Professional Documents
Culture Documents
March 2019 PDF
March 2019 PDF
58
THE
INNER
LIVES OF
NEUTRON
STARS
Inside the densest
objects in the universe
S
PLU
UNDISCOVERED ILLNESS
The opposite of depression PAGE 36
VO LU M E 3 2 0 , N U M B E R 3
42
A STROPHYSIC S C L I M AT E
Hundreds of thousands of people Excavations of stone tools left dense remnants made mostly of neutrons.
experience mania without ever behind by nonhuman primates Inside these remnants, the neutrons themselves
may break down, or they might form a friction
getting depressed. Why does are illuminating the origins of
less “superfluid.” New experiments should help
psychiatry insist on calling them technological innovation. scientists sort through the possibilities.
bipolar? By Simon Makin By Michael Haslam Illustration by FOREAL.
ON THE WEB
Revisiting Fukushima
Scientific American l ooks at the legacy of the Fukushima
nuclear disaster of March 11, 2011, and the science still
being done to grapple with its continuing effects.
Go to www.ScientificAmerican.com/mar2019/fukushima
74
Scientific American (ISSN 0036-8733), Volume 320, Number 3, March 2019, published monthly by Scientific American, a division of Springer Nature America, Inc., 1 New York Plaza, Suite 4600, New York, N.Y. 10004-1562.
Periodicals postage paid at New York, N.Y., and at additional mailing offices. Canada Post International Publications Mail (Canadian Distribution) Sales Agreement No. 40012504. Canadian BN No. 127387652RT; TVQ1218059275
TQ0001. Publication Mail Agreement #40012504. Return undeliverable mail to Scientific American, P.O. Box 819, Stn Main, Markham, ON L3P 8A2. I ndividual Subscription rates: 1 year $49.99 (USD), Canada $59.99 (USD),
International $69.99 (USD). I nstitutional Subscription rates: Schools and Public Libraries: 1 year $84 (USD), Canada $89 (USD), International $96 (USD). Businesses and Colleges/Universities: 1 year $399 (USD), Canada
$405 (USD), International $411 (USD). Postmaster: Send address changes to Scientific American, Box 3187, Harlan, Iowa 51537. R eprints inquiries: (212) 451-8415. To request single copies or back issues, call
(800) 333-1199. S ubscription inquiries: U.S. and Canada (800) 333-1199; other (515) 248-7684. Send e-mail to scacustserv@cdsfulfillment.com.
Printed in U.S.A. Copyright © 2019 by Scientific American, a division of Springer Nature America, Inc. All rights reserved.
Scientific American is part of Springer Nature, which owns or has commercial relations with thousands of scientific publications (many of them can be found at www.springernature.com/us). Scientific American maintains
a strict policy of editorial independence in reporting developments in science to our readers. Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
“Outrageous” focusing on these unusual objects. Dive in, starting on page 24.
The human genome’s DNA forms some 10,000 wiggling
Objects and
minuscule loops in our cells, which somehow avoid “tangling
into a mess” that would disrupt crucial genetic messages. These
loops, which turn out to be ancient structures in biology, are
Other Adventures involved in gene regulation and may hold clues to how many dis-
eases arise. As geneticist Erez Lieberman Aiden writes, “We and
in Science
others have figured out how these loops form, dancing an ele-
gant tango that keeps the genome tangle-free.” Beginning
on page 50, you can unspool the mystery in his feature,
“Untangling the Genome.”
“The most outrageous object t hat most peo- Several stories will take you on fascinating intel-
ple have never heard of,” as one scientist calls lectual voyages into the mind and behavior—and
it, is the subject of our cover story—and, to my not just those of humans. Contributing editor
mind at least, such amazing adventures in discov- Melinda Wenner Moyer looks at why some
ery make up a theme that resounds throughout people refuse to accept facts and data in
this Scientific American i ssue, among many others. “Why We Believe Conspiracy Theories”
What’s this intriguing object? In “The Inner Lives (page 58). “The Undiscovered Illness,” by
of Neutron Stars,” senior editor Clara Moskowitz journalist Simon Makin, explores the
writes about these strange cosmic things, which pack question of whether some bipolar patients
the mass of roughly two suns into a space no wider than who experience only mania should have a separate diag-
a city. They are born when stars die and collapse on nosis (page 36). Two articles look at cognitive areas at least partly
themselves. The extreme density created by stellar cataclysms is shared among animals. “The Orca’s Sorrow,” by science writer Bar-
the greatest amount allowed naturally in our universe and impos- bara J. King, finds evidence that a wide variety of animals are capa-
sible to come close to approximating in any laboratory on Earth. ble of mourning (page 30). “The Other Tool Users,” by independent
Understanding the phenomena that result under such conditions researcher Michael Haslam (page 64), looks at excavations of stone
is the tantalizing challenge of researchers, who are positioned to tools left behind by nonhuman primates and the origin of inno-
gain new insights from detectors capable of measuring gravita- vation. And get ready for more extreme summer weather, as expert
tional waves from neutron star collisions, along with experiments Michael E. Mann takes us on a tour of the jet stream (page 42).
BOARD OF ADVISERS
Leslie C. Aiello Edward W. Felten Lene Vestergaard Hau Satyajit Mayor Daniela Rus
President, Wenner-Gren Foundation Director, Center for Information Mallinckrodt Professor Senior Professor, National Center Director, Computer Science and
for Anthropological Research Technology Policy, Princeton University of Physics and of Applied Physics, for Biological Sciences, Tata Institute Artificial Intelligence Laboratory, M.I.T.
Robin E. Bell Jonathan Foley Harvard University of Fundamental Research Eugenie C. Scott
Research Professor, Lamont-Doherty Executive Director and William R. Hopi E. Hoekstra John P. Moore Chair, Advisory Council,
Earth Observatory, Columbia University and Gretchen B. Kimball Chair, Alexander Agassiz Professor Professor of Microbiology and National Center for Science Education
California Academy of Sciences of Zoology, Harvard University Immunology, Weill Medical Terry Sejnowski
Emery N. Brown
Jennifer Francis Ayana Elizabeth Johnson College of Cornell University Professor and Laboratory
Edward Hood Taplin Professor of
Medical Engineering and of Senior Scientist, Woods Hole Founder and CEO, Donna J. Nelson Head of Computational
Computational Neuroscience, M.I.T., Research Center Ocean Collective Professor of Chemistry, Neurobiology Laboratory,
and Warren M. Zapol Professor Kaigham J. Gabriel Christof Koch University of Oklahoma Salk Institute for Biological Studies
of Anesthesia, Harvard Medical School President and Chief Executive Officer, President and CSO, Robert E. Palazzo Meg Urry
Charles Stark Draper Laboratory Allen Institute for Brain Science Dean, University of Alabama Israel Munson Professor of Physics
Vinton G. Cerf
Harold “Skip” Garner Morten L. Kringelbach at Birmingham College and Astronomy, Yale University
Chief Internet Evangelist, Google
Executive Director and Professor, Associate Professor and Senior of Arts and Sciences Michael E. Webber
George M. Church
Primary Care Research Network Research Fellow, The Queen’s College, Rosalind Picard Co-director, Clean Energy Incubator,
Director, Center for Computational
and Center for Bioinformatics University of Oxford Professor and Director, Affective and Associate Professor,
Genetics, Harvard Medical School and Genetics, Edward Via College Computing, M.I.T. Media Lab Department of Mechanical Engineering,
Robert S. Langer
Rita Colwell of Osteopathic Medicine David H. Koch Institute Professor, Carolyn Porco University of Texas at Austin
Distinguished University Professor, Michael S. Gazzaniga Department of Chemical Leader, Cassini Imaging Science George M. Whitesides
University of Maryland College Park Director, Sage Center for the Study Engineering, M.I.T. Team, and Director, CICLOPS, Professor of Chemistry and
and Johns Hopkins Bloomberg School of Mind, University of California, Space Science Institute Chemical Biology, Harvard University
Meg Lowman
of Public Health Santa Barbara Senior Scientist and Lindsay Chair Lisa Randall Amie Wilkinson
Drew Endy Carlos Gershenson of Botany, California Academy of Professor of Physics, Professor of Mathematics,
Professor of Bioengineering, Research Professor, National Sciences, and Rachel Carson Center Harvard University University of Chicago
Stanford University Autonomous University of Mexico for Environment and Society, Ludwig Martin Rees Anton Zeilinger
Nita A. Farahany Alison Gopnik Maximilian University Munich Astronomer Royal and Professor Professor of Quantum Optics,
Professor of Law and Philosophy, Professor of Psychology and John Maeda of Cosmology and Astrophysics, Quantum Nanophysics,
Director, Duke Initiative for Affiliate Professor of Philosophy, Global Head, Computational Institute of Astronomy, Quantum Information,
Science & Society, Duke University University of California, Berkeley Design + Inclusion, Automattic, Inc. University of Cambridge University of Vienna
“The problems with change “the process and criteria for re
drawing state legislative districts during
slavery would not reapportionment.” (While many argued
have been fixed that the ballot wording was deceptive, one
needs examine the details. The full state
simply by calling ment can be found here: www.sos.mo.gov/
for more regulation elections/petitions/2018BallotMeasures)
I wonder if any of the ideas or analyses
and stiffer penalties.” Duchin presents could be used toward
marianne hillsouth portland, me. validating the method outlined in the
constitutional amendment before actual
redistricting maps are constructed.
