FOOD MICROBIOLOGY

crossm

Exploring the Impacts of Postharvest

Processing on the Microbiota and
Metabolite Profiles during Green Coffee
Bean Production

Downloaded from http://aem.asm.org/ on May 2, 2020 by guest

Florac De Bruyn,a Sophia Jiyuan Zhang,a Vasileios Pothakos,a Julio Torres,b
Charles Lambot,b Alice V. Moroni,c Michael Callanan,c Wilbert Sybesma,c
Stefan Weckx,a Luc De Vuysta
Research Group of Industrial Microbiology and Food Biotechnology, Faculty of Sciences and Bioengineering
Sciences, Vrije Universiteit Brussel, Brussels, Belgiuma; Nestlé R&D Centre Tours, Tours, Franceb; Nestlé Research
Centre, Lausanne, Switzerlandc

ABSTRACT The postharvest treatment and processing of fresh coffee cherries can
impact the quality of the unroasted green coffee beans. In the present case study, Received 17 August 2016 Accepted 21
October 2016
freshly harvested Arabica coffee cherries were processed through two different wet
Accepted manuscript posted online 28
and dry methods to monitor differences in the microbial community structure and October 2016
in substrate and metabolite profiles. The changes were followed throughout the Citation De Bruyn F, Zhang SJ, Pothakos V,
postharvest processing chain, from harvest to drying, by implementing up-to-date Torres J, Lambot C, Moroni AV, Callanan M,
techniques, encompassing multiple-step metagenomic DNA extraction, high- Sybesma W, Weckx S, De Vuyst L. 2017.
Exploring the impacts of postharvest
throughput sequencing, and multiphasic metabolite target analysis. During wet pro- processing on the microbiota and metabolite
cessing, a cohort of lactic acid bacteria (i.e., Leuconostoc, Lactococcus, and Lactobacil- profiles during green coffee bean production.
lus) was the most commonly identified microbial group, along with enterobacteria Appl Environ Microbiol 83:e02398-16. https://
doi.org/10.1128/AEM.02398-16.
and yeasts (Pichia and Starmerella). Several of the metabolites associated with lactic
Editor Johanna Björkroth, University of Helsinki
acid bacterial metabolism (e.g., lactic acid, acetic acid, and mannitol) produced in Copyright © 2016 American Society for
the mucilage were also found in the endosperm. During dry processing, acetic acid Microbiology. All Rights Reserved.
bacteria (i.e., Acetobacter and Gluconobacter) were most abundant, along with Pichia Address correspondence to Luc De Vuyst,
and non-Pichia (Candida, Starmerella, and Saccharomycopsis) yeasts. Accumulation of ldvuyst@vub.ac.be.
F.D.B., S.J.Z., and V.P. contributed equally to this
associated metabolites (e.g., gluconic acid and sugar alcohols) took place in the dry-
article.
ing outer layers of the coffee cherries. Consequently, both wet and dry processing
methods significantly influenced the microbial community structures and hence the
composition of the final green coffee beans. This systematic approach to dissecting
the coffee ecosystem contributes to a deeper understanding of coffee processing
and might constitute a state-of-the-art framework for the further analysis and subse-
quent control of this complex biotechnological process.
IMPORTANCE Coffee production is a long process, starting with the harvest of cof-
fee cherries and the on-farm drying of their beans. In a later stage, the dried green
coffee beans are roasted and ground in order to brew a cup of coffee. The on-farm,
postharvest processing method applied can impact the quality of the green coffee
beans. In the present case study, freshly harvested Arabica coffee cherries were pro-
cessed through wet and dry processing in four distinct variations. The microorgan-
isms present and the chemical profiles of the coffee beans were analyzed through-
out the postharvest processing chain. The up-to-date techniques implemented
facilitated the investigation of differences related to the method applied. For in-
stance, different microbial groups were associated with wet and dry processing
methods. Additionally, metabolites associated with the respective microorganisms
accumulated on the final green coffee beans.
KEYWORDS coffee bean fermentation, wet processing, dry processing, high-
throughput sequencing, metabolite target analysis, UPLC-MS/MS, green coffee beans

January 2017 Volume 83 Issue 1 e02398-16 Applied and Environmental Microbiology aem.asm.org 1
De Bruyn et al. Applied and Environmental Microbiology

P ostharvest processing of coffee cherries yields green coffee beans, which need to
be roasted and ground to obtain the desired characteristic coffee aroma and taste
(1). These processes are the main drivers of consumers’ perception of coffee beverage
quality. The cherries and beans are the fruits and seeds of the coffee plant (Coffea sp.,
family Rubiaceae), which is cultivated in plantations, mainly in the equatorial zone.
The on-farm postharvest coffee processing is essential for ensuring high coffee cup
quality (2) and constitutes a chain of interlinked phases mainly aimed to remove the
mucilage of the cherries and dry the beans to a low moisture content of 10 to 12%
(mass/mass). The final quality of the green coffee beans is thus dependent on the
agricultural and farm practices applied, which in turn depend on the coffee plant
cultivar, geography, weather conditions, and infrastructure available (3). Even when all
of these factors are fixed within one type of postharvest processing, a multitude of
variations exist, as a standardized pipeline for the production of green coffee beans is

Downloaded from http://aem.asm.org/ on May 2, 2020 by guest

lacking (4). After harvesting of the cherries, the outer layers of the coffee drupe (i.e., hull
and pulp) are easily removed, while the mucilage, parchment, and silverskin are firmly
attached to the beans. Different methods are employed to eliminate all of these layers,
commonly referred to as wet and dry coffee processing. During wet processing, the hull
and pulp of the cherries are mechanically stripped from the beans (depulping). The
inside of the cherries thus gets exposed to environmental contamination, and the
mucilage is subsequently removed by spontaneous microbial fermentation in a water
tank for 6 to 24 h (5–15). This is followed by washing of the fermented beans and sun
drying. Dry processing involves direct drying of the whole cherries on cement patios or
aerated trays for 14 to 30 days, during which spontaneous fermentation occurs (8,
16–18). Both wet- and dry-processed coffees are finally subjected to dehulling to obtain
the green coffee beans (4). In all processes, the spontaneous fermentation step is highly
variable and hence needs to be further investigated to understand its contribution to
the final coffee cup quality.
Microorganisms are ubiquitous during the different stages of postharvest coffee
processing (2, 19–22). Enterobacteriaceae and other Gram-negative bacteria, including
acetic acid bacteria (AAB), bacilli, lactic acid bacteria (LAB), yeasts, and filamentous
fungi have been found through culture-dependent and -independent methods during
coffee fermentation processes (5-18, 22). The occurrence and activity of specific micro-
bial groups can be associated with diverse functionalities during processing, for in-
stance, the degradation of pulp pectin and the depletion of mucilage carbohydrates
(5–7, 12, 23). Their metabolite production capacities can have beneficial and/or detri-
mental effects on the sensory characteristics of the green coffee beans and final coffee
cup quality (3, 24–26). However, it is not yet clear to what extent microorganisms are
essential for the production of high-quality coffee (2). Recently, the ability of naturally
occurring yeasts to act as selected starter cultures and to influence the in-cup attributes
of coffee has been shown during semidry processing (14, 15, 27). Also, the beans
(endosperms) remain metabolically active during coffee processing and are impacted
by the processing method implemented, thereby affecting the final coffee cup quality
(2, 28–33).
Despite the complexity of coffee processing and the numerous factors contributing
to the quality traits of the green coffee beans, all studies conducted so far only targeted
specific steps of the processing (2, 19, 21). Their primary goal has been the identifica-
tion of the microbiota associated with the fermentation part of the processing and the
chemical profiling of the green coffee beans and/or bean germination process. How-
ever, no study has been performed to unravel the evolution of the microbial species
and concomitant substrate degradation and metabolite production or the chemical
profiles of distinct cherry layers throughout the coffee-processing chain.
This study aimed to apply a systematic approach for monitoring the evolution of the
microorganisms, substrates, and metabolites during an entire chain of both wet and dry
coffee processing carried out under various conditions in Ecuador (Fig. 1 shows details
of the four experiments). These conditions were chosen to represent a more and a less
favorable postharvest practice to gain insight into the potential correlation of specific

January 2017 Volume 83 Issue 1 e02398-16 aem.asm.org 2

Microbiota and Metabolites during Coffee Processing Applied and Environmental Microbiology

Downloaded from http://aem.asm.org/ on May 2, 2020 by guest

FIG 1 Experimental setup of the case study of four coffee-processing experiments carried out at the
Nanegal station (Ecuador). For the wet and dry processing, the orange line depicts the standard wet process
(SW) and standard dry process (SD). The green line represents the extended fermentation wet process (EW)
(36 h) and heaped dry process (HD). A pool of freshly handpicked coffee cherries (CB sample) served for all
wet- and dry-processing experiments. Concerning the wet processing, sample W1 refers to the depulped
beans used for both wet-processing variations. Samples SW2 and EW2 correspond to the beans postfer-
mentation and prior to washing, SW3 and EW3 constitute beans postsoaking, and samples SW4 to SW7 and
EW4 to EW7 represent beans during sun drying. Regarding the dry processing, samples SD1 to SD10 and
HD1 to HD10 were recovered during sun drying.

microorganisms with a certain processing. High-throughput sequencing of metag-

enomic DNA, targeting both the bacterial and fungal diversity, and robust metabolite
target analysis of a broad range of chemical compounds in the coffee pulp, mucilage,
and endosperm were undertaken.

