Report

A Novel Bat Coronavirus Closely Related to SARS-

CoV-2 Contains Natural Insertions at the S1/S2
Cleavage Site of the Spike Protein
Highlights
d Metagenomic analysis identified a novel coronavirus,
RmYN02, from R. malayanus
Authors
Hong Zhou, Xing Chen, Tao Hu, ...,
Alice C. Hughes, Yuhai Bi, Weifeng Shi

d RmYN02 was the closest relative of SARS-CoV-2 in most of Correspondence

the virus genome
ach_conservation2@hotmail.com
(A.C.H.),
d Two loop deletions in RBD may reduce the binding of
beeyh@im.ac.cn (Y.B.),
RmYN02 with ACE2 shiwf@ioz.ac.cn (W.S.)

d RmYN02 contains an insertion at the S1/S2 cleavage site in

In Brief
the spike protein
Zhou et al. report a bat-derived
coronavirus, RmYN02, which is the
closest relative of SARS-CoV-2 in most of
the virus genome reported to date.
RmYN02 contains an insertion at the S1/
S2 cleavage site in the spike protein in a
similar manner to SARS-CoV-2. This
suggests that such insertion events can
occur naturally in animal
betacoronaviruses.

Zhou et al., 2020, Current Biology 30, 1–8

June 8, 2020 ª 2020 Elsevier Inc.
https://doi.org/10.1016/j.cub.2020.05.023 ll
 Please cite this article in press as: Zhou et al., A Novel Bat Coronavirus Closely Related to SARS-CoV-2 Contains Natural Insertions at the S1/S2
Cleavage Site of the Spike Protein, Current Biology (2020), https://doi.org/10.1016/j.cub.2020.05.023

ll

Report
A Novel Bat Coronavirus Closely Related
to SARS-CoV-2 Contains Natural Insertions
at the S1/S2 Cleavage Site of the Spike Protein
Hong Zhou,1,8 Xing Chen,2,8 Tao Hu,1,8 Juan Li,1,8 Hao Song,3 Yanran Liu,1 Peihan Wang,1 Di Liu,4 Jing Yang,5
Edward C. Holmes,6 Alice C. Hughes,2,* Yuhai Bi,5,* and Weifeng Shi1,7,9,*
1Key Laboratory of Etiology and Epidemiology of Emerging Infectious Diseases in Universities of Shandong, Shandong First Medical

University, and Shandong Academy of Medical Sciences, Taian 271000, China

2Landscape Ecology Group, Center for Integrative Conservation, Xishuangbanna Tropical Botanical Garden, Chinese Academy of Sciences,

Menglun, Mengla, Yunnan 666303, China

3Research Network of Immunity and Health (RNIH), Beijing Institutes of Life Science, Chinese Academy of Sciences, Beijing 100101, China
4Computational Virology Group, Center for Bacteria and Virus Resources and Bioinformation, Wuhan Institute of Virology, Chinese Academy

of Sciences, Wuhan 430071, China

5CAS Key Laboratory of Pathogenic Microbiology and Immunology, Institute of Microbiology, CAS Center for Influenza Research and

Early-Warning (CASCIRE), CAS-TWAS Center of Excellence for Emerging Infectious Diseases (CEEID), Chinese Academy of Sciences, Beijing
100101, China
6Marie Bashir Institute for Infectious Diseases and Biosecurity, School of Life and Environmental Sciences and School of Medical Sciences,

The University of Sydney, Sydney, NSW 2006, Australia

7The First Affiliated Hospital of Shandong First Medical University (Shandong Provincial Qianfoshan Hospital), Ji’nan 250014, China
8These authors contributed equally
9Lead Contact

*Correspondence: ach_conservation2@hotmail.com (A.C.H.), beeyh@im.ac.cn (Y.B.), shiwf@ioz.ac.cn (W.S.)