James K. Boyce makes about the links be Moritz FarbsteinSt. Louis, Mo.
tween environmental degradation and
inequality in “The Environmental Cost of The Markov chain Monte Carlo (MCMC)
Inequality” [The Science of Inequality]. process for redistricting that Duchin de
But Stiglitz’s list of needed policy changes scribes requires the public to trust both
falls short, as does Boyce’s reliance on en the mathematics and the mathemati
November 2018 vironmental activists to save flora, fauna cians. The possible configurations are so
and natural resources. enormous that it reminds me of all the
We know that the problems with slav possible outcomes in a game of chess.
INEQUALITY CONTROL ery would not have been fixed simply by And yet even beginners play chess with
Economist Joseph E. Stiglitz’s article (“A calling for more regulation and stiffer out being overwhelmed by the vast num
Rigged Economy” [The Science of In penalties. Our laws today ensure that a ber of moves.
equality]) on how we got to today’s la few can claim excessive wealth and pow Perhaps the entire process could be
mentable economic state in the U.S. is er. By what right do those owning firms treated more like chess, with the two sides
spot on. Yet let me give my own, more have the power to decide how the in taking turns choosing a district to maxi
simple explanation: When I was a young come and wealth generated by the talent mize its number of voters instead of let
man, during the three decades after FDR and labor of many are used? Stakehold ting one side make all the moves for both.
and the New Deal, the maximum federal ers—employees, customers, the commu If one side outnumbers the other, that side
tax rate (applied at the time to income ex nities affected by a company’s decisions— may be given proportionally more choices.
ceeding an amount that has ranged be have rights that require greater recogni The final result would be approved by a
tween $100,000 and $500,000) was be tion. Stakeholders’ interests should be judge or a redistricting committee.
tween 70 and 91 percent. As such, federal represented on the boards of big firms. There is no need to resort to the mas
taxation was highly progressive; the rich Those with revenues exceeding $1 billion sive computations in MCMC as long as
were few and were not so obscenely should be required to have a national the process of choosing the districts is fair.
wealthy, and most important, the middle charter that would lay out obligations Benjamin Jones v ia e-mail
class was dominant. In 1981, shortly after and penalties.
taking office, Ronald Reagan slashed the Where would the power to institute DUCHIN REPLIES: T he Missouri amend-
top bracket’s rate to 50 percent and then, such changes originate? My fellow econo ment that Farbstein refers to belongs to a
in 1986, to 28 percent—a tremendous mists are very reluctant to talk about poli crop of state-level reform measures ap-
windfall for the rich that continues un tical parties, yet we want to influence po proved by voters in 2018 (joining Colora-
abated (today’s top rate is 37 percent on litical platforms. We can at least begin to do, Utah, Ohio and Michigan). Missouri’s
income exceeding $500,000). identify not only where the public interest was especially detailed: specific criteria
One has only to look at Stiglitz’s graphs, lies but also what kind of political group is were laid out, including a formula to de-
in which everything takes a turn for the most likely to represent those interests. fine “partisan fairness” and a precise way
worse after 1980, to see how our current Marianne Hill S outh Portland, Me. to measure “competitiveness.” A legiti-
tax code lines the pockets of the rich and mate worry for such reforms is that trade-
steadily erodes the middle class. We either REDISTRICT JUDGE offs in redistricting priorities are so com-
return to a progressive tax policy or con In “Geometry v .Gerrymandering,” Moon plicated that well-meaning rules might
tinue the descent into plutocracy. Duchin describes mathematicians’ efforts actually conflict or have unintended con-
R. C. Gibson Irvine, Calif. to create statistical methods to detect sequences. This raises scientific questions,
and replace biased voting district maps. and they are approachable! Sampling
I agree with the points that Stiglitz (who Last November’s election in Missouri from the universe of plans can illustrate
is my former professor) makes about the had an amendment on the ballot, ap the cost to one priority as another is intro-
causes of inequality, as well as those that proved by about 62 percent of the vote, to duced and can give a state-specific base-
Genomic Studies
Already these projects have led to discoveries that
can make clinical trials and medical care more successful for par-
ticipants with these genetic backgrounds. For example, the Kore-
Need Diversity
an genome project found a population-specific variant in a gene
that regulates how some medications are metabolized by the body.
This is essential information for dosing and for gauging the like-
lihood that a patient will respond to a particular therapy.
A heavy skew toward white people In places with less developed infrastructure, including parts of
makes precision medicine imprecise Latin America and Africa, such efforts have lagged: the National
Human Genome Research Institute has begun gathering data
By Jonas Korlach
from these areas, but sequencing and analysis are usually done
Underrepresentation of nonwhite ethnic groups in scientific elsewhere. Still, as more such projects move forward, there will be
research and clinical trials has been a disturbing trend. One important discoveries that will be relevant to any number of eth-
particularly troubling aspect is that human genomic databases nic groups. One such program—a National Institutes of Health ef-
are heavily skewed toward people of European descent. If left fort called “All of Us”—aims to sequence a diverse sampling of
unaddressed, this inherent bias will continue to contribute to Americans across gender, sexual orientation, ethnicity and race.
uneven success rates in so-called precision medicine. Being inclusive is its fundamental goal, and participation is free.
The problem stems from the underlying structure of science. In the field of rare diseases, genome sequencing has proved re-
In the early days of genomics, funding for sequencing projects was markable at increasing the diagnosis rate, giving answers to pa-
often highest among mostly white countries, so those populations tients who might otherwise have gone undiagnosed. Today that
are better represented in public databases. Also, some minorities approach remains most effective for Caucasian patients because
have been historically mistreated by scientists—the Tuskegee more of their DNA can be interpreted using current genomic data
syphilis experiment is one glaring example—and many members repositories. But as we build up data for people of other ethnici-
of those groups can be understandably reluctant to enter studies. ties, we can expect such successes to extend rapidly to patients of
Early studies were also biased by the types of genetic variation any background, which stands to dramatically improve health
the research focused on. Initially scientists looked at only tiny, care for hundreds of millions of people.
single-base-pair DNA differences between populations, ignoring Achieving the vision of precision medicine for individuals of
larger variations that were more difficult to assess but that turned any ethnic group requires more diverse representation in the bi-
out to be more significant than anyone expected. These are now ological repositories that underlie clinical programs. Advanced
known to cause genetic disease and influence the way drugs are DNA-sequencing technology is one tool of many needed to help
metabolized by different ethnic populations, not just individuals— generate better information about people from all ethnicities for
and advanced technologies allow scientists to identify variations the equitable application of those data in clinical practice.
that in many cases have never been seen before.
JOIN T HE CONVERSAT ION ONLINE
This is an exciting step forward: we are finding that some of Visit Scientific American on Facebook and Twitter
these structural differences can explain diseases for which no or send a letter to the editor: editors@sciam.com
C L I M AT E A N D H E A LT H
Feverish
Planet
A sobering report links climate
change to labor loss, disease
and death worldwide
of the report. “We’ve been seeing these occupational health. But there comes a result of extreme weather, the report found.
impacts for some time now.” point at which it is simply too hot for the “Overall, the report does suggest very
The report found that millions of people body to function. For example, sweating serious concerns about the way in which
worldwide are vulnerable to heat-related heavily without replenishing water can climate change is evolving and its potential
disease and death and that populations in result in chronic kidney disease, Kjellstrom implications for human health,” says Andy
Europe and the eastern Mediterranean are notes. News reports have documented Haines, a professor of environmental
especially susceptible—most likely because farm workers in Central America dying change and public health at the London
they have more elderly people living in from kidney problems after years of work- School of Hygiene & Tropical Medicine,
urban areas. Adults older than 65 are par- ing in the hot fields. Richer countries such who was not involved in the 2018 report
ticularly at risk, as are those with chronic as the U.S. may avoid the worst effects but has co-authored previous Lancet
illnesses such as heart disease or diabetes. because of better access to drinking water Countdown assessments. “One of the
Places where humans tend to live are and, in the case of indoor work, air-condi- problems is that we don’t have enough
exposed to an average temperature tioning. But these solutions can be expen- data on the actual impacts, particularly in
change that is more than twice the global sive, Kjellstrom says. the low-income countries,” which will likely
average—0.8 versus 0.3 degree Celsius Then there are indirect effects. For be most affected, he says.