RESULTS
Microbial community structures. The average numbers of raw V4 and internal
transcribed spacer 1 (ITS1) sequences per sample reached approximately 200,000 and
94,000 sequences, respectively. The estimated sequencing coverage ranged between
98.2 and 99.7%.
(i) Freshly harvested coffee cherries. The initial surface contamination of the
freshly harvested coffee cherries (CB sample) encompassed bacterial operational
taxonomic units (OTUs) belonging to the Enterobacteriaceae (especially Klebsiella
pneumoniae), AAB (Gluconobacter spp.), and soil-associated bacteria such as Dyella
kyungheensis (Fig. 2A and 3). Only a small portion of the reads was attributed to the
LAB species Leuconostoc mesenteroides/pseudomesenteroides. In regard to the fun-
gal diversity, Pichia kluyveri/fermentans was highly abundant (Fig. 2B and 3). Based
on the principal-coordinate analysis (PCoA) performed on all microbial community
structures, the CB sample was clearly differentiated from all other coffee-processing
samples (Fig. 4).

January 2017 Volume 83 Issue 1 e02398-16 aem.asm.org 3

De Bruyn et al. Applied and Environmental Microbiology

Downloaded from http://aem.asm.org/ on May 2, 2020 by guest

FIG 2 Relative abundances (percentage) of bacterial (A) and fungal (B) operational taxonomic units (OTUs) occurring in
selected samples throughout the four postharvest coffee-processing experiments. (A) Bacterial OTUs with relative abundance
values greater than 0.1% in at least three samples. (B) Distribution of minor fungal OTUs with a scale from 85 to 100% to better
show the fungal diversity because of the dominance (87 to 99%) of a large OTU assigned to the genus Pichia.

(ii) Wet coffee processing. Upon depulping (W1), the OTU Leuconostoc increased in
relative abundance, and it was the most prevalent bacterial taxon throughout the wet
processing, especially during fermentation (SW2 and EW2) (Fig. 2A and 3). The most
prevalent fungal taxon was Pichia, whereas the OTUs Starmerella and Candida increased
in relative abundances mainly during the fermentation and soaking stage (Fig. 2B and
3). Over the course of sun drying (SW4 and SW5), the arrangement of the OTUs stayed
nearly unvaried. Overall, all wet-processed samples grouped closer on the PCoA biplots,
depicting similarities in their microbial community structures that mainly encompassed
LAB and only limited fungal diversity (Fig. 4). However, certain differences in the
evolution of the microbial communities occurred. While Leuconostoc spp., Lactococcus,
and Weissella were predominant during fermentation in SW, a higher incidence of
lactobacilli was found from fermentation in EW. This indicated a shift toward more
acid-tolerant LAB communities, which corresponded to a decrease in the pH of the
fermenting mass from 4.5 (after 16 h of fermentation) to 4.0 (after 36 h of fermentation).
LAB-associated OTUs decreased during drying. Further, the abundance of enterobac-

January 2017 Volume 83 Issue 1 e02398-16 aem.asm.org 4

Microbiota and Metabolites during Coffee Processing Applied and Environmental Microbiology

Downloaded from http://aem.asm.org/ on May 2, 2020 by guest

FIG 3 Pseudo-heatmap showing the species diversity and relative abundances (percentage) of bacterial and fungal species
occurring in selected samples throughout the four postharvest coffee-processing experiments. The color key at the bottom of
the heatmap indicates the relative abundances of the species in the sample.

terial taxa was lower in EW than in SW, especially after fermentation and soaking but
increased during drying. Also, a rise in the relative abundances of soil-associated OTUs
Acinetobacter, Janthinobacterium, and Cellulosimicrobium followed the decrease in
moisture content (Fig. 3; see also Fig. S1 in the supplemental material).
(iii) Dry coffee processing. During dry processing (both SD and HD), the LAB
species L. mesenteroides/pseudomesenteroides and AAB taxa (Acetobacter and Glucono-
bacter) were present in high relative abundances (Fig. 2A and 3). The Enterobacteriaceae
OTUs decreased compared to those for the CB and wet-processed samples. Other
bacterial OTUs appeared sporadically and in variable relative abundances over the
course of drying, for instance, reflecting environmental contamination (SD7). Further
examples are Lactobacillaceae, Enterobacteriaceae (mostly K. pneumoniae), Enterococ-
caceae, Brucellaceae (especially Ochrobactrum pseudogrignonense), Stenotrophomonas,
and Janthinobacterium lividum. The fungal diversity of the dry-processed samples was
greater than that of the wet-processed samples. Although Pichia was still the major
fungal taxon, the occurrences of Starmerella bacillaris and Candida spp. were higher
than in wet processing (Fig. 2). The PCoA underpinned the distinction between wet-
and dry-processing samples based on their microbial community structures (Fig. 4).

January 2017 Volume 83 Issue 1 e02398-16 aem.asm.org 5

De Bruyn et al. Applied and Environmental Microbiology

Downloaded from http://aem.asm.org/ on May 2, 2020 by guest

FIG 4 Principal-coordinate analysis (PCoA) biplots based on Bray-Curtis dissimilarities of the bacterial (A) and fungal (B) community structures for
the coffee samples analyzed.

Significant differences between SD and HD were found. During the first 6 days of
HD, the heaped and nonstirred cherries remained moist, as liquid exuded from the
pulp, and no significant decrease in the moisture content was noted (Fig. S1). Also,
visible chalk-dust mycelia were formed on these cherries, and a strong odor developed,
indicating high microbial activity. Moreover, dominance of AAB and the presence of the
mold-like yeast Saccharomycopsis crataegensis were found during HD (Fig. 2 and 3). The
co-occurrence and coexclusion plot, based on a Spearman rank-order correlation matrix
(see Fig. S2 in the supplemental material) confirmed the positive relationship among
Gluconobacter spp., Acetobacter spp., and S. crataegensis as well as non-Pichia yeasts.
Metabolite target analysis. (i) Freshly harvested coffee cherries. The moisture
content of the mucilage (85%) and endosperm (51%) of the fresh coffee cherries as well
as the concentrations of all targeted metabolites differed substantially (Fig. 5A and B).
The mucilage was rich in fructose (27% on dry mass), glucose (21%), sucrose (9%), and
organic acids (7.3%), among which malic acid, quinic acid, and gluconic acid were the
most abundant. In contrast, the endosperm had high levels of sucrose (8% on dry mass)
and low concentrations of monosaccharides, whereas the most prevalent organic acids
(2.4%) were citric acid, malic acid, and quinic acid. In addition, the trigonelline (1.0%)
and caffeine concentrations (0.9%) were higher in the endosperm than in the mucilage,
whereas the acetic acid concentration was lower.
(ii) Wet coffee processing. As the mucilage was completely removed from the
endosperm after fermentation, metabolite quantification of the mucilage was per-
formed up to the soaking stage. In the mucilage, sucrose was completely consumed by
the end of fermentation in both SW and EW. Fructose and glucose concentrations
decreased, and this drop was more intense during EW. A substantial accumulation of
metabolites associated with microbial activity occurred, including acetic acid, ethanol,
glycerol, lactic acid, and mannitol (Fig. 5A). These compounds started to accumulate
after depulping, and the concentrations increased proportionally to the time of fer-
mentation. The organic acid profile of the mucilage was also modified during fermen-
tation, as the concentrations of gluconic acid, malic acid, and quinic acid decreased.
Propionic acid, butyric acid, isobutyric acid, valeric acid, isovaleric acid, hexanoic acid,
and oxalic acid concentrations were below the quantification limits. The caffeine and
trigonelline concentrations decreased upon processing.

January 2017 Volume 83 Issue 1 e02398-16 aem.asm.org 6

Microbiota and Metabolites during Coffee Processing Applied and Environmental Microbiology

Downloaded from http://aem.asm.org/ on May 2, 2020 by guest

FIG 5 Metabolite profiles of mucilage (A) and endosperm (B) from wet-processed coffee samples and of hull and pulp (C) and endosperm (D) from
dry-processed coffee samples. In the case of the compositional analysis of the endosperms (B and D), all other layers (i.e., hull and pulp, parchment and
silverskin, or dried hull) were manually removed prior to extraction. The metabolite target analysis encompassed carbohydrates, sugar alcohols, organic acids,
short-chain fatty acids, ethanol, and coffee-specific compounds. The metabolite concentrations represent the averages of three independent extractions. The
standard error in all cases was less than ⫾5% and is thus not shown in the charts.