https://doi.org/10.1016/j.cub.2020.05.023

SUMMARY

The unprecedented pandemic of pneumonia caused by a novel coronavirus, SARS-CoV-2, in China and
beyond has had major public health impacts on a global scale [1, 2]. Although bats are regarded as the
most likely natural hosts for SARS-CoV-2 [3], the origins of the virus remain unclear. Here, we report a novel
bat-derived coronavirus, denoted RmYN02, identified from a metagenomic analysis of samples from 227
bats collected from Yunnan Province in China between May and October 2019. Notably, RmYN02 shares
93.3% nucleotide identity with SARS-CoV-2 at the scale of the complete virus genome and 97.2% identity
in the 1ab gene, in which it is the closest relative of SARS-CoV-2 reported to date. In contrast, RmYN02
showed low sequence identity (61.3%) to SARS-CoV-2 in the receptor-binding domain (RBD) and might
not bind to angiotensin-converting enzyme 2 (ACE2). Critically, and in a similar manner to SARS-CoV-2,
RmYN02 was characterized by the insertion of multiple amino acids at the junction site of the S1 and S2 sub-
units of the spike (S) protein. This provides strong evidence that such insertion events can occur naturally in
animal betacoronaviruses.

RESULTS AND DISCUSSION
Coronaviruses (CoVs) are common viral respiratory pathogens
that primarily cause symptoms in the upper respiratory and
gastrointestinal tracts. In 1960s, two CoVs, 229E and OC43,
were identified in clinical samples from patients experiencing
the common cold [4]. More recently, four additional human
CoVs have been successively identified: severe acute respira-
tory syndrome coronavirus (SARS-CoV) in 2002, NL63 in late
2004, HKU1 in January 2005, and Middle East respiratory syn-
drome coronavirus (MERS-CoV) in 2012. However, two betacor-
onaviruses (beta-CoVs), SARS-CoV and MERS-CoV, are notable
as they have caused severe and fatal infections, leading to 774
and 858 deaths to date, respectively, suggesting that beta-
CoVs may be of particular concern to human health. In
December 2019, viral pneumonia caused by an unidentified mi-
crobial agent was reported, which was soon identified to be a
novel coronavirus [1–3], now termed SARS-CoV-2 [5]. The num-
ber of patients infected with SARS-CoV-2 has increased sharply
since January 21, 2020, and confirmed SARS-CoV-2 cases were
present in all the Chinese provinces and municipalities by the
end of January. The virus also spread rapidly outside of China
in March and the World Health Organization had to declare a
coronavirus disease 2019 (COVID-19) pandemic on March 11,
2020. As of April 15, 2020, more than two million confirmed
SARS-CoV-2 cases have been reported, with >130,000 deaths
worldwide.
An epidemiological survey of several SARS-CoV-2 cases at an
early stage of the outbreak revealed that most had visited the
Huanan seafood market in Wuhan city prior to illness, where

Current Biology 30, 1–8, June 8, 2020 ª 2020 Elsevier Inc. 1

 Please cite this article in press as: Zhou et al., A Novel Bat Coronavirus Closely Related to SARS-CoV-2 Contains Natural Insertions at the S1/S2
Cleavage Site of the Spike Protein, Current Biology (2020), https://doi.org/10.1016/j.cub.2020.05.023