(graphic). There were 157 million more example, warmer temperatures have The report did find some bright spots: in
“heat wave exposure events” (one heat increased the geographical ranges of 2015, 30 of 40 countries surveyed by the
wave experienced by one person) in 2017 organisms that spread dengue fever, WHO reported having climate change
than in 2000. Compared with 1986 to 2005, malaria and cholera. The “vectorial health adaptation plans, and 65 percent of
each person was exposed to, on average, capacity”—a measure of how easily a cities have undertaken (or are undertaking)
1.4 more days of heat wave per year from disease carrier can transmit a pathogen— risk assessments that address threats to
2000 to 2017. That may not seem like a lot, of dengue virus, which is spread by the public health infrastructure. But worldwide
but as Watts notes, “someone who is 75 Aedes aegyptiand A edes albopictusmosqui- spending on health adaptation is still under
and suffers from kidney disease can proba- toes, reached a record high in 2016. The 5 percent of all climate adaptation spending.
bly survive three to four days of heat wave percentage of coastline suitable for bacte- And funding has not matched that pledged
but not five or six.” ria in the Vibrio genus (which includes the in the Paris Agreement, the global climate
Sweltering temperatures also affect species that causes cholera) increased accord that is set to take effect in 2020.
productivity. A staggering 153 billion hours from the 1980s to the 2010s in the Baltic Among the biggest steps countries can
of labor—80 percent of them in agricul- region and northeastern U.S. by 24 and take to mitigate these health effects are
ture—were lost to excessive heat in 2017, 27 percent, respectively. In Africa’s high- phasing out coal-fired power and shifting to
the new report found, with the most vul- lands, environmental suitability for the greener forms of transportation, Watts says.
nerable areas being in India, Southeast malaria-causing P lasmodium falciparum Electric vehicles are making inroads in plac-
Asia, sub-Saharan Africa and South Ameri- parasite increased by nearly 21 percent es, he notes—and “active” transport, such as
ca. The first stage of heat’s impact is dis- from the 1950s to the 2010s. walking or cycling, is also important. Tallying
comfort, says report co-author Tord Kjell- Climate change also threatens food up the costs of climate change, Watts says,
strom, director of the Health and Environ- security. Our planet still produces more makes it clear that “our response or lack of
SOURCE: “THE 2018 REPORT OF THE LANCET COUNTDOWN ON HEALTH AND CLIMATE CHANGE: SHAPING THE HEALTH
ment International Trust in New Zealand than enough food for the world, but 30 response is going to determine our health
and a consultant on environmental and countries have seen crop yields decline as a over the next century.” —Tanya Lewis
OF NATIONS FOR CENTURIES TO COME,” BY NICK WATTS ET AL., IN L ANCET, VOL. 392; DECEMBER 8, 2018
A Hotter Planet Puts More People at Risk
+0.8 Average temperature change
(degrees Celsius)
Baseline Baseline
–0.2 –50
2000 2002 2004 2006 2008 2010 2012 2014 2016 2000 2002 2004 2006 2008 2010 2012 2014 2016
The graphs compare temperatures and heat wave events since 2000 with baseline values from the reference period 1986−2005.
Chatter
Fournet and her collaborators amassed Your Panama tour features
Chatter
Fournet and her collaborators amassed
nearly 115 hours of archival recordings col- all hotels, all meals, complete
nearly 115 hours of archival recordings col-
lected in southeastern Alaska between sightseeing, and all activities
Many humpback calls have lected in southeastern Alaska between
1976 and 2012. “No one had listened to
Many humpback calls have 1976 and 2012. “No one had listened to
included. Tax and fees extra.
remained the same over decades them in years,” Fournet says of the older A professional Tour Director
remained the same over decades them in years,” Fournet says of the older
recordings, which likely include vocaliza- guides you from start to finish.
recordings, which likely include vocaliza-
Recently coined words such as “selfie” tions of the great-grandmothers and great-
Recently coined words such s uch as “selfie” tions of the great-grandmothers and great- Discover why smart shoppers
and “hangry” reflect humans’ evolving lan- grandfathers of juvenile whales alive today.
and “hangry” reflect humans’ evolving lan- grandfathers of juvenile whales alive today. and experienced travelers choose
guage. The communication patterns of By analyzing the duration and frequency
guage. The communication patterns of By analyzing the duration and frequency Caravan. Enjoy a well-earned,
other social animals, including whales, also of the calls, the researchers grouped them
other social animals, including whales, also of the calls, the researchers grouped them worry-free Panama vacation.
vary over time. The “songs” adult male into 16 types. Fournet and her team detect-
vary over time. The “songs” adult male into 16 types. Fournet and her team detect- Call now for choice dates.
humpback whales produce during the ed 12 of them in both the earliest and most
humpback whales produce during the ed 12 of them in both the earliest and most Happy Travels!
breeding season, for example, are con- recent recordings—and each of the 16 call
breeding season, for example, are con- recent recordings—and each of the 16 call
stantly changing. types recurred over at least three decades,
stantly changing. types recurred over at least three decades,
But in a new study, researchers investi- the scientists reported last September in
“ ”
But in a new study, researchers investi- the scientists reported last September in
gated the permanence of nonsong whale Scientific Reports. This finding led Fournet to Brilliant, Affordable Pricing
gated the permanence of nonsong whale SScientific
cientific Reports.
Reports. This finding led Fournet to
vocalizations known as calls and found that conclude that these particular vocalizations —Arthur Frommer, Travel Editor
vocalizations known as calls and found that conclude that these particular vocalizations
the majority have remained stable over most likely are essential to the whales’ sur-
the majority have remained stable over most likely are essential to the whales’ sur-
multiple decades. This surprising result sug- vival, ensuring foraging success and social Choose Your Fully Guided Tour
multiple decades. This surprising result sug- vival, ensuring foraging success and social
gests that calls may function as important contact. “For calls to stay in the [collective] 10 days Guatemala with Tikal
gests that calls may function as important contact. “For calls to stay in the [collective] 9 days Costa Rica
tools for conveying information about for- conversation for so long is an indication
tools for conveying information about for- conversation for so long is an indication 8 days Panama & Canal Cruise
aging, social behaviors and whale identity. that these call types are vital to the life his-
aging, social behaviors and whale identity. that these call types are vital to the life his- 10 days Nova Scotia, P. E. Island
Scientists have studied humpback tories of humpback whales,” she says.
Scientists have studied humpback tories of humpback whales,” she says. 9 days Canadian Rockies, Glacier
whale songs extensively—but there is This work provides “rare and very valu-
whale songs extensively—but there is This work provides “rare and very valu- 9 days California Coast, Yosemite
probably a lot more to these creatures’ able insights into the evolution of animal
probably a lot more to these creatures’ able insights into the evolution of animal 8 days Grand Canyon, Bryce, Zion
communication than we know, says communication systems,” says Volker
communication than we know, says communication systems,” says Volker 8 days Yellowstone, Mt. Rushmore
Michelle Fournet, a marine ecologist now Deecke, a biologist at the University of
Michelle Fournet, a marine ecologist now Deecke, a biologist at the University
the University of 8 days New England Fall Foliage
at Cornell University and lead author of the Cumbria in England, who was not involved
at Cornell University and lead author of the Cumbria in England, who was not involved
new study. “The running hypothesis in the research.
new study. “The running hypothesis in the research. FREE Tour Catalog
is that any time the whales are talking Next summer Fournet plans to travel
is that any time the whales are talking
about something other than breeding,
Next summer Fournet plans to travel
to southeastern Alaska to play back record- 1-800-CARAVAN
Images
Caravan.com
about something other than breeding, to southeastern Alaska to play back record-
Images
they’re using calls,” explains Fournet, who ings of calls to humpbacks there. The goal
Getty
they’re using calls,” explains Fournet, who ings of calls to humpbacks there. The goal
completed the work while at Oregon State is to test theories about the functions
G etty
Getty
MIGNON
completed the work while at Oregon State is to test theories about the functions
University. These vocalizations, which typi- of different calls, she says, adding, “We’re
MIGNON
University. These vocalizations, which typi- of different calls, she says, adding, “We’re
cally last only a few seconds, are extremely going to go and start the conversation.”
VANESSA
cally last only a few seconds, are extremely going to go and start the conversation.”
VANESSA
diverse and have evocative names such as —Katherine Kornei Fully Guided Tours Since 1952
diverse and have evocative names such as — —K atherine Kornei
Katherine Kornei
Eyes of
the Peloton
Visual cues govern cyclists’
pack behavior
etty Images
sea Warfare Center and Tadd Truscott of see that pattern inside a group. Aerodynam- and their colleagues noticed two behaviors
Utah State University have found that visu- ics only matters at the outside edge—you that caused fluidlike ripples through the
JEFF PACHOUD G
al input plays a critical role in how cyclists save energy wherever you are inside a pack.” peloton. In one, a rider would brake and
position themselves within the pack: indi- Previous studies in animals ranging from other riders would slow to avoid a collision.
viduals subconsciously form a diamond- locusts to birds suggested that vision helps to In the other, a rider would move sideways
E C O LO G Y
Zombie
Spiders
Parasitic wasp larvae
make arachnid hosts
build their own tombs
that stick out of it vertically. “It could be This parasitic puppet master camps out Scientists do not know how a wasp larva
Estimated Abundances of
BIOLOGY
Microbial Cells by Environment
Microbial Dark Matter
Most microorganisms have never been studied in a laboratory
Just as most of the matter in the universe is thought to be “dark matter,” much
of Earth is populated by a kind of microbial analogue: microorganisms that are
known to exist but have never been grown in a laboratory. Marine sediment
A new study, published last September in mSystems, suggests such microbes 2,900 × 1026 cells
could account for up to 81 percent of all bacterial genera that live outside the
human body. These little-known organisms could hold the secrets to new tools
for treating disease and could help us understand life in extreme environments,
such as those on other planets.