Compared to the mucilage, less extensive change in metabolite concentrations

occurred in the endosperms of the coffee-processing samples. After fermentation, the
fructose, glucose, sucrose, and caffeine concentrations in the endosperms decreased
significantly (P ⬍ 0.05). The extended fermentation time resulted in a further drop of
the sucrose concentration and in increases in the acetic acid, ethanol, glycerol, glucu-
ronic acid, lactic acid, mannitol, and succinic acid concentrations. The accumulation of
these compounds was proportional to the duration of fermentation. After 24 h of
soaking, the concentrations of the majority of these targeted compounds, especially
ethanol, fructose, glucose, glucuronic acid, lactic acid, and mannitol, dropped. In
addition, the concentrations of citric acid, quinic acid, caffeine, and trigonelline de-
creased after the soaking step. During drying, the endosperms of both SW and EW
followed a comparable pattern, with a decrease in sucrose, glucose, fructose, ethanol,
caffeine, and trigonelline concentrations and a slight increase in caffeic acid and
erythritol concentrations (Fig. 5B).
(iii) Dry coffee processing. Clear changes in metabolite concentrations occurred in
the dried outer layers of SD and HD (Fig. 5C), whereas fewer changes were found in the
endosperms (Fig. 5D). No sucrose was found in the outer layers of dry-processed
cherries, indicating a fast and complete depletion upon drying. In addition, glucose and

January 2017 Volume 83 Issue 1 e02398-16 aem.asm.org 7

De Bruyn et al. Applied and Environmental Microbiology

fructose concentrations decreased; however, this drop was more gradual in SD than in
HD. The glycerol and mannitol concentrations increased intensively and peaked in the
SD3 and HD5 samples. Arabitol, sorbitol, and xylitol concentrations also increased in the
outer layers during drying. Organic acid concentrations, encompassing lactic acid (1.0%
in SD5, 2.1% in HD3), gluconic acid (8.7% in SD5, 14.3% in HD3), and glucuronic acid
(1.7% in SD3, 3.1% in HD1) also increased during drying, with higher concentrations
generated in the HD samples than in the SD samples (Fig. 5C). A sharp increase in acetic
acid concentrations took place in SD1 and HD1, whereas they decreased afterwards.
Regarding the endosperm, the monosaccharide and sucrose concentrations de-
creased gradually during drying, whereas the glucose and fructose concentrations had
a secondary peak in the SD6 and HD3 samples (Fig. 4D). Small concentrations of
glycerol were found, reaching their highest values in the SD3 and HD3 samples. Acetic
acid, ethanol, and lactic acid reached their highest concentrations in the SD2 and HD3

Downloaded from http://aem.asm.org/ on May 2, 2020 by guest

samples, and they decreased afterwards (slower during HD than during SD). Accumu-
lation of glucuronic acid, gluconic acid, and succinic acid concentrations took place
at the beginning of drying and followed a gradual decrease upon processing as was
found for the aforementioned compounds. Overall, the principal-component anal-
ysis (PCA) performed on the endosperm metabolite data showed not only a clear
distinction between wet- and dry-processed samples but also clear grouping
between samples during the beginning of processing and those close to the end
(Fig. 6). These clusters were corroborated by the drop in lactic acid, mannitol, and
sucrose concentrations (Fig. 6).
(iv) Final green coffee beans. The metabolite profiles of the green coffee bean
samples (SW7, EW7, SD10, and HD10) differed. Significantly higher concentrations of
monosaccharides, myo-inositol, ethanol, fumaric acid, lactic acid, succinic acid, and
5-caffeoylquinic acid (5-CQA) were found in EW7 than in SW7, whereas lower sucrose
concentrations were found in EW7 than in SW7 (see Fig. S3 in the supplemental
material). In HD10, significantly higher concentrations of glucose, fumaric acid, gluconic
acid, succinic acid, and caffeic acid occurred than in SD10, while the concentrations of
glycerol, mannitol, myo-inositol, acetic acid, and 5-CQA were lower. Overall, wet-
processed green coffee beans contained higher citric acid and erythritol concentrations
and lower concentrations of fructose, glucose, caffeic acid, caffeine, trigonelline, and
certain CQA isomers (i.e., 3-CQA, 4-CQA, 3,4-diCQA, and 4,5-diCQA) than dry-processed
green coffee beans.

DISCUSSION
The present case study on coffee processing represents a systematic approach for
the monitoring of both microbial community shifts and metabolite profiles associated
with coffee cherry substrates (i.e., pulp and mucilage) and coffee beans throughout the
postharvest processing chain. The molecular analysis conducted was based on an
enzymatic total DNA extraction method, targeting bacteria, yeasts, and filamentous
fungi, suitable for metagenomic purposes. The high-throughput sequencing (HTS) of
short-length amplicons of bacteria and fungi under the same barcode was an econom-
ical way to evaluate the total microbial diversity of this complex ecosystem. Challenges
were the equimolar pooling of the two DNA template libraries that resulted in a 2:1
ratio of generated reads (V4/ITS1) and adapter read-throughs in the ITS1 sequences
because of the various length of the ITS regions of Ascomycota and Basidiomycota (34).
The metabolite target analysis employed rapid sample preparation steps combined
with three different extraction methods and various chromatographic separation and
detection techniques, allowing high discriminatory power among structurally related
compounds in complex matrices.
The microbial community structure on the surface of the freshly harvested coffee
cherries was composed of Enterobacteriaceae, fungi, and soil microorganisms that
naturally occur in the phyllosphere (35, 36). As soon as the coffee cherries started
exuding, these prototrophic microorganisms were succeeded by fermentative LAB
species such as L. mesenteroides/pseudomesenteroides and the yeast species P. kluyveri/

January 2017 Volume 83 Issue 1 e02398-16 aem.asm.org 8

Microbiota and Metabolites during Coffee Processing Applied and Environmental Microbiology

Downloaded from http://aem.asm.org/ on May 2, 2020 by guest

FIG 6 Three-dimensional (3-D) plot of the PCA of the chemical composition of the coffee samples analyzed. The plot is based
on the quantification data of the metabolite target analyses. The ellipses indicate the approximate grouping of the two sample
clusters corresponding to the coffee-processing methods. The coordinates of the centroid of each cluster (i.e., wet- and
dry-processing samples) are given. Principal components PC1, PC2, and PC3 account for 71% of the variance in the data matrix,
and their correlation with the different variables is graphically shown next to the axes. PC1 was positively correlated with the
presence of free glucose and fructose, whereas it was negatively correlated with that of erythritol. PC2 was positively correlated
with the caffeic acid concentration and reversely correlated with that of sucrose. Last, PC3 correlated with high lactic acid and
mannitol concentrations.

fermentans that dominated during processing. In general, L. mesenteroides is associated

with cereal, vegetable, and fruit fermentations (37–40), and P. kluyveri has often been
found in coffee and cocoa bean fermentations (19, 41).
During wet processing, acidification was ascribed to the accumulation of lactic acid
and acetic acid by LAB species belonging to the taxa Lactococcus, Leuconostoc, and
Weissella in the mucilage. Extended fermentation selected for more acid-tolerant
lactobacilli. The concomitant increase in the mannitol concentration in the mucilage
corroborated the activity of heterofermentative leuconostocs. These are common
patterns and activities during plant fermentation processes (37, 39, 40, 42–45). The
yeast diversity of coffee processing often encompasses the taxa Candida, Hansenias-
pora, Pichia, and Saccharomyces (11, 14, 16–19). In the current study, the yeast diversity
was more restricted, as shown by the high relative abundance of P. kluyveri/fermentans.
Changes in the fermenting mucilage were also reflected in the endosperms, where high
concentrations of microbial end metabolites (e.g., acetic acid, ethanol, glycerol, lactic
acid, and mannitol) occurred. In addition, the anoxia of underwater submersion trig-
gered the germination of the endosperms, resulting in an anaerobic carbohydrate
consumption response, which was even more intense during the extended fermenta-
tion of depulped and thus injured coffee beans (28, 32, 33, 46, 47). The coffee beans
under anoxia consumed the carbohydrate resources continuously through glycolysis, as
the sucrose concentration decreased in the endosperms. Alternatively, during soaking,

January 2017 Volume 83 Issue 1 e02398-16 aem.asm.org 9

De Bruyn et al. Applied and Environmental Microbiology

the osmotic pressure facilitated the loss of monosaccharides and microbial metabolites
accumulated upon fermentation. Hence, the soaking step carried out on the fermented
coffee beans facilitated a significant washout of these compounds, which may impact
the quality of the brewed coffee because of a lower degree of acidity and will lead to
a milder flavor. It is well known that the loss of dry matter is associated with fermen-
tation and soaking due to endogenous metabolism and exosmosis, thereby influencing
coffee cup quality (4, 48). During drying of the coffee beans, the moisture content
decreased and shifted their microbial contamination to environmental taxa related to
soil (mainly Gram-negative bacteria) (49). Also, the drying step induced a drought stress
response and aerobic respiration in the endosperms (31), which slowed down the
glucose and fructose turnover rate (31). All of these processing steps contributed to
differences in the concentrations of coffee-specific compounds too. Consequently,
technological aspects (especially the duration of fermentation, soaking, and drying) can