ll
Report

Table 1. Sequence Identity for SARS-CoV-2 Compared with RmYN02 and Representative Beta-CoV Genomes
Complete Gene Region
Strain Genome 1ab S RBD 3a E M 6 7a 7b 8 N 10
Nucleotide RmYN02 93.3%a 97.2% 71.9% 61.3% 96.4% 98.7% 94.8% 96.8% 96.2% 92.4% 45.8% 97.3% 99.1%
sequences RaTG13 96.1% 96.5% 92.9% 85.3% 96.3% 99.6% 95.4% 98.4% 95.6% 99.2% 97.0% 96.9% 99.1%
ZC45 87.6% 89.0% 75.1% 62.1% 87.8% 98.7% 93.4% 95.2% 88.8% 94.7% 88.5% 91.1% 99.1%
ZXC21 87.4% 88.7% 74.6% 60.6% 88.9% 98.7% 93.4% 95.2% 89.1% 95.5% 88.5% 91.2% /
pangolin/ – 90.8% 89.3% – 93.4% 98.3% 93.1% 94.6% 93.4% – 92.1% 96.1% –
GD/2019b
pangolin/ 85.2% 84.7% 83.2% 79.9% 87.0% 97.4% 91.3% 90.9% 86.6% 81.8% 80.6% 91.0% 94.0%
GX/P5L/2017
SARS-CoV 78.9% 79.6% 72.3% 73.8% 75.6% 93.5% 85.1% 74.5% 82.1% 83.0% 45.3% 88.1% /
GZ02
Amino acid RmYN02 N/A 98.8% 72.9% 62.4% 96.7% 100.0% 98.2% 96.7% 95.9% 83.7% 27.3% 98.6% 97.4%
sequences RaTG13 N/A 98.5% 97.4% 89.3% 97.8% 100.0% 98.6% 100.0% 97.5% 97.7% 95.0% 99.0% 97.4%
ZC45 N/A 95.6% 80.2% 63.5% 90.9% 100.0% 98.6% 93.4% 87.6% 93.0% 94.2% 94.3% 97.4%
ZXC21 N/A 95.2% 79.6% 62.9% 92.0% 100.0% 98.6% 93.4% 88.4% 93.0% 94.2% 94.3% /
pangolin/ N/A 97.1% 90.7% 97.4% 97.4% 100.0% 98.6% 96.6% 97.5% – 94.9% 97.6% –
GD/2019b
pangolin/ N/A 92.6% 92.4% 86.8% 89.8% 100.0% 98.2% 95.1% 88.4% 72.1% 87.6% 93.8% 84.2%
GX/P5L/2017
SARS-CoV N/A 86.2% 76.2% 74.6% 73.1% 94.7% 89.6% 68.9% 85.2% 79.5% 29.7% 90.5% /
GZ02
Pangolin/GD/2019 and pangolin/GX/P5L/2017 (EPI_ISL_410540). –, no corresponding values in [6]; /, this open reading frame is not found; N/A, not
available.
a
Sequence identities for RmYN02 compared with the SARS-CoV GZ02 (accession number AY390556); the bat SARS-like coronaviruses RaTG13 (EP-
I_ISL_402131), ZC45 (MG772933), and ZXC21 (MG772934); and the pangolin SARS-like coronaviruses
b
Pangolin/GD/2019 represents a merger of GD/P1L and GD/P2S, and these values were adapted from [6]

various wild animals were on sale before it was closed on
January 1, 2020, due to the outbreak. Phylogenetic analysis
has revealed that SARS-CoV-2 is a novel beta-CoV distinct
from SARS-CoV and MERS-CoV [1–3]. To date, the most closely
related virus to SARS-CoV-2 is RaTG13, identified from a Rhino-
lophus affinis bat sampled in Yunnan province in 2013 [3]. This
virus shared 96.1% nucleotide identity and 92.9% identity in
the S gene, again suggesting that bats play a key role as corona-
virus reservoirs [3]. Notably, however, several novel beta-CoVs
related to SARS-CoV-2 have also been identified in Malayan
pangolins (Manis javanica) that were illegally imported into
Guangxi (GX) and Guangdong (GD) provinces, southern China
[6–8]. Although these pangolin CoVs are more distant to SARS-
CoV-2 than RaTG13 across the virus genome as a whole, they
are very similar to SARS-CoV-2 in the receptor-binding domain
(RBD) of the S protein, including at the amino acid residues
thought to mediate binding to ACE2 [7]. It is therefore possible
that pangolins play an important role in the ecology and evolution
of CoVs. Indeed, the discovery of viruses in pangolins suggests
that there is a wide diversity of CoVs still to be sampled in wildlife,
some of which may be directly involved in the emergence of
SARS-CoV-2.
Between May and October 2019, we collected a total of 302
samples from 227 bats from Mengla County, Yunnan Province
in southern China (Table S1). These bats belonged to 20 different
species, with the majority of samples from Rhinolophus malaya-
nus (n = 48, 21.1%), Hipposideros larvatus (n = 41, 18.1%), and
Rhinolophus stheno (n = 39, 17.2%). The samples comprised
multiple tissues, including patagium (n = 219), lung (n = 2) and
liver (n = 3), and feces (n = 78). All but three bats were sampled
alive and subsequently released. Based on the bat species pri-
marily identified according to morphological criteria and
confirmed through DNA barcoding, the 224 tissues and 78 feces
were merged into 38 and 18 pools, respectively, with each pool
including 1 to 11 samples of the same type (Table S1). These
pooled samples were then used for next-generation sequencing
(NGS).
Using next-generation metagenomic sequencing, we suc-
cessfully obtained 11,954 and 64,224 reads from pool 39 (from
a total of 78,477,464 clean reads) that mapped to a previously
identified SARS-like bat coronavirus, Cp/Yunnan2011 [9]
(JX993988), and to SARS-CoV-2. From this, we generated two
preliminary consensus sequences. After a series of verification
steps, including re-mapping, one partial (23,395 bp) and one
complete (29,671 bp) beta-CoV genome sequences were ob-
tained and named BetaCoV/Rm/Yunnan/YN01/2019 (RmYN01)
and BetaCoV/Rm/Yunnan/YN02/2019 (RmYN02), respectively.
Pool 39 comprised 11 fecal samples from Rhinolophus malaya-
nus collected between May 6 and July 30, 2019. RNAs from eight
samples remained for further analysis. Based on the assembled
sequence of RmYN02, TaqMan-based qPCR was performed to
detect the existence of RmYN02 in the eight additional samples
(see primers and probe in Table S2): the virus was only detected
in sample no. 123 collected on June 25, 2019, from Rhinolophus