Microbes are the most abundant life-form on Earth. Researchers have
sequenced the DNA of many species out in the field, but they can be difficult to
culture in the lab, and scientists usually grow only one species at a time to study
them in a controlled setting. To determine how much microbial dark matter
exists, Karen Lloyd, a microbiologist at the University of Tennessee, Knoxville,
and her colleagues compared all known microbial DNA sequences with the sub-
set from species that have already been cultured. They then inferred the fraction
of microbes that have been sequenced but never cultured (graphic). “We’re dis-
covering numerically that so many of the microbes on Earth are things we have
Soil
never really learned anything about,” Lloyd says. 2,560 × 1026 cells
The sheer number of microbial species—possibly close to a trillion—means
that scientists cannot possibly collect them all. Many species exist in hard-to-
reach places, such as at the bottom of the ocean or under frozen Arctic soil. Fur-
thermore, not all microbes can survive in cultures designed to nurture just one
strain. Some can grow only in a far more complex, natural environment, notes
environmental microbiologist Laura Hug of the University of Waterloo in Ontar-
io, who was not involved in the study. “They get what they need from their com-
munity,” she says, “so that means you can’t really grow them on their own.”
But Lloyd is optimistic. “We have made great strides with just the known
microbes, and there are potentially even more discoveries hidden in these [unknown
ones],” she says. “It leaves open the possibility for really grand discoveries.”
—Dana Najjar
Terrestrial subsurface
2,500 × 1026 cells
Or ly
Fa s
ma
Cla r
ylu
nu
ss
de
ec
mi
ng
PHYSIC S
should tick at a more slug-
NICARAGUA BRAZIL
IN THE NEWS Government authorities used deadly force against A metropolis of at least 200 million active termite
THAILAND
PERU Thai lawmakers voted to pass
Scientists excavated the an amendment that legalizes
skeletons of more than the medical use of marijuana and
140 children and 200 baby kratom, a tropical tree native to
llamas from part of Peru’s Southeast Asia that is traditionally
northern coast, in what they consumed for its stimulant and
think may have been the painkiller properties.
world’s largest known child
sacrifice. They believe the SINGAPORE
ritual slaughter took place Researchers used a bacteria-
550 years ago in an attempt to infecting virus to manufacture tiny
combat rising sea tempera wires in a computer’s memory.
tures and coastal flooding. INDONESIA This advance makes it possible to
Before-and-after radar images show that a flank of Indo move data from memory to a hard
nesia’s Anak Krakatau volcano disappeared—possibly in drive in nanoseconds instead of
For more details, visit a landslide—during an eruption. This may have triggered milliseconds, which could help
www.ScientificAmerican.com/
mar2019/advances the tsunami that killed hundreds of people last December. create faster supercomputers.
ing brain function in only that spot. approach could also be used to deliver psy-
Results from experiments in rats chiatric drugs to specifi
specificc brain areas, poten-
showed the action of the drug—an anes- tially reducing side eff ects and improving
effects
FFRF is a 501(c)(3) educational charity.
thetic—was limited to a three-millimeter effi cacy. “The mind boggles with the range
efficacy.
cube where the beam was focused. The of possibilities,” Airan says.
says. — —SSimon Makin
Deductible for income tax purposes.
imon Makin
and men drank 0.8 gram (that is equivalent people with blood alcohol concentrations least make us more interested in what
to 3.75 glasses of wine for a 70-kilogram of 0.08 or higher—the legal limit for driving intoxicated witnesses have to say,” Hilde Hilde-
woman or four glasses for a man of the in most of the U.S. (Intoxication levels varied brand Karlén says, “and perhaps take them
same weight, Hildebrand Karlén says). because different
different people metabolize alcohol a bit more seriously.”
seriously.” —A
— gata Boxe
Agata Boxe
© 2019 Scientific American
Vital Organs? gans extracted before age nine were found to have a twofold to
threefold higher rate of upper respiratory diseases and higher
rates of allergies and asthma. Notably they suffered more frequent-
From the appendix to the tonsils, ly from ear infections and, in the case of adenotonsillectomies,
sinus infections—conditions thought to be helped by surgery.
there are no truly expendable body parts We have known for a long time that the adenoids and tonsils
By Claudia Wallis “act as a first line of defense against pathogens that enter through
the airways or eating,” says Sean Byars, a senior research fellow
Medicine has not always shown a lot of respect for the human at the Melbourne School of Population and Global Health and
body. Just think about the ghoulish disregard early surgeons had lead author of the paper. The fact that these tissues are most
for our corporeal integrity. They poked holes in the skull and prominent in children, with the adenoids nearly gone by adult-
copiously drained blood with leeches or lancets—a practice that hood, has bolstered the view that they are not essential, but as
remained a medical mainstay through the late 19th century. Byars points out, “maybe there’s a reason they are largest in child-
Even today many of the most popular surgeries involve the hood.” Perhaps they play a developmental role, helping to shape
wholesale removal of body parts—the appendix, gallbladder, the immune system in ways that have lasting consequences.
tonsils, uterus (usually after the childbearing years)—with an Byars cautions that his study, large though it is, awaits confir-
assurance that patients will do just fine without them. There are mation by others and that the decision to treat any given child
many valid reasons for these “ectomies,” but what has become must be made on an individual basis. Still, he says, “Given these
increasingly less defensible is the idea that losing these organs is are some of the most common surgeries in childhood, our results
of little or no consequence. suggest a conservative approach would be wise.”
Take the appendix. Or rather leave it be, if possible. Many of us It is worth noting that tonsillectomy rates have declined in the
learned in school that this tiny, fingerlike projection off the colon U.S., especially since the heyday in the mid-20th century. Sur-
is a useless, vestigial remnant of our evolution, much like the puny geons are also doing fewer hysterectomies, reflecting a growing
leg bones found in some snakes. But that idea has been debunked, view that the uterus does not outlive its usefulness once child-
says evolutionary biologist Heather Smith, director of Anatomi- bearing is done and that there are less drastic ways to address
cal Laboratories at Midwestern University in Arizona. A 2017 common issues such as fibroid tumors.
study led by Smith reviewed data on 533 species of mammals and So are any human body parts truly useless or vestigial? Per-
found that the appendix appears across multiple, unrelated spe- haps the best case can be made for the wisdom teeth. “Our faces
cies. “This suggests there’s some good reason to have it,” she says. are so flat, compared with other primates, that there’s often not
The reason appears to be immunological and gastrointestinal. room for them,” Smith observes. And given how we butcher and
In all species that have an appendix, Smith notes, it either contains cook our food, “we really don’t need them.”
And the Laptop If there was ever a path to business success in music, it would
seem that technology has closed it off. But here’s the thing: tech-
Played On
nology is a lways roiling the music world. At the end of the 19th
century, publishers worried that the phonograph would slash
sales of sheet music, and it eventually did. But music flourished
anyway, as the phonograph itself helped give birth to new genres,
Technology is upending such as jazz. Today changes in the technology of music produc-
how music gets made tion and distribution are once again forcing musicians to find
new ways to make money. But they’re not impeding music cre-
By Wade Roush
ation—just the opposite.
Even for Jimi Hendrix, t he guitarist who used feedback and dis- I saw that at Mmmmaven, an electronic music academy in my
tortion to build sounds the world had never heard before, it hometown of Cambridge, Mass. When I visited this year, stu-
wasn’t easy to break into the music business. He joined his first dents were abuzz over recent upgrades to a popular sequencer
band in 1958 and spent years as a touring and backup musician program called Ableton Live. It was born in the early 2000s as a
before releasing his first hit record in 1966. By the late 1960s tool for live looping, or repeating a sampled section of music dur-
Hendrix was headlining top music festivals such as Woodstock, ing a live performance. But today, in combination with its chess-
where he earned more than any other performer. He died in boardlike Push controller, it’s changing what it means to write,
1970, but by then he had blazed a path to stardom and wealth record and perform music. DJs use Ableton to orchestrate all-
that other pop artists would follow for three decades. night sets of electronic dance music, or EDM. And producers
Next came the Napster Apocalypse. U.S. music revenues such as Jon Hopkins use it to synthesize haunting new sounds
peaked at $15 billion in 1999 and then contracted as peer-to-peer and assemble them into full songs. Hopkins’s 2018 release
sharing of MP3s undercut the need to buy music. The bleeding “Luminous Beings” opens with “a kind of psychedelic feedback
slowed, beginning in 2003, when Apple introduced the iTunes experience..., bounced down and pitched and distorted” in Able-
Store, and streaming services such as Spotify, Apple Music and ton, he told the podcast Song Exploder.
Pandora finally stopped it in 2016. But today, unless your name What really had Mmmmaven students “freaking out,” accord-
is Drake or Beyoncé, you have to make do with literal micropay- ing to the academy’s co-founder, David Day, was a collaboration
ments for your music. Drummer Damon Krukowski (of the feature called Link. “You can work on the same piece of music at
bands Galaxie 500 and Damon & Naomi) has written that “it the same time, in real time,” from different computers, Day
would take songwriting royalties for roughly 312,000 plays on explained. “So if I’m working with another user, and they up the
Pandora to earn us the profit of one—one—LP sale.” tempo, it ups my tempo. If they add a bass line, it adds it to my
bass line. That is your future of music, right there. Everyone’s a
musician. All we hear is new music, and it’s from u s.”
Thanks to these user-friendly digital tools, there’s more new
music to sample than ever. The EDM club scene is booming in cit-
ies around the world. And the emergence of online platforms
such as SoundCloud, Beatport, YouTube and Bandcamp is help-
ing more independent music producers find fans, who then buy
digital tracks, merchandise and tickets to live gigs. Bandcamp
alone reports that 600,000 artists have sold tunes through its site.