Downloaded from http://aem.asm.org/ on May 2, 2020 by guest

be decisive for the composition of the endosperms, as the accumulation of microbial
metabolites and endogenous mobilization of resource macromolecules might alter the
overall coffee bean composition.
In the case of dry processing, mainly AAB occurred next to yeast communities
composed of P. kluyveri/fermentans, Candida spp., and S. bacillaris. Hence, a clear
distinction between the microbial community structures of wet and dry processing of
coffee was made, which was confirmed by the evolution patterns of the targeted
chemical compounds. Especially in the case of the heaped dry process, the prevalence
of Acetobacter, Gluconobacter, and the appearance of S. crataegensis was facilitated. The
latter species was able to produce an extensive mycelium, which might explain the
mold-like appearance of the heaped beans upon processing. Also, this yeast species has
a negative or weak capacity to ferment glucose and can assimilate gluconic acid, which
is produced by AAB (50, 51). These metabolic characteristics might give it a competitive
advantage over other microorganisms in the heaped dry coffee-processing malpractice.
The incidence of yeasts along with the Acetobacter and Gluconobacter species
increased the concentrations of acetic acid, ethanol, glycerol, and gluconic acid in the
dried outer layers, especially during heaped dry processing. Also, a minor accumulation
of microbial metabolites, such as gluconic acid, glycerol, and mannitol took place in the
endosperm. These findings support the effect of microorganisms on the chemical
profile of dry-processed coffee beans and might imply a slow but observable migration
of microbial metabolites to the endosperm. This is, for instance, the case when beans
are spoiled by fungal contamination, resulting in poor-quality coffee that tastes moldy
and earthy (24). In addition, stress during drying can result in a bimodal pattern
response, which corresponded to the relapsing peak in glucose and fructose concen-
trations (31). The absence of depulping injury and anoxia contributed to higher
concentrations of free monosaccharides in the final dry-processed green coffee beans
than in wet-processed ones. Moreover, the slow aeration and subsequent decrease in
moisture in the heaped dry process might account for the chlorogenic acid (CGA)
degradation and caffeic acid generation by endogenous enzymes as well as the higher
concentration of volatiles in the endosperms compared to wet-processed coffee beans
(52). Higher concentrations of caffeic acid, caffeine, fructose, glucose, trigonelline, and
certain CGA isomers in dry- rather than wet-processed green coffee beans have also
been shown for beans from different origins (9, 30, 53).
In general, the resulting chemical profiles of green coffee beans are strongly
associated with the final coffee cup quality (54–58). For instance, caffeine, CGAs, and
trigonelline are responsible for the bitterness and astringency of the final coffee
beverage. As the dry-processed green coffee beans contain more of such compounds,
higher bitterness and astringency levels would be expected in the corresponding
coffee beverages than in the wet-processed ones (9, 58–60). Finally, most compounds
mentioned above undergo extensive changes during roasting, mainly Maillard reac-
tions, and hence contribute to differences in coffee flavors (24, 30, 60, 61).
In conclusion, the present case study monitored the evolution of the bacterial and
fungal diversity along with substrates consumed and metabolites produced during the

January 2017 Volume 83 Issue 1 e02398-16 aem.asm.org 10

Microbiota and Metabolites during Coffee Processing Applied and Environmental Microbiology

entire chain of both wet and dry processing under favorable and less favorable
processing conditions. At the same time, specific endosperm metabolite changes were
followed. This was made possible by simultaneous HTS of metagenomic DNA and
metabolite target analysis of a broad range of chemical compounds. The results
showed that the different processing conditions influenced the composition and
activity of the microbial communities as well as metabolite accumulation in the
endosperms. In addition, the current findings corroborate the effect of microorganisms
on the chemical profiles of coffee beans and support the idea of using a starter culture
during coffee processing for improved process control and prevention of spoilage and
eventually steering the sensory differentiation of roasted coffee, as has been performed
for cocoa bean fermentation (62, 63). Further studies should ultimately allow strength-
ening of the understanding of the impact of the microbiota on coffee cup quality and
provide robust data for the development of commercial starter cultures.

Downloaded from http://aem.asm.org/ on May 2, 2020 by guest

MATERIALS AND METHODS
Coffee cultivar and coffee-processing experiments. The coffee cultivar used throughout this study
was Coffea arabica L. var. typica. Four coffee-processing experiments were performed at a coffee
plantation near Nanegal (Nestlé Ecuador; latitude and longitude coordinates, 0°11=25.8⬙N 78°40=41.4⬙W;
altitude, 1,329 m; https://www.google.be/maps/place/0%C2%B011=25.8%22N⫹78%C2%B040=41.4
%22W/@0.190509,-78.678155,13z/data⫽!4m2!3m1!1s0x0:0x0) in May to July 2014 (Fig. 1). Approximately
160 kg of healthy mature cherries were selectively handpicked and served as a pool of common starting
material for all experiments. Two parallel wet-processing experiments were performed, which differed in
fermentation time. Initially, 100 kg of cherries were depulped mechanically (UCBE 500; Penagos,
Bucaramanga, Colombia). The depulped beans were then allowed to ferment spontaneously in clean
plastic containers (50 cm by 30 cm by 20 cm). A first part of the depulped beans was left to ferment for
16 h and a second part for 36 h. In this way, half of the depulped beans underwent a standard wet
process (SW), while the other half was subjected to an extended fermentation wet process (EW). The
fermented beans were manually washed with clean water and soaked for 24 h. Finally, the soaked beans
were dispersed onto cement patios for drying until they reached a moisture content of approximately
12% (mass/mass). Simultaneously with the SW and EW experiments, two dry processing experiments
were performed. Approximately 30 kg of fresh cherries (originating from the same aforementioned pool
of harvested cherries) were equally divided between a standard dry process (SD), in which the cherries
were spread in a monolayer on a covered aerated drying tray and stirred daily, and a heaped dry process
(HD) wherein the cherries were heaped on the drying tray (4 to 6 cherries deep) without stirring during
the first 6 days. Afterwards, the HD cherries were stirred daily as well. The cherries underwent sun drying
until a moisture content of approximately 12% (mass/mass) was reached. The moisture content was
evaluated by means of a mini GAC plus moisture tester (Dickey-john, Auburn, IL).
Sampling during coffee processing. Coffee-processing samples (i.e., freshly harvested cherries,
depulped beans, fermented beans, soaked beans, drying beans, and dry-processed cherries) were
collected at specific time points and immediately stored at ⫺20°C until further analysis. A uniform
code was assigned to each processing sample, containing information on the type of variation
(standard [S], extended [E], and heaped [H]), processing method (wet [W] and dry [D]), and sampling
point (1–10) (Fig. 1).
The pH was measured by means of pH-Fix strips 0 to 14 (Macherey-Nagel; Düren, Germany) at the
end of the fermentation steps of SW and EW. The moisture contents of all cherry and bean samples were
determined by mass difference through drying in an oven at 100°C for 24 h.
Microbial community analysis. (i) Total DNA extraction. An innovative approach of metagenomic
DNA extraction was performed. Total DNA was extracted from thawed coffee-processing samples by first
detaching microbial cells present on the cherries or beans via manual inversion (2 treatments of 2 min
with a 15-min pause) in 25 ml of saline solution (8.5 g/liter NaCl; Merck, Darmstadt, Germany). Depending
on the type of sample, 6 cherries or 20 to 50 beans were used for total microbial DNA extraction. After
manual inversion, the resulting suspensions were filtered through a 20-␮m average pore-size 50-ml
Steriflip filter (Merck) to eliminate coarse impurities. The filtrates were pelletized by centrifugation
(14,000 ⫻ g, 10 min). The pellets were washed with 1 ml of TES buffer (50 mM Tris base, 1 mM EDTA, 6.7%
[mass/vol] sucrose [pH 8.0]). Subsequently, several consecutive enzymatic steps were applied to cover all
microbial communities potentially present. To obtain fungal cell lysis, the pellets were resuspended in
300 ␮l of 50 mM phosphate buffer (pH 6.0) and incubated with chitinase (500 mU/ml; Sigma-Aldrich, St.
Louis, MO) at 37°C for 2 h, followed by centrifugation at 8,000 ⫻ g for 10 min. The pellets were then
resuspended in 600 ␮l of sorbitol buffer (21% [mass/vol] sorbitol [VWR International, Darmstadt,
Germany], 50 mM Tris base [pH 7.5]) containing a cocktail of 0.2 U of lyticase (Sigma-Aldrich), 200 U of
Zymolyase (G-Biosciences, St. Louis, MO), and 1.23 ␮l of 2-mercaptoethanol (Merck), and the mixtures
were incubated at 30°C for 1 h. Following this initial fungal cell lysis treatment, the suspensions were
washed with sorbitol buffer. Then, bacterial cells were lysed by adding 300 ␮l of STET buffer (8%
[mass/vol] sucrose, 50 mM Tris base, 50 mM EDTA, 5% [mass/vol] Triton X-100 [pH 8.0]) and incubating
the suspensions with a cocktail of 0.1 U of mutanolysin (Sigma-Aldrich) and 8 mg of lysozyme (Merck)
at 37°C for 1 h. Subsequently, 40 ␮l of a 20% (mass/mass) sodium dodecyl sulfate solution and 0.1 g of
sterile glass beads were added before the suspensions were vortexed intensively for 1 min. Protein

