J. Microbiol. Biotechnol.
(2012), 22(6), 729–735
http://dx.doi.org/10.4014/jmb.1111.11046
First published online March 17, 2012
pISSN 1017-7825 eISSN 1738-8872
RFLP Analysis of cry1 and cry2 Genes of Bacillus thuringiensis Isolates
from India
Patel, Ketan D.1* and Sanjay S. Ingle2
1
Department of Microbiology and Biotechnology Center, The M.S. University of Baroda, Vadodara, Gujarat, India
2
Ground Floor Laboratory, Department of Microbiology and Biotechnology Center, The M.S. University of Baroda, Vadodara,
Gujarat, India
Received: November 17, 2011 / Revised: January 21, 2012 / Accepted: January 22, 2012
The PCR-RFLP method has been useful for detection of
known genes and identification of novel genes. In the
present study, degenerate primers were designed from
five groups of cry1 genes for PCR-RFLP analysis. Bacillus
thuringiensis (Bt) isolates from different regions were
evaluated for PCR amplification of various cry1 genes
using newly designed primers and cry2 genes using
reported primers. PCR analysis showed an abundance of
cry1A genes and especially cry1Ac genes in isolates from
all regions. RFLP analysis revealed the presence of multiple
cry1A genes in isolates from central and southern regions.
Unique digestion patterns of cry1A genes were observed in
isolates from each region. Few of the isolates represented a
digestion pattern of cry1A genes that did match to any of
the known cry1A genes. RFLP analysis suggested an
abundance of cry2Ab along with a novel cry2 gene in Bt
isolates from different regions of India. Sequence analysis
of the novel cry2 gene revealed 95% sequence identity to
cry2Ab and cry2Ah genes. Phylogenetic analysis revealed
that the novel cry2 gene could have diverged earlier than
the other cry2 genes. Our results encourage finding of
more diverse cry2 genes in Bt isolates. Rarefaction analysis
was used to compare cry1A gene diversity in isolates from
different soil types. It showed a higher degree of cry1A
gene diversity in isolates from central region. In the
present study, we propose the use of novel degenerate
primers for cry1 genes and the PCR-RFLP method using
a single enzyme to distinguish multiple cry1A and cry2
genes as well as identify novel genes.
Keywords: Bacillus, cry genes, RFLP, degenerate primer
*Corresponding author
Phone: +0265-2794396;
E-mail: msu.ketan@gmail.com
# Supplementary data for this paper are available on-line only at
http://jmb.or.kr.
Lepidopteran insects are the major pests in various crops
around the world. Cry1 and Cry2 toxins of Bacillus
thuringiensis (Bt) having specific toxicity towards these insects
are more important economically. The diversity of cry1 and
cry2 genes that encode these toxins has been investigated
worldwide [1-5, 7, 9, 17]. As a result, 42 holotypes of cry1
genes and 7 holotypes of cry2 genes have been identified
(http://www.lifesci.sussex.ac.uk/Home/Neil_Crickmore/Bt).
However continuous screening for novel cry genes is still
required to address two main drawbacks associated with
Cry toxins. The most important is the development of
resistance in insects, which necessitates use of novel toxins
that can bind to different receptors. Another is the narrow
spectrum of activity, which requires search for toxins with
broader specificity such as Cry2 toxins or strains harboring
multiple cry genes.
Several methods have been described for identification
of novel genes and detection of multiple cry genes in Bt.
PCR analysis using specific primers could be a method of
choice but becomes cumbersome and time consuming
when dealing with large collection of isolates [14].
Alternatively, multiplex PCR can be used, but identification
of novel cry genes could become difficult [15]. Instead,
multiple cry genes can be detected easily with the PCR-
RFLP method by analyzing digestion patterns. More
importantly, novel cry genes can be identified prior to
sequencing [10]. As a result, the PCR-RFLP method has
been used widely in detection of different known cry genes
[17, 18] as well as identification of novel cry genes [10, 20].