In the big picture, it’s true, album sales are still dropping. The
producer lifestyle, with its incessant travel and long club nights,
is punishing. The studio session and concert backup jobs that
used to help many musicians pay the rent are going away, Kru-
kowski told me, as top stars realize that they can use computers
to record and perform without bands. Concerts, merchandise
sales and crowdfunding can bring in revenue, but they may nev-
er replace the losses from the recording industry’s implosion.
As always, music is a precarious career. But what’s encourag-
ing is that digital technology is drawing in a new generation of
music makers, who are using it to create their own brands of psy-
chedelic feedback. The spirit of Hendrix lives.
J O I N T H E C O N V E R S AT I O N O N L I N E
Visit Scientific American on Facebook and Twitter
or send a letter to the editor: editors@sciam.com
LIVES OF
NEUTRON
STARS
The insides of neutron stars—the densest form
of matter in the universe—have long been a mystery,
but it is one that scientists are starting to crack
W
By Clara Moskowitz
Illustration by FOREAL
hen a star the size of 20 suns dies, it becomes, in the words of astrophysicist
Zaven Arzoumanian, “the most outrageous object that most people have never
heard of”—a city-size body of improbable density known as a neutron star. A chunk
of neutron star the size of a Ping-Pong ball would weigh more than a billion met-
ric tons. Below the star’s surface, under the crush of gravity, protons and electrons
melt into one another to form a bulk of mostly neutrons—hence the name. At least,
that is what we think. The issue is far from settled. Astronomers have never seen a
neutron star up close, and no laboratory on works at nasa’s Goddard Space Flight Center.
Earth can create anything even approaching the They are also the most strongly gravitating form
same density, so the inner structure of these of matter known—add just a bit more mass, and
objects is one of the greatest mysteries in space. they would be black holes, which are not matter
“They are matter at the highest stable density at all but rather purely curved space. “What goes
that nature allows, in a configuration that we on at that threshold,” Arzoumanian says, “is
don’t understand,” says Arzoumanian, who what we’re trying to explore.”
up and down, are found in atoms. The rest of the flavors steadily monitors several dozen pulsars spread across
are so massive and unstable that they usually appear the sky, detecting x-ray photons from them. By measur-
only as short-lived detritus from high-energy particle ing the photons’ timing and energy, as well as how the
Cooper pair
s d Up quark
u
u d
s
d u
s
Hyperon
stars’ gravitational fields bend their light, NICER CRASH SITE DETECTIVES
allows scientists to calculate the masses and radii of a Studying individual n eutron stars can tell us a lot, but
collection of pulsars and compare them. “If NICER we can learn much more when two of them slam to
finds stars with roughly the same mass but very differ- gether. For years telescopes have detected blasts of
ent radii, that would mean there’s something funny light, called gamma-ray bursts, that researchers sus-
going on,” Alford says, “some new form of matter that, pected came from a crash of two neutron stars. In the
when it appears, makes the stars shrink down.” Such a August 2017 detection of gravitational waves, astrono-
transition could occur, for instance, when neutrons mers saw the first confirmed neutron star merger.
break apart into quarks and gluons. Specifically, on August 17, 2017, two experiments—
Measuring the sizes of neutron stars is a useful way the Laser Interferometer Gravitational-wave Observato-
to narrow the range of possible forms that matter in ry, or LIGO (based in Washington State and Louisiana),
side neutron stars can take. Scientists once thought and Virgo (a European project based near Pisa, Italy)—
half the neutrons in any given neutron star would simultaneously detected gravitational ripples produced
turn into hyperons that contained strange quarks; as two neutron stars spiraled toward each other and
theoretical calculations suggested that such a hyper- merged to form either a single neutron star or a black
on-rich star could not exceed 1.5 times the mass of hole. This was not the first detection of gravitational
the sun. In 2010, however, astronomers led by Paul waves, but all the previous sightings were created by the
Demorest of the National Radio Astronomy Observa- collisions of two black holes. Before this date, scientists
tory measured the mass of one neutron star at 1.97 had never observed waves coming from neutrons stars,
solar masses, eliminating a number of theories about and this was also the first time that telescopes had
the interior of a neutron star. Now physicists estimate responded to a gravitational-wave detection and seen
that hyperons cannot make up more than 10 percent light coming from the same place in the sky at the same
of a neutron star. time. The light and waves together provided a bounty of
ORCAS a re among
the many species now
understood to experience grief.
D EFINING GRIEF
The study of animal grief is still sufficiently new that investigators
continue to wrestle with how to recognize it. In 2017, within the
small mountain city of Prescott, Ariz., an adult female collared
peccary—one of a small herd of five of the piglike mammals, also
known as javelinas—died. Over the next 10 days the herd mates of
this individual visited, ate near, slept right up against her body and
protected it from predators. This prolonged response to death was
recorded by a motion-sensitive wildlife camera, a birthday present
swam with the tiny body on her head and to then third grade student Dante de Kort, who set it up two days
after he noticed the peccary corpse near his home. When de Kort
made deep dives to retrieve it when it slipped
shared images of the animals’ behavior at his school’s science fair
off. Other members of her pod registered her the next month, he met biologist Mariana Altrichter of Prescott
distress: at one point, a group of females gath- College. That serendipitous encounter between the boy and the
researcher led to the publication of an article on the peccaries in
ered in a tight circle around J35, an act of
the February 2018 issue of the journal Ethology (de Kort was the
apparent emotional attunement that lasted at lead author) and to a renewed conversation among scientists
least two hours. Seventeen days and 1,000 about the definition and scope of grief in the animal kingdom.
De Kort had stationed his camera five meters from the body of
miles passed before J35 finally released her
the female peccary and set it to take 10-second-long films at inter-
daughter’s corpse for good. vals of 30 seconds. It captured 93 videos with peccaries in them.
For roughly half of the recorded time, herd members walked or
J35’s response to her calf’s death was a powerful reminder that stood within five meters of the dead individual. And for more
humans are not the only species that experiences grief. For decades than a third of the time, they contacted the body directly. At vari-
animal behavior experts were wary of ascribing that emotion to ous points, they nuzzled, smelled, stared at, bit and tried to lift up
other species. But our thinking has shifted as new evidence has the dead body. They also slept in direct contact with it and de-
come to light. Six years ago I wrote about the then nascent field of fended it from coyotes. In nearly half of the recorded time, the
animal grief for Scientific American. S ince then, the number of same two peccaries (at least, probably the same two, according to
case studies has exploded. Some, such as the example of J35, cap- best efforts to identify individuals) were present at the body.
ture fresh and poignant details from species already known to In their paper, de Kort and his co-authors noted that the pec-
mourn; others document the phenomenon in new species. caries’ responses expanded the behavioral complexity known for
Together these findings are yielding fascinating insights into this group and showed that they resembled humans and chim-
the origins of grief. Previously it seemed that bereavement was as- panzees in their reaction to death. But the scientists stopped
sociated with large-brained mammals—namely, primates, ele- short of calling the reaction grief. In fact, they stated that they
phants and cetaceans. But the latest evidence indicates otherwise. “cannot determine if there is grieving.”
Brainy mammals may grieve in more nuanced ways than some Peccaries belong to the artiodactyl branch of the mammal
PRECEDING PAGES: FRANCO BANFI G etty Images
other animals because of their advanced abilities to reason and family tree. Other members of this group include sheep and ante-
IN BRIEF
Scientists have traditionally b een reluctant In recent years, however, evidence for animal grief These findings suggestthat multiple factors deter-
to attribute human emotions, including grief, has accumulated. A wide variety of animals have mine whether or not a species exhibits emotional
to species other than our own. been found to mourn the loss of close companions. responses to death.
lopes. Little is known about grief in artiodactyls. But the peccaries’ ences. By using the term “emotion,” I do not mean to imply that
behavior closely matches the criteria for grief I set forth in my animals are unaware of their own grief, though. In the frame-
2013 book How Animals Grieve: Survivors alter their behavior in work I am using, common in anthropology and developmental
the wake of a death in significant ways that indicate intense dis- psychology, perception and processing of stimuli in brain circuits
tress. Depending on the species, these changes may include atyp- do prepare an individual to express an emotion, but that emotion
ical patterns of eating or sleeping; withdrawal from social activi- emerges in the context of an unfolding event between social part-
ties; and expression of upset at or near the body through vocaliza- ners. It is expressed by animals who are conscious, aware beings.
tions, facial expressions or body language. For this reason, I would be surprised if researchers were to ob-
Can we state with absolute certainty that the peccaries, or serve grief in social insects, such as ants, termites and bees, that
some of the peccaries, were grieving, as opposed to exhibiting a retrieve and even sometimes bury corpses of dead companions
generalized distress about a change in the dynamics of their entirely through a system of chemical signaling, as opposed to
herd? No. My definition of grief relies on interpretation of cues conscious decision-making.
made visible to us by individual animals, and in this practice,
there is inevitably room for error because we cannot read ani- H EARTBREAK ALL AROUND
mals’ minds or know their intentions. Yet given that we know The peccaries provide strong evidence t hat the capacity for grief
peccaries form small, cohesive groups characterized mainly by is not limited to large-brained animals. But they are not the only
cooperation and friendly interactions such as grooming, I find it species to do so.