January 2017 Volume 83 Issue 1 e02398-16 aem.asm.org 11

De Bruyn et al. Applied and Environmental Microbiology

digestion was achieved by incubation of these suspensions with 0.5 mg of proteinase K (Merck) at 56°C
for 1 h. Thereupon, 100 ␮l of a 5 M NaCl solution was added to the suspensions and incubated at 65°C
for 2 min, after which 80 ␮l of a 10% (mass/mass) cetyltrimethyl ammonium bromide solution was added,
and the mixtures were incubated at 65°C for 10 min. Following this, 600 ␮l of chloroform-phenol-isoamyl
alcohol solution (49.5:49.5:1.0) was added, and the lysates were shaken vigorously for 5 min. Finally, the
solutions were centrifuged at 13,000 ⫻ g for 5 min in 2-ml vials (Phase Lock Gel Heavy; 5 Prime, Hilden,
Germany). The DNA contained in the supernatants was purified by binding on and elution from a
cellulose acetate membrane, using the DNeasy blood and tissue kit (Qiagen, Venlo, The Netherlands)
according to the manufacturer’s instructions. DNA concentrations were measured with a NanoDrop
ND-2000 (Thermo Scientific, Wilmington, DE).
(ii) Amplification of group-specific loci for HTS. Group-specific loci of both bacterial and fungal
DNA were amplified through PCR. The V4 hypervariable region of the bacterial 16S rRNA gene was
amplified using the primers F515 (5=-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGTGCCAGCMGCC
GCGGTAA-3=) and R806 (5=-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAA
T-3=) with an Illumina platform-specific 5= tag (underlined) (64). The PCR assay conditions consisted of an
initial step at 94°C for 3 min, followed by 35 cycles at 94°C for 45 s, 50°C for 60 s, and 72°C for 90 s. A

Downloaded from http://aem.asm.org/ on May 2, 2020 by guest

final extension was performed at 72°C for 10 min. The fungal ITS1 region was amplified using the primers
ITS1 (5=TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCCGTAGGTGAACCTTGCGG3=) and ITS2 (5=GTCTC
GTGGGCTCGGAGATGTGTATAAGAGACAGGCTGCGTTCTTCATCGATGC3=) with an Illumina platform-
specific 5= tag (underlined) (34). The PCR assay conditions consisted of an initial step at 95°C for 2 min,
followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 50°C for 30 s, and extension at 72°C
for 60 s. A final extension was performed at 72°C for 5 min. Each PCR assay mixture contained 6 ␮l of 10⫻
PCR buffer (Sigma-Aldrich), 2.5 ␮l of 0.1 mg/ml bovine serum albumin (Sigma-Aldrich), 0.2 mM deoxy-
nucleotide triphosphate mixture (Sigma-Aldrich), 1.25 U of Taq DNA polymerase (Roche), 10 to 100 ng
of DNA template, and 5 ␮M each primer (Integrated DNA Technologies, Leuven, Belgium). The PCR
amplicons were purified using the Wizard SV gel and PCR clean-up system (Promega, Madison, WI) and
size selected using Agencourt AMPure XP PCR purification magnetic beads (Beckman Coulter, Brea, CA),
following the manufacturers’ instructions. The amplicon size distribution was checked qualitatively by
means of a 2100 Bioanalyzer instrument (Agilent Technologies, Santa Clara, CA). Finally, double-stranded
DNA concentrations were quantified using the fluorometric Qubit 2.0 quantitation assay (Thermo Fisher,
Waltham, MA).
(iii) HTS of V4 and ITS1 amplicons. A novel approach was followed for HTS. The bacterial and fungal
DNA template libraries of each sample were combined and sequenced under the same index. Briefly,
bacterial V4 and fungal ITS1 amplicons originating from the same sample were pooled equimolarly,
barcoded with the same index, and diluted if necessary before sequencing. Every pooled sample had a
total volume of 30 ␮l. All samples were sequenced using the Illumina MiSeq platform (Illumina, San
Diego, CA) in a commercial facility (BRIGHTcore, Jette, Belgium). Two Fastq files were obtained for each
sample, encompassing all forward and reverse reads, both deriving from the bacterial and fungal
amplicons.
(iv) Bioinformatics analysis. The forward and reverse Fastq files of each sample, containing the
sequences of the bacterial V4 and fungal ITS1 fragments, were first split by means of an in-house Perl
script into two files. Based on the first six nucleotides of the reads corresponding to the respective
primers, a first Fastq file contained all the bacterial V4 sequences and a second Fastq file comprised the
fungal ITS1 sequences. Both the bacterial and fungal diversities were processed through mothur software
v1.36.1, following a workflow described before (65), with some modifications as outlined below.
For the V4 sequences (4,440,225 paired reads), removal of primers, generation of contigs, and
subsequent quality screening were performed. The unique sequences were aligned against the bacterial
16S rRNA SILVA database and then clustered into groups, allowing a difference of maximum two
mismatches. A chimera check was carried out by means of the Uchime algorithm (66). After the removal
of chimeric sequences, the taxonomic allocation and generation of operational taxonomic units (OTUs)
were performed at a level of 97% identity.
For the fungal ITS1 sequences (2,073,445 paired reads), the forward and reverse reads were first
trimmed using Cutadapt software (release 1.9.dev6) (67), due to the short length of the targeted ITS1
region in some cases, which resulted in adapter read-throughs (68). Briefly, the sequenced adapters
and the overhangs at the 3= end of the forward and reverse reads were trimmed off. The trimmed
Fastq files were then processed through mothur for the generation of contigs and quality screening
of the paired reads. The unique sequences were classified taxonomically through comparison with
the fungal UNITE_ITS1 database (v6_sh_99), as described before (69), and merged into OTUs when
the taxonomic allocation was identical.
Finally, the representative unique sequences corresponding to the respective bacterial or fungal
OTUs were aligned with reference 16S rRNA gene and ITS1 sequences using the BLASTN algorithm (70).
When the sequence identity was higher than 99% compared to that for well-described and curated
sequences of type and reference strains, an assignment to the species level was performed too. In all
cases, the ranking of the identified taxa presented above is based on a decreasing order of relative
abundance.
Metabolite target analysis. (i) Preparation of extracts from mucilage, pulp, and endosperm.
Due to the complexity of wet and dry processing, all coffee cherry layers and endosperms were
collected and analyzed separately to monitor the shifts of the metabolite profile along the post-
harvest processing chain. Therefore, each coffee-processing sample was subjected to a standard
preparation protocol prior to metabolite extraction. In the case of wet-processed samples, the pulp

January 2017 Volume 83 Issue 1 e02398-16 aem.asm.org 12

Microbiota and Metabolites during Coffee Processing Applied and Environmental Microbiology

was first separated from the beans, then the mucilage was scraped off, and finally the parchment
was detached manually. In the case of dry-processed samples, all dried outer layers were removed
manually. In all cases, representative samples (20 g) of cherry layers or endosperm were first frozen
in liquid nitrogen (Air Liquide, Louvain-la-Neuve, Belgium) and ground into fine powders with a malt
miller (Corona Mill, Bogotá, Colombia).
Three types of extraction were used to analyze the metabolites targeted in the final samples. Water
extracts were prepared by submerging 0.1 to 0.5 g of sample in 5 g of ultrapure water (Milli-Q; Merck
Millipore, Billerica, MA) at room temperature for 30 min. Methanol extracts were prepared by treating 0.1
to 0.5 g of sample in 5 g of 40% (vol/vol) methanol (Sigma-Aldrich) at 40°C for 20 min. Acidic extracts
were prepared by adding 0.1 to 0.5 g of sample to 5 g of 0.01 N HCl and ultrasonicating (Ultrason 2510;
Branson, Danbury, CT) at room temperature for 20 min. All samples were microcentrifuged (14,000 rpm,
10 min), deproteinized with acetonitrile (Sigma-Aldrich) at a 1:3 ratio, and filtered through 0.2-␮m
pore-size filters (Whatman filters; GE Healthcare Life Sciences, Little Chalfont, Buckinghamshire, UK) prior
to injection. All samples were both prepared and analyzed in triplicate.
(ii) Determination of free carbohydrates and sugar alcohols. The concentrations of free carbo-
hydrates (fructose, galactose, glucose, and sucrose) were determined by high-performance anion-