However, available PCR-RFLP methods target only
cry1A and cry1I genes or use limited size of amplification
for RFLP analysis. Thus, the present study aims to use
novel degenerate primers for amplification of most frequently
observed groups of cry1 genes, and RFLP analysis using a
single restriction enzyme.
730 Patel and Ingle
MATERIALS AND METHODS
Bt Isolation
Soil samples were collected from the north-western, central, and
southern regions of India. Samples included in the north-western
region were from north and central Gujarat state, Rajasthan state
(Udaipur), Punjab state (Jalandhar), and Uttar Pradesh state (Chandoli).
Samples from Madhya Pradesh state and south Gujarat state (Vyara
and Mandvi) were allocated in the central region. Samples from
Karnataka state (Dharwar and Hubli) and Andhra Pradesh state
(Guntur) were considered in the southern region. Bt strains were
isolated and characterized for crystal formation, Cry protein content,
serotypes, and insect toxicity as described in a previous study [13].
Bt isolates were subcultured and maintained on Luria-Bertani agar
medium.
Designing of Degenerate Primers
Alignment of the initial 20 bp sequences from open reading frames
of cry1 genes and grouping according to the sequence similarity
were done using MEGA 4 software (http://www.megasoftware.net/
mega4). A degenerate primer was designed from five groups of cry1
genes as shown in Table 1. All primers were obtained from MWG-
Bioron Pvt. Ltd., Bangalore, India.
Amplification of cry1 Genes Using Degenerate Primers
Total DNA extraction from Bt isolates was performed by using a
Bacterial Total DNA extraction kit (Qiagen) as per the manufacturer’s
instructions. Total DNA (~50 ng) was used in a 30 µl PCR reaction.
Forward primers Grp 1 and Grp 5 were used at final concentration
of 1 µM, and primers Grp 2, Grp 3, and Grp 4 at 0.75 µM. CJ2
primer [3] was used as a common reverse primer for all five groups
at 0.25 µM final concentration for amplification of 3.4 kb cry1
genes. Long PCR Enzyme mix (Fermentas) was used as 2 Units per
system, dNTPs at 0.25 µM final concentration, and PCR buffer at
1× dilution. The PCR program for all primer pairs was first a
denaturation step at 94oC for 5 min followed by 30 cycles of
denaturation step at 94oC for 30 s, annealing step at 49oC for 45 s,
and elongation step at 72oC for 4 min, and a final extension at 72oC
for 10 min. Plasmid pKK-233-cry1Ac obtained from the Bacillus
Genetic Stock Centre (BGSC), Ohio State University, Ohio, USA,
was used as template for standardization of PCR amplification using
the Grp 3 degenerate primer. Similarly, plasmids pTZ-cry1Da, pTZ-
cry1Ea, and pTZ-cry1Ba were used for primers Grp 1, Grp 2, and
Grp 5, respectively.
Table 1. Degenerate primers for RFLP analysis of cry1 genes.
Primer Primer sequence
Grp 1 CGAGGATCCATGGADATAARTMAYCARAA
Grp 2 CGAGGATCCATGGAGATARTRAATAATCA
Grp 3 CGAGGATCCATGGATAACAATCCGAAMAT
Grp 4 CGAGGATCCATGAAAYTAAAGAATCMARA
Grp 5 CGAGGATCCTTGAMTTCAAATAGGAAAA
Uni R TTAGTCGACTATCGGTTTCTGGGAAGTA
Underlined letters represent degenerate codes, and sequences in italics are restriction sites.
Amplification of cry2 Genes
Primers II(+) and II(-) [12] were used at 0.25 µM final concentration
for partial amplification of cry2 genes. The amount of total DNA
and PCR rection was the same as for cry1 genes. The PCR program
was first a denaturation step at 94oC for 5 min, followed by 30
cycles of denaturation step at 94oC for 30 s, annealing step at 46oC
for 30 s, and elongation step at 72oC for 1 min 45 s, and a final
extension at 72oC for 10 min. Total DNA from Bacillus thuringiensis
subsp. kurstaki HD1 obtained from BGSC was used as a positive
control. Primers cry2 FP (AATAVTGTATTGAATARYGGAAGAA)
and cry2 RP (TTAATAAAGTGGTGRAAKATTAGTT) were used for
full-length amplification of novel cry2 genes. The PCR conditions
were the same as for partial amplification except for the extension
time of 2 min 30 s.