just as risky to dismiss the strong likelihood of a grief response. In Film taken at the Donkey Farm Foundation sanctuary in the
an e-mail to me, Altrichter explained that she and her colleagues Netherlands shows distressed donkeys milling around and emit-
did not want to interpret the emotional aspect of the peccaries’ ting startlingly loud vocal calls at the body of an old male donkey
behavior in their paper, preferring to stick to reporting the ob- laid out on the ground. A sorrowful donkey was also the subject of a
servable facts. But she allowed that the creatures’ response report sent to me earlier in 2018 from the Farm Animal Rescue and
“meets a reasonable definition of grief for nonhuman animals.” Rehoming Movement (FARRM) animal sanctuary in Alberta, Can-
In the field of animal behavior, or ethology, the reluctance to ada. Founder Melissa Foley and volunteer Stephanie Belland were
claim grief outright in the peer-reviewed scientific literature concerned that a resident donkey named Lena was having great
stems from the discipline’s long history of bringing charges of trouble recovering from the death of the horse Jake, with whom
anthropomorphism—the projection of human qualities or capac- she had been very close for three years. When at 32 years of age
ities onto other species—against scientists who venture into the Jake fell gravely ill, a vet put him down. That first night Jake’s body
CENTER FOR WHALE RESEARCH w haleresearch.com
realm of animal emotion. Those charges are sometimes still lev- lay under a tarp until he could be buried, but Lena tore the cover-
eled within the scientific community today. Yet it turns out that it ings off. “Throughout the night, Lena circled and refused to leave,”
is the science of animal behavior itself that shows we humans Foley and Belland recalled. “When we buried Jake the next day, she
have no monopoly on the expression of sorrow (or, for that mat- followed his body to the hole we had dug and remained standing
ter, its opposite: joy) in the animal kingdom. over his grave for days, pawing at the dirt and braying throughout
A clarification on terminology is key here. In the field of neu- the night. She refused to leave even for food and water.”
roscience, “emotion” is a body state triggered by external stimuli, This description brought tears to my eyes. Over the next weeks
whereas “feeling” is a mental state that accompanies the changes Lena began to recover; she gradually resumed normal eating and
in body state. In this scheme, feelings are the conscious experi- drinking and sought out the company of other horses. Perhaps
Royal Society B d evoted to animal and human responses to death, adult male with whom Thomas had forged a friendship, visited
Claire F. I. Watson and Tetsuro Matsuzawa, both at Kyoto Univer- and inspected the body more often than the other two males did
sity’s Primate Research Institute in Japan, observed that most re- and displayed energetically around the body. Noel, an adult fe-
ports about responses to death in mammals to date concern male who had adopted Thomas in the wake of his mother’s death,
mothers and their dead offspring. This is true. But there are some did something never before observed in chimpanzees: she
interesting exceptions to this rule. cleaned Thomas’s teeth using a grass tool. Noel persisted in this
HUNDREDS OF
THOUSANDS OF PEOPLE
EXPERIENCE MANIA
WITHOUT EVER
GETTING DEPRESSED.
WHY DOES PSYCHIATRY
INSIST ON CALLING
THEM BIPOLAR?
By Simon Makin
HE
IN BRIEF
Mania usually occurs with depressive episodes Evidence to justify s eparate diagnoses for Some researchers recommend defining unipolar
as part of bipolar disorder. Yet some bipolar unipolar mania and bipolar disorder has been mania as an official subtype of bipolar disorder
patients experience only mania, raising the elusive, but studies hinting at measurable to raise awareness and facilitate further research
question of whether another diagnosis is needed. differences are starting to emerge. into what distinguishes it.
polar treatment, the anticonvulsant Depakote (divalproex sodi- Unipolar Mania: A Distinct Entity? O lcay Yazıcı in Journal of Affective Disorders,
um), was no different. Vols. 152–154, pages 52–56; January 2014.
Madness May Enrich Your Life: A Self-Study of Unipolar Mood Elevation. David Y. F.
The researchers next grouped all 121 patients according to Ho in Psychosis, V
ol. 8, No. 2, pages 180–185; 2016.
whether the majority of their episodes were manic or depressive Differences between Unipolar Mania and Bipolar-I Disorder: Evidence from Nine
and then created a further division of patients whose manic epi- Epidemiological Studies. Jules Angst et al. in Bipolar Disorders. Published online
sodes accounted for at least 80 percent of the total. A smaller per- November 2018.
centage of patients who had at least a majority of manic episodes FROM OUR ARCHIVES
responded to lithium than patients who had more depressive ep- Mental Illness Overlap. Mark Fischetti and Martin Krzywinski; Graphic Science, July 2018.
isodes did, and this difference was greater for patients whose ma-
s c i e n t if i c a m e r i c a n . c o m /m a g a zi n e /s a
nia put them in the 80 percent group. Most tellingly, when those
AMPLIFIER
Strange waves in the jet stream foretell a future
full of heat waves and floods
By Michael E. Mann
Is it coincidence that the most devastating summer weather R OSSBY BRINGS BAD WEATHER
has occurred in recent decades? My colleagues and I do not think The jet stream forms where warm surface air from the subtropics
so. All these events had a striking feature in common: a very around the globe moves northward and meets cold surface air from
unusual pattern in the jet stream. The jet stream is a narrow band the polar region—roughly where the U.S. meets Canada. The jet
of strong wind that blows west to east around the Northern Hemi- blows at around 35,000 feet up, along the boundary between the
sphere, generally along the U.S.-Canada border, continuing across troposphere (the lowest level of the atmosphere, where weather
the Atlantic Ocean, Europe and Asia. The band is sometimes fair- happens) and the stratosphere (the next level, where airliners fly).
ly straight, but it can take on big bends—shaped like an S lying on The greater the temperature difference when the subtropical
its side. It typically curls northward from the Pacific Ocean into and polar air meet, the stronger the jet stream wind. During sum-
western Canada, then turns southward across the U.S. Midwest, mer the temperature difference is less than during winter, so the
then back up toward Nova Scotia. This shape usually proceeds jet stream is weaker. When it weakens, it is more likely to exhibit
west to east across the U.S. in a few days, bringing warm air north broad north-south bends.
or cool air south and creating areas of rain or snow, especially But why do the bends form where they do? The jet stream is
near the bends. The jet stream controls our daily weather. affected by a set of large waves that waft through the atmosphere,
During the extreme events I noted, the jet stream acted created naturally as the earth rotates through a fluid—in this case,
strangely. The bends went exceptionally far north and south, and air. They are Rossby waves, named after Swedish-American mete-
they stalled—they did not progress eastward. The larger these orologist Carl-Gustaf Rossby, who first explained in the 1930s the
bends, the more punishing the weather gets near the northern physics of large-scale atmospheric motions. They occur through-
peak and southern trough. And when they stall—as they did over out the oceans, too.
the U.S. in the summer of 2018—those regions can receive heavy Rossby waves in the atmosphere extend for hundreds of miles
rain day after day or get baked by the sun day after day. Record and move west to east in the Northern Hemisphere. When the
floods, droughts, heat waves and wildfires occur. temperature difference between the air masses decreases in sum-
My collaborators and I have recently shown that these highly mer, the Rossby waves tend to bend more and proceed more slow-
curved, stalled wave patterns have become more common because ly from west to east over North America. The jet stream follows
of global warming, boosting extreme weather. But we predict that the shape and path of those waves.
the rising severity may level off for the next several decades. That Other waves also course through the atmosphere and the
may sound strangely “good”—the bad spells will continue, but at ocean. For example, gravity waves arise from a temporary dis-
PRECEDING PAGES: JOSH EDELSON Getty Images
least they will not get worse. We also predict that the extreme turbance between gravity pulling the atmosphere down and
IN BRIEF
When the jet stream’s shape b ecomes highly bent, Mathematics from quantum mechanics e xplains Through about 2050, a erosols in the air from coal
it can bring heavy summer rain or heat. And if the how resonance in the atmosphere can amplify the plants will slow the increasing severity, but as the
jet stalls, the bad weather can continue for days. bends, making harsh weather even worse. plants install scrubbers, the intensity will rise again.
with record heat, dryness and wildfires and, downstream of it, a T HE QUANTUM CONNECTION
deep trough over Pakistan associated with record flooding. Understanding how the behavior of an atmospheric wave is math-
The amplitude that routine Rossby waves can attain is limited ematically similar to the behavior of an electron will help reveal a
by the energy they radiate away as they bend north and south key reason why droughts and floods are getting worse.
and as they proceed eastward. Under certain conditions, howev- In classical physics, an electron can become trapped when it is
Hadley cell 5
Ferrel cell
Polar cell
0
Equator 30°N 60°N North Pole
Earth’s rotation
Low-pressure system
Rossby wave pattern
High-pressure system
46 Scientific American, March 2019 Illustration by 5W Infographics (globes) and Jen Christiansen (waveguides)
B Quantum Physics
High energy Modest energy
Infinite walls represent a Finite walls represent a
high-energy barrier that acts modest-energy barrier that
as a strong waveguide 0 acts as a weak waveguide
Destructive Day
Storms Resonate A resonating jet stream, stalled during late July and early August 2018,
Large Rossby waves, and the jet stream bends that track them, can get touched off or magnified extreme weather around the planet.
stuck in place, forming a standing wave. The atmosphere can then act On July 22, heat waves and droughts gripped several regions and
as a waveguide (red lines), which encourages the bends to resonate and aggravated wildfires, while heavy flooding occurred in other areas.
amplify, reaching even farther north and south (shown). The weather
systems become intense and get locked in place for days. The situation
arises more commonly in summer than winter.
