with Microbial Endophytes and Mycorrhizal

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

relative of barley, Hordeum murinum. Endophytes live in a diverse range

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

I thank Pascal-Antoine Christin for providing the time-calibrated phyloge-

Phylogenetic Analyses and Morphological Innovations in Land Plants

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.

Annual Plant Reviews Online, Volume 1. Edited by Jeremy Roberts.