RFLP Analysis
The NEB cutter v.2.0 online program was used to select HaeIII
restriction enzyme, which showed unique in silico digestion patterns
for different cry1 genes. Similarly, TaqI enzyme was selected for
cry2 genes. The PCR amplification products were directly used in a
restriction digestion system of 25 µl. Both enzymes were used as 10
Units per system and ~500 ng of PCR amplification products. The
restriction system was incubated at 37oC for 4 h. Digests (25 µl)
were resolved in 2% agarose and stained with ethidium bromide
solution (0.5 µg/ml).
Diversity Indices
Bt isolation was performed from the north-western, central, and
southern regions of India representing alluvial soils, black soil, and
red and yellow soil, respectively. Isolation was also performed from
river sedimentary soil. In order to compare the diversity of cry1A
genes in isolates from different soil types, the Operational Taxonomic
Units (OTU) richness was estimated by rarefaction analysis. Similar
RFLP digestion patterns were considered as a single OTU.
Calculations were performed using Analytical Rarefaction program
version 1.3 (S. M. Holland, http://www.uga.edu/strata/software). E
values representing OTU richness for each region were plotted
against the number of isolates to generate rarefaction curves.
Phylogenetic Analysis
Clustering of the cry2 gene nucleotide sequences was based on the
neighbor-joining method using Clustal W (http://www.ebi.ac.uk/Tools/
msa/clustalw2/) and phylogenetic tree building using the Dendoscope
program (http://ab.inf.uni-tuebingen.de/software/dendroscope/).
cry1 Genes recognized
cry1Da, cry1Db, cry1Hb, cry1Ca, cry1Ga, cry1Gb, cry1Ja,
cry1Jb, cry1Jd
cry1Ea, cry1Ad, cry1Ha
cry1Aa, cry1Ab, cry1Ac, cry1Ae, cry1Af, cry1Ai, cry1La
cry1Ia, cry1Ib, cry1Ic, cry1Id, cry1Ie
cry1Ba, cry1Bb, cry1Bc, cry1Bd, cry1Bf, cry1Bg, cry1Ka
cry1
 RFLP ANALYSIS OF CRY1 AND CRY2 GENES 731

Fig. 1. RFLP analysis of 3.4 kb cry1A gene amplification products of isolates from the (A) north-western region, (B) central region, (C) southern
region and (D) river sedimentary soil.
Capital letters A to N on lanes represent different digestion patterns. ML: mixed DNA ladder.

RESULTS PCR amplification yielded products of expected 3.4 kb

Designing and Validation of Degenerate Primers
The phylogenetic tree of the initial 20 bp sequence formed
six groups of cry1 genes (Supplementary Fig. S1). One
group comprised cry1Fa, cry1Fb, cry1Cb, and cry1Eb genes,
which are not frequently observed and were not considered
for primer designing. A degenerate primer was designed
from the rest of the five groups to amplify most of the cry1
genes (Table 1). The degenerate primers Grp1, Grp2, Grp3,
and Grp5 were evaluated for amplification using reference
genes cry1Da, cry1Ea, cry1Ac, and cry1Ba from each group
as positive control, respectively (Supplementary Fig. S2).
size. Cross-amplification was not obtained with any of the
primers. Reference strain Bacillus thuringiensis HD-1 (Btk
HD1) was used to confirm amplification of multiple cry1A
genes by the Grp3 primer (Fig. 1B, lane 1).
PCR Amplification of cry1 and cry2 Genes
A total of 65 Bt isolates that showed amplification with
universal primers CJI-1 and CJI-2 for cry1 genes were
selected for PCR analysis using degenerate primers as
listed in Table 1. Surprisingly, 60 isolates showed expected
PCR amplification products of size 3.46 kb with Grp 3
primers for cry1A genes. Nine isolates and six isolates
732 Patel and Ingle
Fig. 2. RFLP analysis of 1.5 kb cry2 gene amplification products of isolates from the (A) north-western and central regions, (B)
southern region, and (C) river sedimentary soil.