Heat wave
in Japan
July 22,
California
wildfires 2018
Heat wave
in Scandinavia
Heat wave in
Waveguide
Southwest U.S.
Heavy flooding
rains in mid-
Atlantic U.S.
surrounded by high potential energy. Imag- PARCHED SUNFLOWERS ( 1) ation, the waves can grow in amplitude
ine looking though a box from the side, and stunted seeds (2) near Golssen, because of QRA. Stuck in place, the now
with walls that are infinitely high. The elec- Germany, were wrought by huge standing wave creates extreme
tron cannot pass through the walls, because a prolonged heat wave in 2018. weather systems inside the ridges and
they have infinitely high energy that cannot troughs that persist for days. The WKB
be overcome. The electron bounces back approximation, which leads to solutions
and forth, left to right, in a straight line. to waveguide problems in quantum mechanics, also helps to
In the quantum mechanics picture, things are different. The solve the Rossby waveguide problem.
electron no longer has a definite position. Instead the probability
of finding the electron is determined by the famous Schrödinger A CHANGING WAVE CLIMATE
equation, a wave equation. The motion of the electron—or more With this understanding, w e can now see how climate change is
precisely, the probability of where the electron is most likely to be affecting the standing waves that give us persistent weather
found—is described by a sinusoidal curve: an S laying down on its extremes. Several years ago Petoukhov and his Potsdam collabora-
side. Sound familiar? The electron acts in part like a particle and tors built on Karoly and Hoskins’s work, showing that waveguide
in part like a wave. conditions for standing Rossby waves arise primarily in summer.
Something interesting happens when the potential energy Often in summer, the jet stream is not a single, strong west-to-east
“walls” are not infinite in height but instead are finite. In that case, wind. It alternates between two corridors, one to the north and one
the electron has a small probability of actually penetrating the to the south of the typical location along the U.S.-Canada border.
wall, and it can pass all the way through it if the wall is thin enough. Using the WKB approximation, Petoukhov’s group showed
It is as if you hit a tennis ball against a concrete wall, and it “tun- that it is precisely under these “double-peak” jet conditions that
neled” through the wall and out the other side. The same probabil- the atmosphere can behave as a waveguide for Rossby waves with
ity pertains to the opposite wall. The electron is largely confined to a short wavelength. The amplitude of these waves is generally
the box but with just a bit of “leakage” across the boundaries. Wel- small: the bends do not extend very far north or south. But if an
come to the peculiar world of quantum mechanics. initial bend is generated when an air mass moving west to east
Looking through this finite box is the same as looking down hits the Rocky Mountains or the Alps or when it encounters a
the inside of a slightly leaky three-dimensional waveguide—like a strong surface temperature contrast at the boundary between
coaxial cable. The mathematical nugget that allows us to solve the land and ocean, the Rossby waves can readily grow much larger
equations that describe these objects was put forward in 1926, bends through the QRA mechanism.
known as the WKB approximation, after the three scientists who Whether conditions are favorable for QRA varies from year to
introduced it: Gregor Wentzel, Hendrik Kramers and Léon Bril year. They depend in large part on the north-south pattern of tem-
louin. The WKB approximation is used in quantum mechanics for perature variations in the lower atmosphere—something that cli-
lots of wave equations and to aid the design of products such as mate models resolve well. In 2017 my colleagues and I showed
the tunnel diode in your smartphone. that there has been a greater tendency in recent decades for con-
In the early 1980s David Karoly, now at Australia’s Common- ditions that favor QRA. Climate simulations show that the trend
wealth Scientific and Industrial Research Organization, and Bri- is driven by increases in greenhouse gas concentrations over time.
an Hoskins of the University of Reading in England demonstrat- Natural factors such as fluctuations in solar output and volcanic
ed that the atmosphere can behave like a waveguide for stalled, eruptions, as well as other human factors such as atmospheric
or standing, Rossby waves that have certain short wavelengths sulfur dioxide pollution in particular, have also played a role. The
(roughly the width of the continental U.S., or six to eight full simulations, called CMIP5, are the result of modeling by more
SEAN GALLUP G etty Images
wavelengths all the way around the Northern Hemisphere). than 50 groups worldwide done for the most recent report of the
The standing Rossby wave becomes trapped inside the wave- Intergovernmental Panel on Climate Change (IPCC).
guide, with only minimal leakage of energy through the north- Temperature data recorded at weather stations and the mod-
ern and southern boundaries—just like the electron. In this situ- els show that climate change is causing the Arctic to warm faster
UNTANGLING
ACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACT
CTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACT
CTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACT
CTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
New discoveries on ancient loops in DNA
ACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACT
CTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
THE
ACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACT
CTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACT
CTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACT
CTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
offer clues into gene regulation
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACT
CTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACT
GENOME
CTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACT
CTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACT
CTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACT
CTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGAC
By Erez Lieberman Aiden
ACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACT
CTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
Illustration by Traci Daberko
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG March 2019,
TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG ScientificAmerican.com 51
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACT
© 2019 Scientific American
CTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG TGACTGACTGACTGACTGACTGAC
ACTGACTGACTGACTGACTGACTGACTGACTGACTG ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGAC
B ecause I find it hard to relate to something as small
as the structure of the human genome, I like to imagine
it scaled up a millionfold. At this size, each DNA molecule—
a chromosome—is as wide as a ramen noodle. Laid end
to end, all 46 of the scaled-up chromosomes that compose
a cell’s genome would stretch from New York to Kansas
City, although they instead fold up to fit inside a structure
the size of a house—the cell nucleus. Collectively, the 46 chromosomes contain
two sets of roughly 20,000 genes. Each gene spells out a coded message telling
the cell how to make a particular protein; at the millionfold scale, a gene is
as long as a car.
A Four possible motif orientations B A growing loop is stabilized as cohesin Growing loop Stable loop
rings encounter two CTCF-binding motifs
pointing into the loop.
DNA CTCF-binding motif
Cell type 1
Cell type 2
Inactive CTCF-
binding motifs
Enhancer 1
Enhancer 2
Gene 2
Gene 1
Gene regulation may be DNA going in one ring and out the other. But then, the
two rings slide in opposite directions (one to the left
a side gig for loops; perhaps along the linear molecule and one to the right), extrud-
ing a growing loop as they go. They do not slide forever,
their maın function in cells though. Eventually one approaches a site where a CTCF
Baseless
theories
threaten our
safety and
democracy.
It turns out
that specific
emotions
make people
prone to such
thinking
By Melinda
Wenner Moyer
IN BRIEF
False conspiracy theories c an drive Anxious people a re especially drawn to You can spot hallmarks o f fake theories,
people to violence, as they did for the conspiratorial thinking, experiments such as internal contradictions in the
Pittsburgh synagogue shooter, and show, and the mindset is also triggered “evidence” and contentions based on
affect political activity. by a loss of control. shaky assumptions, psychologists say.
2 3 4
CONSPIRACY THEORISTS believe plots are behind many situations. Some hold that the Apollo moon landing was
faked (1), others that the White House forced Supreme Court Justice Anthony Kennedy to retire (2), and others that
Trump slogans on a mail bomber's van were put there to frame Republicans (3). The gunman who killed 11 synagogue
members in 2018 claimed a Jewish group was undermining America (4).
ple more willing to believe in conspiracies. Experi- political spectrum. A 2018 Pew Research Center sur-
ments have revealed that feelings of anxiety make vey found that the majority of both Democrats and
people think more conspiratorially. Such feelings, Republicans feel that “their side” in politics has been
along with a sense of disenfranchisement, currently losing in recent years on issues they find important.
grip many Americans, according to surveys. In such Such existential crises can promote conspiratorial
situations, a conspiracy theory can provide comfort thinking. In a 2015 study in the Netherlands, re
BRENDAN SMIALOWSKI G etty Images ( 2 ) ; ALAMY (3 ) ; JEFF SWENSEN G etty Images (4 )
by identifying a convenient scapegoat and thereby searchers split college students into three groups. Peo-
making the world seem more straightforward and ple in one group were primed to feel powerless. The
controllable. “People can assume that if these bad scientists asked them to recall and write about a time
guys weren’t there, then everything would be fine,” in their lives when they felt they were not in control of
Lewandowsky says. “Whereas if you don’t believe in the situation they were in. Those in a second group
a conspiracy theory, then you just have to say terri- were cued in the opposite direction. They were asked
ble things happen randomly.” to write about a time when they felt totally in control.