Downloaded from http://aem.asm.org/ on May 2, 2020 by guest

exchange chromatography with pulsed amperometric detection (HPAEC-PAD), using an ICS 3000 chro-
matograph equipped with an AS autosampler, a CarboPac PA-100 column, and an ED-40 PAD detector
(Dionex, Sunnyvale, CA). The mobile phases consisted of ultrapure water (eluent A), 100 mM NaOH
(eluent B) (J. T. Baker, Deventer, The Netherlands), and 900 mM NaOH (eluent C) (J. T. Baker), with a
constant flow rate of 1.0 ml/min and the following gradient: 0.0 to 15.0 min, 95% A, 5% B, and 0% C; 15.5
to 22.0 min, 0% A, 0% B, and 100% C; and 22.5 to 30.0 min, 95% A, 5% B, and 0% C. The identification
of the targeted compounds was achieved by injecting pure standards (Sigma-Aldrich).
The concentrations of sugar alcohols (arabitol, erythritol, galactitol, glycerol, mannitol, myo-inositol,
sorbitol, and xylitol) were determined by HPAEC-PAD, using the same chromatograph as mentioned
above, but equipped with a CarboPac MA-1 column (Dionex). The mobile phases consisted of ultrapure
water (eluent A) and 730 mM NaOH (eluent B) (J. T. Baker), with a constant flow rate of 1.0 ml/min and
the following gradient: 0.0 to 15.0 min, 90% A and 10% B; 40.0 to 55.0 min, 0% A and 100% B; and 55.5
to 65.0 min, 90% A and 10% B. Targeted compounds were identified by injecting pure standards
(Sigma-Aldrich).
All above-mentioned compounds in the water extracts were quantified by external calibration,
including rhamnose as an internal standard (IS).
(iii) Determination of short-chain fatty acids and ethanol. Short-chain fatty acids (SCFAs) (namely,
acetic acid, propionic acid, butyric acid, isobutyric acid, valeric acid, isovaleric acid, and hexanoic acid)
and ethanol were quantified through gas chromatography with flame ionization detection (GC-FID),
using a Focus GC apparatus equipped with an AS 3000 autosampler and a flame ionization detector
(Interscience, Breda, The Netherlands) and a Stabilwax-DA column (Restek, Bellefonte, PA). Samples (1 ␮l)
were injected into the column directly, applying a split ratio of 1:20. The injector temperature was set at
270°C. The oven temperature was programmed as follows: first 40°C for 5 min, followed by a temperature
increase to 225°C at a rate of 10°C/min, and then held at 225°C for 5 min. The detector temperature was
set at 250°C. Helium (Air Liquide) was used as the carrier gas at a constant flow rate of 1.0 ml/min, and
nitrogen gas (Air Liquide) was used as the make-up gas. The volatile compounds were identified by
injecting pure standards (Merck). The compounds in the water extracts were quantified by external
calibration, with the inclusion of 1-butanol (Merck) as an IS.
(iv) Determination of organic acids and coffee bean-specific compounds. Organic acids (citric
acid, fumaric acid, gluconic acid, glucuronic acid, isocitric acid, lactic acid, malic acid, oxalic acid,
quinic acid, and succinic acid) and coffee bean-specific compounds, namely, caffeine, caffeic acid,
and six chlorogenic acid [CGA] isomers (3-, 4-, and 5-caffeoylquinic acids [CQAs], and 3,4-, 3,5-, and
4,5-diCQAs), and trigonelline, were determined by ultraperformance liquid chromatography coupled
to mass spectrometry (UPLC-MS), using an Acquity system equipped with an HSS T3 column (150
mm by 2.1 mm; internal diameter, 1.8 ␮m) and a TQ tandem mass spectrometer with a ZSpray
electrospray ionization source operating both in the negative (organic acids and CGAs) and positive
(other coffee bean-specific compounds) ion modes (Waters, Milford, MA). The following eluents were
used: ultrapure water with 0.2% (vol/vol) formic acid (eluent A) (Fluka, St. Louis, MO) and a mixture
of methanol (Sigma-Aldrich) and water (950:50) with 0.2% (vol/vol) formic acid (eluent B) (Fluka). In
the case of organic acids and coffee-specific compounds (except for CGAs), the gradient elution was
as follows: 0.0 to 1.5 min, isocratic 10% B; 1.5 to 3.0 min, linear from 10 to 90% B; 3.0 to 4.0 min,
isocratic 90% B; 4.0 to 4.1 min, linear from 90 to 10% B; and 4.1 to 6.0 min, isocratic 10% B. In the
case of CGAs, this was 0.0 to 1.5 min, isocratic 10% B; 1.5 to 12.0 min, linear from 10 to 20% B; 12.0
to 20.0 min, linear from 20 to 68% B; 20.0 to 20.2 min, linear from 68 to 100% B; 20.2 to 22.0 min,
isocratic 100% B; 22.0 to 22.2 min, linear from 100 to 10% B; and 22.2 to 25.0 min, isocratic 10% B.
The flow rate was kept constant at 0.3 ml/min. The targeted compounds were identified by injecting
pure standards (CGAs were from Biopurify, Chengdu, China; other compounds used as standards
were from Sigma-Aldrich). CGAs in the methanol extracts, and organic acids and other coffee
bean-specific compounds in acidic extracts, were quantified by external calibration. The reaction
monitoring method that was selected was optimized by IntelliStart (see Table S1 in the supplemen-
tal material).
Statistical analysis. The microbial community structure data obtained through HTS were exported
in BIOM format files and imported in the R environment for statistical analysis (www.R-project.org). The
OTU tables of bacteria and fungi were preprocessed (i.e., removal of global singletons, alpha-diversity,

January 2017 Volume 83 Issue 1 e02398-16 aem.asm.org 13

De Bruyn et al. Applied and Environmental Microbiology

and rarefaction) by implementing the vegan package (http://CRAN.R-project.org/package⫽vegan). The

phyloseq package was used to construct principal-coordinate analysis (PCoA) plots based on Bray-Curtis
dissimilarities (71). Additionally, a Spearman rank-order correlation matrix was employed to evaluate the
dependence among genera. The co-occurrence and coexclusion relationships between all microbial
genera were only considered when the correlation was significant at a confidence level of 99%. The
quantitative data from the metabolite target analyses were subjected to principal-component analysis
(PCA) to identify patterns associated with the coffee processing method applied. One-way analysis of
variance (ANOVA) was conducted for the determination of differences in metabolite concentrations
between samples, and Duncan’s test was employed. A probability level of 0.05 was considered to be
significant for all statistical procedures, and only those data are reported here. All statistical analyses and
tests performed were executed through the SPSS v.20 package (IBM, Chicago, IL).
Accession number(s). All sequences generated were submitted to the European Nucleotide Archive
of the European Bioinformatics Institute (ENA/EBI) under accession number PRJEB14106 and are available
at http://www.ebi.ac.uk/ena/data/view/PRJEB14106.

SUPPLEMENTAL MATERIAL

Downloaded from http://aem.asm.org/ on May 2, 2020 by guest

Supplemental material for this article may be found at https://doi.org/10.1128/
AEM.02398-16.
TEXT S1, PDF file, 0.6 MB.

ACKNOWLEDGMENTS
We acknowledge financial support from the Research Council of the Vrije Univer-
siteit Brussel (SRP7 and IOF342 projects), the Hercules Foundation (grant UABR09004),
and Nestec S.A., a subsidiary of Nestlé S.A.
Cyril Moccand and Jay Siddharth are acknowledged for critical reading of the
manuscript and Arne Glabasnia and Frédéric Mestdagh for their advice on the analytical
methods.