Capital letters V to Z on lanes represent different digestion patterns. M: 100 bp DNA ladder; ML: mixed DNA ladder.
showed expected amplification products with Grp 5 and
Grp 1 primers, respectively. Only two isolates showed
amplification with Grp 2 primers. PCR amplification
product with Grp 4 primers for cry1I genes was not
obtained with any of the isolates used in the present study.
Thirty isolates yielded PCR products of expected 1.5 kb size
for cry2 genes using universal cry2 primers II(+) and II(-).
RFLP Analysis of cry1 Genes
Sixty isolates from different regions that showed
amplification with Grp3 primers for cry1A genes were
considered for RFLP analysis. PCR amplification products
of the 16 isolates from the north-western region, 17 isolates
from the central region, 18 isolates from river sedimentary
soil, and 9 isolates from the southern region were subjected
to RFLP analysis with HaeIII enzyme. Diverse digestion
patterns representing single to multiple cry1 genes were
observed during PCR-RFLP analysis. Bt isolates from the
central region showed the highest seven distinct digestion
patterns (Fig. 1B). Bt isolates from the north-western region
showed five digestion patterns, whereas isolates from the
southern region and river sedimentary soil showed four
patterns each (Fig. 1). Overall, 14 distinct digestion patterns
were observed for cry1A genes in the present study.
Reference strain Btk HD1 showed digestion pattern
representing cry1Aa, cry1Ab, and cry1Ac genes (Fig. 1B,
lane 1). Most of the isolates from the central and southern
regions showed digestion patterns representing multiple
cry1A genes (Fig. 1B and 1C), whereas most of the isolates
from the north-western region and river sedimentary soil
showed digestion pattern representing a single cry1A gene
(Fig. 1A and 1D). A few of the isolates also showed patterns
that did not match to any of the known cry1A genes (Fig. 1A,
lane 14; Fig. 1B, lane 8; Fig. 1C, lane 7). Pattern A, which
represented the cry1Ac gene, was observed most frequently
in isolates from different regions and river sedimentary soil.
The cry1A genes in isolates from the north-western region
and river sedimentary soil showed common patterns A and
B, whereas that from the central and southern regions
showed patterns F and A as common. Patterns C and D
were unique in isolates from the north-western region, and
patterns H, I, J, and K to the central region. Similarly,
patterns L and M were unique to isolates from river
sedimentary soil and pattern N to the southern region.
PCR Amplification for cry1Ac Gene
Surprisingly, the digestion pattern representing the cry1Ac
gene (Fig. 1A, lane 2) was observed in 42 out of 60 isolates
 RFLP ANALYSIS OF CRY1 AND CRY2 GENES 733

Fig. 3. Phylogenetic tree constructed based on alignment of cry2 gene sequences along with the cry2 gene from native Bt isolate KN4.

(72%). Twenty-two from these isolates exhibited pattern
representing a single cry1Ac gene. Confirmation of the
cry1Ac gene was done by PCR amplification with gene-
specific primers and sequencing of the amplification
products from two isolates (GenBank Accession Nos.
EU906915 and EU906916). All 42 isolates showed PCR
amplification with cry1Ac gene-specific primers (Supplementary
Fig. S3). Dominance of the cry1Ac gene was observed in
isolates from all soil types.
RFLP Analysis of cry2 Genes
RFLP analysis of partial cry2 gene amplification products
of 30 Bt isolates showed five distinct digestion patterns
(Fig. 2). Four isolates showed single cry2 gene pattern Y
(Fig. 2B, lanes 4 to 7), which matched to that of the Btk
HD1 cry2Ab gene (Fig. 2A, lane 17). Eleven isolates
showed digestion pattern X for simultaneous presence of
two different cry2 genes, which represented cry2Ab gene
and an unknown cry2 gene. Pattern W was represented by
eight isolates, which did not match to any of the known
cry2 gene digestion patterns. Jouzani et al. [9], Liang et al.