Discerning fact from fiction can be difficult, how- And still others, in a third group, were asked some-
ever, and some seemingly wild conspiracy ideas turn thing neutral: to describe what they had for dinner last
out to be true. The once scoffed at notion that Rus- night. Then the researchers asked all the groups how
sian nationals meddled in the 2016 presidential elec- they felt about the construction of a new subway line
tion is now supported by a slew of guilty pleas, evi- in Amsterdam that had been plagued by problems.
dence-based indictments and U.S. intelligence agency Students who had been primed to feel in control
conclusions. So how is one to know what to believe? were less likely than students in the other two groups
TOOL USERS
researchers have subfields focused on specific times, places or methods, ago. Given the lack of stone tool use among central or
begun to unearth but they have all had one central theme: understanding eastern chimpanzees (as seen at Gombe)—or among
the archaeological people. Nonhuman animals were a part of archaeologi- their sister species, bonobos (Pan paniscus)—it seems
records of these
PRECEDING PAGES: MARK M AC EWEN N
cal study but only as food, transport, pets or parasites. likely that the western population independently in-
other creatures. They orbited our world. vented stone use since that time.
Such investigations
Certainly this focus has produced extraordinary That discovery raised key questions about the ori-
stand to elucidate
the factors that achievements. For instance, in 2015 Sonia Harmand of gins of stone tools. Our common ancestor probably
governed the rise of Stony Brook University and her team stretched the used plant tools, just as wild chimpanzees and bonobos,
human and non known record of human behavior back to more than as well as orangutans and gorillas, do. But why did only
human technology. three million years ago when they found stone tools left a very few branches of the family tree look to stone as a
anthropocentric archaeology;
over and over again. In extreme cases, my team has seen
them use one stone hammer to crack and consume more
going forward, archaeology has than 60 oysters in a row.
Oysters are not the only food for which the macaques
all past behavior in its sights. need a utensil. Intertidal zones such as this one are rich with
animal life. Although the macaques prefer oysters, they are
also on the lookout for marine snails and crabs. Unlike oys-
an eternal present, with our view of them almost entirely derived ters, these prey can and do run away, so the monkeys gather them
from the past few decades. If we evaluated humans over the same up and take them to a nearby flat rock. They then find a much larg-
short time frame, we would gain very sparse understanding of er stone than the ones used for oyster pounding—the largest
how our technologies emerged and changed throughout our evo- weigh several kilograms—and use it to crush their food against the
lution. If we had to guess, would we consider chopsticks or cutlery flat rock, which serves as an anvil. When the group is midfeast, the
to best represent ancestral human eating tools? Is the PlayStation constant cracking and rapping sounds of stone on shell fill the air.
or Xbox the more primitive form of a human plaything? These The end result of these low-tide grab-and-smash raids is a
questions may seem slightly absurd, yet scientists often fail to con- shoreline strewn with broken shells and battered stones. The
sider whether past chimps behaved anything like those we see monkeys select their tools with skill and persistence, using
now. Were they less technologically proficient? Or more so? the pointed ends of small rocks to precisely hit the oysters and
Another central concern is that a two-way comparison offers the large central areas of the bigger rocks to pound open snails.
few clues as to why certain features developed in one lineage and These two main patterns of behavior damage the tools in predict-
not the other. For example, as early as the 1860s, English natural- able ways, and my colleagues and I have shown that how a ma-
ist John Lubbock (who coined the terms “Paleolithic” and “Neo- caque tool was used (and therefore its potential target prey) can
lithic” for chapters of the Stone Age) suggested that primate nut be determined from wear, which is readily distinguished from
cracking could be a simple precursor of the human tendency to scars seen on naturally modified stones. It is this characteristic
break stones against each other to create sharp-edged flakes for damage that I search for as I dig into the soft beach sands. The
cutting. If so, why do living chimpanzees not flake stones? Does small volcanic rocks that I have rescued from the tides bear the
the absence of this behavior stem from a lack of imagination, time oyster-processing marks. Although these artifacts do not push
or opportunity? Ideally we would have a much broader selection back the known antiquity of macaque tool use—the oldest ones
of case studies to test our hypotheses about the development of date to just 65 years ago—they are the first monkey tools ever
technology. This is where the monkeys I have been studying clam- found through archaeological excavation.
ber to our rescue.
CAPUCHINS AND CASHEWS
GAME OF STONES These macaques a re not the only monkeys that have left behind an
Back on the beach in Thailand, the bottom of the hole is now fill- archaeological record. Fast-forward to late 2014, and I am back
ing with water. It seeps in from the sides, threatening to undercut beside a square hole, but this time there is no sea breeze to allevi-
and destabilize the walls even further. I have rigged a boat pump ate the heat. Surrounding me are the scrub forests and towering
toric human shell middens, or rubbish heaps. The feedback cycle FROM OUR ARCHIVES
between these durable landscape markers and their attraction The New Origins of Technology. Kate Wong; May 2017.
for young animals learning to use tools may be a critical compo-
s c i e n t if i c a m e r i c a n . c o m /m a g a zi n e /s a
nent of technological traditions among sea otters, much like the
Lost Anatomies:
The Evolution of the Human Form
by John Gurche. Abrams, 2019 ($40)
Einstein. As his confidant and study partner during or who grieve dead companions (observed in ele statistic,” Strathdee writes. In a desperate attempt
his university days, Marić undoubtedly did contrib phants and other animals). Looking at the latest to save his life, the couple agreed to experiment
ute to Einstein’s development as a scientist. But the evidence from behavioral science, genetics and with a forgotten and mostly unregulated therapy:
authors find no evidence that she was a co-inventor paleoanthropology, Rutherford explores the the use of viruses to kill off the resistant bacterium.
FROM LOST ANATOMIES, ©
of relativity, as some have claimed. “Tragically,” ways that humans do differ from other animals Their account offers a fascinating and terrifying
they write, “she did not achieve her full potential as and whether we are indeed as special as we once peek into the devastating outcomes of antibiotic
a scientist . . . nor did she realize her hopes and believed. “Paradoxically,” he writes, the answer is misuse—and what happens when standard health
dreams in marriage and in life.” —Clara Moskowitz “both no and yes.” —Emiliano Rodríguez Mega care falls short. —E.R.M.
Big Data and cide for themselves what to do. As management consultant Peter
Drucker is credited with saying: “If you can’t measure it, you can’t
Oh, Chute
donned backpacks that contained no parachutes. All 23
leapt from either a plane or a helicopter. The jumpers were
assessed shortly after hitting the ground for death or major trau-
ma, and most were reevaluated 30 days later.
Someone finally did a study The authors wrote, “We have performed the first randomized
on the efficacy of parachutes clinical trial evaluating the efficacy of parachutes for preventing
death or major traumatic injury among individuals jumping from
By Steve Mirsky
aircraft. Our groundbreaking study found no statistically signifi-
The randomized controlled trial (RCT) i s often called the “gold cant difference in the primary outcome between the treatment
standard of evidence” in medical research involving humans. In and control arms.” Indeed, all members of both cohorts were fine.
such an experiment, a random sorting leads to only some sub- The researchers further note, “A minor caveat to our findings
jects getting the real intervention being tested. is that the rate of the primary outcome was substantially lower
The first known RCT took place in 1747, when Dr. James Lind, in this study than was anticipated ... [subjects] could have been
surgeon on the HMS Salisbury, staked out his place in history at lower risk of death or major trauma because they jumped
by giving some scurvy patients citrus fruits. At first, anyway. from an average altitude of 0.6 m [just under 2 feet] on aircraft
Then all the sailors got citrus, as it became obvious that scurvy moving at an average of 0 km/h.” As the reader suspected, the
was preventable through the inclusion in the diet of vitamin C aircraft were parked on the ground.
via consumption of oranges, lemons and—of key importance to The researchers also said, “Opponents of evidence-based med-
etymologists—limes, which led to all British sailors, and then all icine have frequently argued that no one would perform a ran-
Brits in general, to become known as Limeys. domized trial of parachute use. We have shown this argument to
Skip ahead a quarter of a millennium to 2003, when the B MJ, be flawed, having conclusively shown that it is possible to ran-
formerly known by its spelled-out name of the B ritish Medical domize participants to jumping from an aircraft with versus with-
Journal (and informally to some as the Limey Medical Journal), out parachutes (albeit under limited and specific scenarios).”
published an article entitled, “Parachute Use to Prevent Death By the way, no participants actually deployed their para-
and Major Trauma Related to Gravitational Challenge: System- chutes—if you throw around square yards of fabric and feet of
atic Review of Randomised Controlled Trials.” strings, somebody could get hurt.
The write-up was a response to a long-held criticism of RCTs,
JOIN T HE CONVERSAT ION ONLINE
namely, that you don’t need them to make reasonable conclu- Visit Scientific American on Facebook and Twitter
sions about certain effects of certain actions—such as jumping or send a letter to the editor: editors@sciam.com
MARCH
1969 Pollution
Heat
Alaska
Centuries ago cities designated 12 p.m. sync (multicolor map). This practice cre- 12 p.m.—which also means our clocks say
as the moment the sun reached its apex ates offsets, however, between solar noon sunrises and sunsets are later than our
overhead, known as solar noon. But by and clock noon. The offsets map (blue and ancestors experienced. The offset pattern
the late 1800s it had become inconve- red) reveals how much later (red) or earli- is similar in winter but less pronounced
nient for nearby municipalities to use er (blue) solar noon happens compared because daylight saving time, observed by
slightly different times. Countries adopt- with clock noon on the summer solstice. many nations, exaggerates the shift (inset
ed time zones so large regions would be in In most places, the sun peaks later than map of Europe).