REFERENCES
1. Sakiyama NS, Ferrão MA. 2014. Botany and production of coffee, p
341–365. In Schwan RF, Fleet GH (ed), Cocoa and coffee fermentations,
1st ed. CRC Press, Boca Raton, FL.
2. Waters DM, Moroni AV, Arendt EK. 2015. Biochemistry, germination and
microflora associated with Coffea arabica and Coffea canephora green
coffee beans. Crit Rev Food Sci Nutr https://doi.org/10.1080/
10408398.2014.902804.
3. Batista LR, Chalfoun SM. 2014. Quality of coffee beans, p 477–508. In
Schwan RF, Fleet GH (ed), Cocoa and coffee fermentations, 1st ed. CRC
Press, Boca Raton, FL.
4. Brando CHJ, Brando MF. 2014. Methods of coffee fermentation and
drying, p 367–396. In Schwan RF, Fleet GH (ed), Cocoa and coffee
fermentations, 1st ed. CRC Press, Boca Raton, FL.
5. Avallone S, Guyot B, Brillouet JM, Olguin E, Guiraud JP. 2001. Microbio-
logical and biochemical study of coffee fermentation. Curr Microbiol
42:252–256. https://doi.org/10.1007/s002840010213.
6. Avallone S, Guiraud JP, Guyot B, Brillouet JM, Olguin E. 2001. Fate of
mucilage cell wall polysaccharides during coffee fermentation. J Agric
Food Chem 49:5556 –5559. https://doi.org/10.1021/jf010510s.
7. Avallone S, Brillouet JM, Guyot B, Olguin E, Guiraud JP. 2002. Involvement of
pectolytic micro-organisms in coffee fermentation. Int J Food Sci Technol
37:191–198. https://doi.org/10.1046/j.1365-2621.2002.00556.x.
8. Batista LR, Chalfoun SM, Silva CF, Cirillo M, Varga EA, Schwan RF. 2009.
Ochratoxin A in coffee beans (Coffea arabica L.) processed by dry and
wet methods. Food Control 20:784 –790. https://doi.org/10.1016/
j.foodcont.2008.10.003.
9. Duarte GS, Pereira AA, Farah A. 2010. Chlorogenic acids and other
relevant compounds in Brazilian coffees processed by semi-dry and wet
postharvesting methods. Food Chem 118:851– 855. https://doi.org/
10.1016/j.foodchem.2009.05.042.
10. Evangelista RS, da Cruz MG, Silva CF, Pinheiro ACM, Schwan RF. 2015.
Microbiology diversity associated with the spontaneous wet method of
coffee fermentation. Int J Food Microbiol 210:102–112. https://doi.org/
10.1016/j.ijfoodmicro.2015.06.008.
11. Masoud W, Cesar LB, Jespersen L, Jakobsen M. 2004. Yeast involved in
fermentation of Coffea arabica in East Africa determined by genotyping
and by direct denaturating gradient gel electrophoresis. Yeast 21:
549 –556. https://doi.org/10.1002/yea.1124.
12. Masoud W, Jespersen L. 2006. Pectin degrading enzymes in yeasts involved
in fermentation of Coffea arabica in East Africa. Int J Food Microbiol 110:
291–296. https://doi.org/10.1016/j.ijfoodmicro.2006.04.030.
13. Nasanit R, Satayawut K. 2015. Microbiological study during coffee fer-
mentation of Coffea arabica var. chiangmai 80 in Thailand. Kasetsart J
Nat Sci 49:32– 41.
14. Pereira GVDM, Soccol VT, Pandey A, Medeiros ABP, Lara JMRA, Gollo AL,
Soccol CR. 2014. Isolation, selection and evaluation of yeasts for use in
fermentation of coffee beans by the wet process. Int J Food Microbiol
188:60 – 66. https://doi.org/10.1016/j.ijfoodmicro.2014.07.008.
15. Pereira GV, Neto E, Soccol VT, Medeiros ABP, Woiciechowski AL, Soccol
CR. 2015. Conducting starter culture-controlled fermentations of coffee
beans during on-farm wet processing: growth, metabolic analyses and
sensorial effects. Food Res Int 75:348 –356. https://doi.org/10.1016/
j.foodres.2015.06.027.
16. Silva CF, Schwan RF, Dias ES, Wheals AE. 2000. Microbial diversity during
maturation and natural processing of coffee cherries of Coffea arabica in
Brazil. Int J Food Microbiol 60:251–260. https://doi.org/10.1016/S0168
-1605(00)00315-9.
17. Silva CF, Batista LR, Schwan RF. 2008. Incidence and distribution of
filamentous fungi during fermentation, drying and storage of coffee
(Coffea arabica L.) beans. Braz J Microbiol 39:521–526. https://doi.org/
10.1590/S1517-83822008000300022.
18. Silva CF, Batista LR, Abreu LM, Dias ES, Schwan RF. 2008. Succession of
bacterial and fungal communities during natural coffee (Coffea arabica)
fermentation. Food Microbiol 25:951–957. https://doi.org/10.1016/
j.fm.2008.07.003.
19. Pereira GVM, Soccol VT, Brar SK, Neto E, Soccol CR. 13 October 2016.
Microbial ecology and starter culture technology in coffee processing.
Crit Rev Food Sci Nutr https://doi.org/10.1080/10408398.2015.1067759.
20. Silva CF. 2014. Microbial activity during coffee fermentation, p 397– 430.
In Schwan RF, Fleet GH (ed), Cocoa and coffee fermentations, 1st ed. CRC
Press, Boca Raton, FL.
21. Vaughan MJ, Mitchel T, McSpadden Gardener BB. 2015. What’s inside the
seed that we brew? A new approach to mining the coffee microbiome.
Appl Environ Microbiol 81:6518 – 6527. https://doi.org/10.1128/
AEM.01933-15.
22. Hamdouche Y, Meile JC, Nganou DN, Durand N, Teyssier C, Montet D.