[11], Sauka et al. [17], and Seifinejad et al. [19] reported a
higher frequency of cry2Ab genes. In contrast to these
reports, patterns X and W represented by cry2Ab gene and
unknown cry2 gene were observed to dominate in Indian
regions during the present study. Similarly, patterns Z and
V did not match to any known pattern and were unique to
isolates from river sedimentary soil.
sequences at the start and end of the ORF of the novel gene
could be different than the known genes. Thus the cry2
gene sequence from the isolate could be a novel gene.
However, cloning of a full-length gene needs to be performed
before assigning it as a new cry2 gene.
The phylogenetic tree constructed from partial cry2
gene sequences formed two clusters with three and five
sequences in each cluster (Fig. 3). The larger cluster
formed two lineages, one by the novel gene and another by
cry2Aa, cry2Ad, cry2Ac, and cry2Af genes. The phylogenetic
tree indicated the novel cry2 gene to have diverged earlier
than the genes of another lineage. The cry2 gene from
KN4 had no other partner sequence, which indicated that
the novel gene could be a distinct cry2 gene.
Diversity Analysis
Rarefaction analysis was performed to compare the diversity
of cry1A genes harbored by isolates from different regions
(Fig. 4). Isolates from the central region represented
maximum seven distinct patterns and thereby the highest
rarefaction curve. In contrast, isolates from the other
regions showed four to five patterns and rarefaction curves
at a similar level. Moreover, an asymptote (plateau) in

Sequence and Phylogenetic Analysis

The cry2 gene amplification product from isolate KN4 was
sequenced (GenBank Accession No. JN257713). Sequence
analysis of the partial 517 bp cry2 gene sequence revealed
95% matching to cry2Ah and cry2Ab genes. At the amino
acid level, the sequence identity with known genes was
observed to be maximum 94%. Since the 517 bp sequence
belonged to the domain I coding region of the cry2 gene,
more sequence differences can be expected in the domain
II and domain III coding regions. Full-length amplification
with degenerate primers designed from the known cry2 Fig. 4. Rarefaction analysis of cry1A genes in isolates from
sequences failed to amplify the novel gene. Thereby, various regions and river sedimentary soil.
734 Patel and Ingle
rarefaction curves denoting full diversity coverage was not
reached for any of the regions.
DISCUSSION
Bt strains isolated from various regions were characterized
by PCR amplification with novel degenerate primers
designed in the present study for cry1 genes and by
reported primers for cry2 genes. Amplification products of
cry1A and cry2 genes were then subjected to RFLP
analysis to detect known genes and identify novel genes.
Amplification with degenerate primers for cry1 genes and
RFLP analysis in the present study indicated a dominance
of cry1A genes in isolates from different regions of India.
PCR amplification with gene-specific primers confirmed
the dominance of cry1Ac gene in isolates from Indian
regions. The dominance of cry1Aa and cry1Ac genes has
been observed by in many parts of the world [2, 9, 19].
Isolates harboring only cry1Ac gene were also observed at
higher frequency by Gao et al. [6]. Thus, the present study
supports a higher frequency of cry1A genes in Bt strains
worldwide. The higher frequency of cry1A genes in the
present study could be attributed to a worldwide dominance
of cry1A genes. However, the dominance of cry1Ac genes
remains unclear.
In the present study, the presence of unique digestion
patterns of cry1A genes to each region was observed,
which indicated a prevalence of specific cry1A gene or its
combination. Region-specific presence of cry1 genes has
been observed by Wang et al. [22]. Ecological-favored
distribution of cry1 genes in various crop lands was suggested
by Uribe et al. [21]. Geographical-related distribution of
cry genes was reported in several studies [2, 4, 5]. Thus,
the present study supports a region-specific distribution of
cry1 genes. Since a plateau was not reached in rarefaction
curves, it indicated that more cry1A could be found from
each region.
A new cry2Ab gene was reported by Jain et al. [7] from
India. Recently, Liang et al. [11] found a novel gene
assigned as cry2Ag. Concurrent to these reports, a novel
cry2 with 95% identity was detected in isolate KN4, which
represented a distinct digestion pattern. Similarly, distinct
patterns Z and V could represent novel cry2 genes. Thus,
the present study encourages finding of more novel cry2
genes that could be useful to combat resistance development.
In fact, the cry2Ab gene was used as a multiple toxin
strategy in Bollguard II variety of transgenic Bt cotton.
Additionally, cry2 genes with dual specificity towards
Lepidopteran and Dipteran insects could be of major
interest. Henceforth, extensive investigations should be
performed to explore remaining unknown cry2 genes.
Kuo and Chak [10] reported primers for PCR-RFLP-
based detection of known cry genes and identification of
novel cry genes. However, amplification products of size
1.6 kb limit RFLP analysis and require use of multiple
restriction enzymes. Sauka et al. [16] used degenerate
primers for full-length amplification of cry1A genes. Song
et al. [20] and Sauka et al. [18] designed primers for PCR-
RFLP method-based identification of cry1I genes. However,
amplification was restricted to only cry1A and cry1I genes,
respectively. In this report, we propose use of five
degenerate primers for amplification of full-length 3.4 kb
of different groups of cry1 genes. Full-length size of the
gene allowed use of just a single restriction enzyme, HaeIII,
for identification of known cry1 genes and detection of
novel genes. At the same time, isolates harboring single or
multiple cry1 genes can be distinguished, which could be
helpful to predict a broader spectrum of activity. More
importantly, cloning of the full-length novel gene can be
done with the same primers for further characterization.
Collectively, our results suggest the possibility of finding
more cry1 and cry2 genes in Bt isolates using PCR-RFLP.
The diversity of cry1 and cry2 genes in native Bt isolates
from India indicates the potential for control of different
species of Lepidopteran and Dipteran insects. Thus, a
future perspective of the present study would be to explore
the toxicity potential of these isolates and the cloning of
novel cry genes.
Acknowledgments
The Authors would like to thank Aram Mikaelyan for his
constant support during the work. It is a pleasure to
acknowledge Prof. Anjana Desai for providing excellent
laboratory facilities and developing department infrastructure.
REFERENCES
1. Armengol, G., M. C. Escobar, M. E. Maldonado, and S. Orduz.
2007. Diversity of Colombian strains of Bacillus thuringiensis
with insecticidal activity against dipteran and lepidopteran
insects. J. Appl. Microbiol. 102: 77-88.
2. Bravo, A., S. Sarabia, L. Lopez, H. Ontiveros, C. Abarca, A.
Ortiz, et al. 1998. Characterization of cry genes in a Mexican
Bacillus thuringiensis strain collection. Appl. Environ. Microbiol.
64: 4965-4972.
3. Ceron, J., L. Covarrubias, R. Quintero, A. Ortiz, M. Ortiz, E.
Aranda, et al. 1994. PCR analysis of the cryI insecticidal crystal
family genes from Bacillus thuringiensis. Appl. Environ. Microbiol.
60: 353-356.
4. Chak, K. F., D. C. Chao, M. Y. Tseng, S. S. Kao, S. J. Tuan,
and T. Y. Feng. 1994. Determination and distribution of cry-
type genes of Bacillus thuringiensis isolates from Taiwan. Appl.
Environ. Microbiol. 60: 2415-2420.
5. Chen, F. C., M. C. Tsai, C. H. Peng, and K. F. Chak. 2004.
Dissection of cry gene profiles of Bacillus thuringiensis isolates
in Taiwan. Curr. Microbiol. 48: 270-275.

6. Gao, M., R. Li, S. Dai, Y. Wu, and D. Yi. 2008. Diversity of
Bacillus thuringiensis strains from soil in China and their
pesticidal activities. Biol. Contr. 44: 380-388.
7. Jain, D., V. Udayasuriyan, P. I. Arulselvi, S. S. Dev, and P.
Sangeetha. 2006. Cloning, characterization, and expression of a
new cry2Ab gene from Bacillus thuringiensis strain 14-1. Appl.
Biochem. Biotechnol. 128: 185-194.