January 2017 Volume 83 Issue 1 e02398-16 aem.asm.org 14

Microbiota and Metabolites during Coffee Processing
2016. Discrimination of post-harvest coffee processing methods by mi-
crobial ecology analyses. Food Control 65:112–120. https://doi.org/
10.1016/j.foodcont.2016.01.022.
23. Avallone S, Guiraud JP, Guyot B, Olguin E, Brillouet JM. 2000. Polysac-
charide constituents of coffee-bean mucilage. J Food Sci 65:1308 –1311.
https://doi.org/10.1111/j.1365-2621.2000.tb10602.x.
24. Lee LW, Cheong MW, Curran P, Yu B, Liu SQ. 2015. Coffee fermentation
and flavor—an intricate and delicate relationship. Food Chem 185:
182–191. https://doi.org/10.1016/j.foodchem.2015.03.124.
25. Velmourougane K, Bhat R, Gopinandhan TN, Panneerselvam P. 2011.
Impact of delay in processing on mold development, ochratoxin-A and
cup quality in Arabica and Robusta coffee. World J Microbiol Biotechnol
27:1809 –1816. https://doi.org/10.1007/s11274-010-0639-5.
26. Vilela DM, Pereira GV, Silva CF, Batista LR, Schwan RF. 2010. Molecular
ecology and polyphasic characterization of the microbiota associated
with semi-dry processed coffee (Coffea arabica L.). Food Microbiol 27:
1128 –1135. https://doi.org/10.1016/j.fm.2010.07.024.
27. Silva CF, Vilela DM, de Souza Cordeiro C, Duarte WF, Dias DR, Schwan RF.
2013. Evaluation of a potential starter culture for enhance quality of
coffee fermentation. World J Microbiol Biotechnol 29:235–247. https://
doi.org/10.1007/s11274-012-1175-2.
28. Bytof G, Knopp SE, Schieberle P, Teutsch I, Selmar D. 2005. Influence of
processing on the generation of ␥-aminobutyric acid in green coffee
beans. Eur Food Res Technol 220:240 –245.
29. Kleinwächter M, Selmar D. 2010. Influence of drying on the content of
sugars in wet processed green Arabica coffees. Food Chem 119:
500 –504. https://doi.org/10.1016/j.foodchem.2009.06.048.
30. Knopp S, Bytof G, Selmar D. 2005. Influence of processing on the content
of sugars in green Arabica coffee beans. Eur Food Res Technol 223:
195–201.
31. Kramer D, Breitenstein B, Kleinwächter M, Selmar D. 2010. Stress metab-
olism in green coffee beans (Coffea arabica L.): expression of dehydrins
and accumulation of GABA during drying. Plant Cell Physiol 4:546 –553.
32. Selmar Bytof DG, Knopp SE, Breitenstein B. 2006. Germination of coffee
seeds and its significance for coffee quality. Plant Biol 8:260 –264. https://
doi.org/10.1055/s-2006-923845.
33. Selmar D, Bytof G, Knopp SE. 2008. The storage of green coffee (Coffea
arabica): decrease of viability and changes of potential aroma precur-
sors. Ann Bot 101:31–38.
34. Bokulich NA, Mills DA. 2013. Improved selection of internal transcribed
spacer-specific primers enables quantitative, ultra-high-throughput pro-
filing of fungal communities. Appl Environ Microbiol 79:2519 –2526.
https://doi.org/10.1128/AEM.03870-12.
35. Lindow SE, Brandl MT. 2003. Microbiology of the phyllosphere. Appl
Environ Microbiol 69:1875–1883. https://doi.org/10.1128/AEM.69.4.1875
-1883.2003.
36. Lindow SE, Leveau JHJ. 2002. Phyllosphere microbiology. Curr Opin
Biotechnol 13:238 –243. https://doi.org/10.1016/S0958-1669(02)00313-0.
37. Camu N, De Winter T, Verbrugghe K, Cleenwerck I, Vandamme P,
Takrama JS, Vancanneyt M, De Vuyst L. 2007. Dynamics and biodiversity
of populations of lactic acid bacteria and acetic acid bacteria involved in
spontaneous heap fermentation of cocoa beans in Ghana. Appl Environ
Microbiol 73:1809 –1824. https://doi.org/10.1128/AEM.02189-06.
38. Papalexandratou Z, Vrancken G, De Bruyne K, Vandamme P, De Vuyst L.
2011. Spontaneous organic cocoa bean box fermentations in Brazil are
characterized by a restricted species diversity of lactic acid bacteria and
acetic acid bacteria. Food Microbiol 28:1326 –1338. https://doi.org/
10.1016/j.fm.2011.06.003.
39. Van der Meulen R, Scheirlinck I, Van Schoor A, Huys G, Vancanneyt M,
Vandamme P, De Vuyst L. 2007. Population dynamics and metabolite
target analysis of lactic acid bacteria during laboratory fermentations of
wheat and spelt sourdoughs. Appl Environ Microbiol 73:4741– 4750.
https://doi.org/10.1128/AEM.00315-07.
40. Wouters D, Grosu-Tudor S, Zamfir M, De Vuyst L. 2012. Bacterial com-
munity dynamics, lactic acid bacteria species diversity and metabolite
kinetics of traditional Romanian vegetable fermentations. J Sci Food Agr
93:749 –760. https://doi.org/10.1002/jsfa.5788.
41. Papalexandratou Z, Falony G, Romanens E, Jimenez JC, Amores F, Daniel
HM, De Vuyst L. 2011. Species diversity, community dynamics, and
metabolite kinetics of the microbiota associated with traditional Ecua-
dorian spontaneous cocoa bean fermentations. Appl Environ Microbiol
77:7698 –7714. https://doi.org/10.1128/AEM.05523-11.
42. De Angelis M, Gobbetti M. 2004. Environmental stress responses in
January 2017 Volume 83 Issue 1 e02398-16
Applied and Environmental Microbiology
Lactobacillus: a review. Proteomics 4:106 –122. https://doi.org/10.1002/
pmic.200300497.
43. De Vuyst L, Van Kerrebroeck S, Harth H, Huys G, Daniel H-M, Weckx S.
2014. Microbial ecology of sourdough fermentations: diverse or uni-
form? Food Microbiol 37:11–29. https://doi.org/10.1016/
j.fm.2013.06.002.
44. Di Cagno R, Coda R, De Angelis M, Gobbetti M. 2013. Exploitation of
vegetables and fruits through lactic acid fermentation. Food Microbiol
33:1–10. https://doi.org/10.1016/j.fm.2012.09.003.
45. Carvalheiro F, Moniz P, Duarte LC, Esteves MP, Gírio FM. 2011. Mannitol
production by lactic acid bacteria grown in supplemented carob syrup.
J Ind Microbiol Biotechnol 38:221–227. https://doi.org/10.1007/s10295
-010-0823-5.
46. Bytof G, Knopp SE, Kramer D, Breitenstein B, Bergervoet JHW, Groot SPC.
2007. Transient occurrence of seed germination processes during coffee
post-harvest treatment. Ann Bot 100:61– 66. https://doi.org/10.1093/
aob/mcm068.
Downloaded from http://aem.asm.org/ on May 2, 2020 by guest
47. Fukao T, Baily-Serres J. 2004. Plant responses to hypoxia – Is survival a
balancing act? Trends Plant Sci 9:449 – 456. https://doi.org/10.1016/
j.tplants.2004.07.005.
48. Velmourougane K. 2011. Effects of wet processing methods and subse-
quent soaking of coffee under different organic acids on cup quality.
World J Sci Technol 1:32–38.
49. Kim D, Baik KS, Kim MS, Park SC, Kim SS, Rhee MS, Kwak YS, Seong CN.
2008. Acetobacter soli sp. nov., isolated from forest soil. J Microbiol
46:396 – 401. https://doi.org/10.1007/s12275-008-0118-y.
50. Kurtzman CP, Smith MT. 1998. Description of teleomorphic ascomycet-
ous genera and species, p 376 –383. In Kurtzman CP, Fell JW (ed), The
yeasts: a taxonomic study, 2nd ed. Elsevier Science, Amsterdam, The
Netherlands.
51. Kersters K, Lisdiyanti P, Komagata K, Swings J. 2006. The family
Acetobacteraceae: the genera Acetobacter, Acidomonas, Asaia, Gluconac-
etobacter, Gluconobacter, and Kozakia, p 163–200. In Dworkin M, Falkow
S, Rosenberg E, Schleifer K-H, Stackebrandt E (ed), The prokaryotes, 4th
ed. Springer, New York, NY.
52. Montavon P, Duruz E, Rumo G, Pratz G. 2003. Evolution of green
coffee protein profiles with maturation and relationship to coffee cup
quality. J Agric Food Chem 51:2328 –2334. https://doi.org/10.1021/
jf020831j.
53. Balyaya KJ, Clifford MN. 1995. Individual chlorogenic acids and caffeine
contents in commercial grades of wet and dry processed Indian green
Robusta coffee. J Food Sci Technol 32:104 –108.
54. Arnold U, Ludwig E. 1996. Analysis of free amino acids in green coffee
beans. Z Lebensm Unters Forsch 203:379 –384. https://doi.org/10.1007/
BF01231078.
55. Gonzalez-Rios O, Suarez-Quiroz ML, Boulanger R, Barel M, Guyot B,
Guiraud J-P, Schorr-Galindo S. 2007. Impact of “ecological” post-harvest
processing on the volatile fraction of coffee beans: I. Green coffee. J
Food Compos Anal 20:289 –296. https://doi.org/10.1016/
j.jfca.2006.07.009.
56. Lyman DJ, Benck RM, Merle SF. 2011. Difference spectroscopy in the
analysis of the effects of coffee cherry processing variables on the flavor
of brewed coffee. Int J Spectrosc 2011:815304. https://doi.org/10.1155/
2011/815304.
57. Tarzia A, Dos Santos Scholz MB, De Oliveira Petkowicz CL. 2010. Influ-
ence of the postharvest processing method on polysaccharides and
coffee beverages. Int J Food Sci Technol 45:2167–2175. https://doi.org/
10.1111/j.1365-2621.2010.02388.x.
58. Yeretzian C, Jordan A, Badoud R, Lindinger W. 2014. From the green
bean to the cup of coffee: investigating coffee roasting by on-line
monitoring of volatiles. Eur Food Res Technol 214:92–104.
59. Dirk S, Maik K, Gerhard B. 2014. Metabolic responses of coffee beans
during processing and their impact on coffee flavor, p 431– 476. In
Schwan RF, Fleet GH (ed), Cocoa and coffee fermentations, 1st ed. CRC
Press, Boca Raton, FL.
60. Gonzalez-Rios O, Suarez-Quiroz ML, Boulanger R, Barel M, Guyot B,
Guiraud J-P, Schorr-Galindo S. 2007. Impact of “ecological” post-harvest
processing on coffee aroma: II. Roasted coffee. J Food Compos Anal
20:297–307. https://doi.org/10.1016/j.jfca.2006.12.004.
61. Farah A, de Paulis L, Trugo LC, Martin PR. 2005. Effect of roasting on the
formation of chlorogenic acid lactones in coffee. J Agric Food Chem
53:1505–1513. https://doi.org/10.1021/jf048701t.
62. Lefeber T, Papalexandratou Z, Gobert W, Camu N, De Vuyst L. 2012.
On-farm implementation of a starter culture for improved cocoa bean
aem.asm.org 15
De Bruyn et al.
fermentation and its influence on the flavour of chocolates produced
thereof. Food Microbiol 30:379 –392. https://doi.org/10.1016/
j.fm.2011.12.021.
63. De Vuyst L, Weckx S. 2016. The cocoa bean fermentation process: from
ecosystem analysis to starter culture development. J Appl Microbiol
121:5–17. https://doi.org/10.1111/jam.13045.
64. Caporaso JG, Lauber CL, Walters WA, Berg-Lyons D, Lozupone CA,
Turnbaugh PJ, Fierer N, Knight R. 2011. Global patterns of 16S rRNA
diversity at a depth of millions of sequences per sample. Proc Natl Acad
Sci U S A 108:4516 – 4522. https://doi.org/10.1073/pnas.1000080107.
65. Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, Hollister EB,
Lesniewski RA, Oakley BB, Parks DH, Robinson CJ, Sahl JW, Stres B,
Thallinger GG, Van Horn DJ, Weber CF. 2009. Introducing mothur:
open-source, platform-independent, community-supported software
for describing and comparing microbial communities. Appl Environ
Microbiol 75:7537–7541. https://doi.org/10.1128/AEM.01541-09.
66. Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R. 2011. UCHIME
improves sensitivity and speed of chimera detection. Bioinformatics
27:2194 –2200. https://doi.org/10.1093/bioinformatics/btr381.
January 2017 Volume 83 Issue 1 e02398-16
Applied and Environmental Microbiology
67. Martin M. 2011. Cutadapt removes adapter sequences from high-
throughput sequencing reads. EMBnetJ 17:1–10. https://doi.org/
10.14806/ej.17.1.200.
68. Gweon HS, Oliver A, Taylor J, Booth T, Gibbs M, Read DS, Griffiths RI,
Schonrogge K. 2015. PIPITS: an automated pipeline for analyses of
fungal internal transcribed spacer sequences from the Illumina sequenc-
ing platform. Methods Ecol Evol 6:973–980. https://doi.org/10.1111/2041
-210X.12399.
69. Findley K, Oh J, Yang J, Conlan S, Deming C, Meyer JA, Schoenfeld D,
Nomicos E, Park M, NIH Intramural Sequencing Center Comparative
Sequencing Program, Kong HH, Segre JA. 2013. Topographic diversity of
fungal and bacterial communities in human skin. Nature 498:367–370.
https://doi.org/10.1038/nature12171.
70. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local
alignment search tool. J Mol Biol 215:403– 410. https://doi.org/10.1016/
S0022-2836(05)80360-2.
71. McMurdie PJ, Holmes S. 2013. phyloseq: an R package for reproducible
Downloaded from http://aem.asm.org/ on May 2, 2020 by guest
interactive analysis and graphics of microbiome census data. PLoS One
8:e61217. https://doi.org/10.1371/journal.pone.0061217.
aem.asm.org 16