8. Jara, S., P. Maduell, and S. Orduz. 2006. Diversity of Bacillus
thuringiensis strains in the maize and bean phylloplane and their
respective soils in Colombia. J. Appl. Microbiol. 101: 117-124.
9. Jouzani, G. S., A. P. Abad, A. Seifinejad, R. Marzban, K.
Kariman, and B. Maleki. 2008. Distribution and diversity of
Dipteran-specific cry and cyt genes in native Bacillus thuringiensis
strains obtained from different ecosystems of Iran. J. Ind.
Microbiol. Biotechnol. 35: 83-94.
10. Kuo, W. S. and K. F. Chak. 1996. Identification of novel cry-
type genes from Bacillus thuringiensis strains on the basis of
restriction fragment length polymorphism of the PCR-amplified
DNA. Appl. Environ. Microbiol. 62: 1369-1377.
11. Liang, H., Y. Liu, J. Zhu, P. Guan, S. Li, S. Wang, et al. 2011.
Characterization of cry2-type genes of Bacillus thuringiensis
strains from soil-isolated of Sichuan basin, China. Braz. J.
Microbiol. 42: 140-146.
12. Masson, L., M. Erlandson, M. Puzstai-Carey, R. Brousseau, V.
Juarez-Perez, and R. Frutos. 1998. A holistic approach for
determining the entomopathogenic potential of Bacillus thuringiensis
strains. Appl. Environ. Microbiol. 64: 4782-4788.
13. Patel, K. D., C. Chudashama, and S. S. Ingle. 2011. Molecular
characterization of Bacillus thuringiensis strains isolated from
diverse habitats of India. J. Basic Microbiol. 51: 1-9.
14. Porcar, M. and V. Juarez-Perez. 2003. PCR-based identification
of Bacillus thuringiensis pesticidal crystal genes. FEMS Microbiol.
Rev. 26: 419-432.
RFLP ANALYSIS OF CRY1 AND CRY2 GENES 735
15. Ben-Dov, E., A. Zaritsky, E. Dahan, Z. Barak, R. Sinai, R.
Manasherob, et al. 1997. Extended screening by PCR for seven
cry-group genes from field-collected strains of Bacillus
thuringiensis. Appl. Environ. Microbiol. 63: 4883-4890.
16. Sauka, D. H., A. F. Amadio, R. O. Zandomeni, and G. B.
Benintende. 2007. Strategy for amplification and sequencing of
insecticidal cry1A genes from Bacillus thuringiensis. Antonie
Van Leeuwenhoek 91: 423-430.
17. Sauka, D. H., J. G. Cozzi, and G. B. Benintende. 2005.
Screening of cry2 genes in Bacillus thuringiensis isolates from
Argentina. Antonie Van Leeuwenhoek 88: 163-165.
18. Sauka, D. H., J. G. Cozzi, and G. B. Benintende. 2006. Detection
and identification of cry1I genes in Bacillus thuringiensis using
polymerase chain reaction and restriction fragment length
polymorphism analysis. Curr. Microbiol. 52: 60-63.
19. Seifinejad, A., G. R. Salehi Jouzani, A. Hosseinzadeh, and C.
Abdmishani. 2008. Characterization of Lepidoptera-active cry
and vip genes in Iranian Bacillus thuringiensis strain collection.
Biol. Contr. 44: 216-226.
20. Song, F., J. Zhang, A. Gu, Y. Wu, L. Han, K. He, et al. 2003.
Identification of cry1I-type genes from Bacillus thuringiensis
strains and characterization of a novel cry1I-type gene. Appl.
Environ. Microbiol. 69: 5207-5211.
21. Uribe, D., W. Martinez, and J. Ceron. 2003. Distribution and
diversity of cry genes in native strains of Bacillus thuringiensis
obtained from different ecosystems from Colombia. J. Invertebr.
Pathol. 82: 119-127.
22. Wang, J., A. Boets, J. Van Rie, and G. Ren. 2003. Characterization
of cry1, cry2, and cry9 genes in Bacillus thuringiensis isolates
from China. J. Invertebr. Pathol. 82: 63-71.