2 Current Biology 30, 1–8, June 8, 2020

 Please cite this article in press as: Zhou et al., A Novel Bat Coronavirus Closely Related to SARS-CoV-2 Contains Natural Insertions at the S1/S2
Cleavage Site of the Spike Protein, Current Biology (2020), https://doi.org/10.1016/j.cub.2020.05.023

ll
Report

A Simplot-Query: SARS-CoV-2
SARS-CoV-2
Consensus
6 7b
RmYN02
1ab S 3a E M 7a 8 N 10
1.0

0.9

0.8
Similarity

0.7

0.6

0.5

0.4
RmYN02 RaTG13 ZC45 ZXC21 pangolin/GX/P5L/2017 SARS-CoV GZ02
0.3

Window:1000bp, Step: 100bp, GapStrip: On, Kimura (2-parameter), T/t: 2.0

0.2
posi on 1000 2000 3000 4000 5000 6000 7000 8000 9000 10000 11000 12000 13000 14000 15000 16000 17000 18000 19000 20000 21000 22000 23000 24000 25000 26000 27000 28000 29000

B Simplot-Query: SARS-CoV-2 Spike gene (1-1658)

1.0 991 RBD 1572

[
0.9

0.8

0.7
Similarity

0.6

0.5

0.4

0.3

0.2

0.1

Posi on 50 100 150 200 250 300 350 400 450 500 550 600 650 700 750 800 850 900 950 1000 1050 1100 1150 1200 1250 1300 1350 1400 1450 1500 1550 1600

RmYN02 RaTG13 ZC45 ZXC21 pangolin/MP789/2019 pangolin/GX/P5L/2017 SARS-CoV GZ02

Window:150bp, Step: 5bp, GapStrip: On, Kimura (2-parameter), T/t: 2.0

Figure 1. Patterns of Sequence Identity between the Consensus Sequences of SARS-CoV-2 and Representative Beta-CoVs
(A) Whole-genome similarity plot between SARS-CoV-2 and representative viruses listed in Table 1. The analysis was performed using Simplot, with a window
size of 1,000 bp and a step size of 100 bp.
(B) Similarity plot in the spike gene (positions 1–1,658) between SARS-CoV-2 and representative viruses listed in Table 1. The analysis was performed using
Simplot, with a window size of 150 bp and a step size of 5 bp.
See also Table S3.

malayanus with a cycle threshold (Ct) value of 34.76 (Figure S1). were extremely similar (>96% sequence identity) in most
RmYN01 and RmYN02 were also identified in sample 123 using genomic regions (e.g., 1ab, 3a, E, 6, 7a, N, and 10) (Table 1).
Tip green supermix (TransGen), with the Ct values 32.21 for In particular, RmYN02 was 97.2% identical to SARS-CoV-2 in
RmYN02 and 35.54 for RmYN01. Sample 123 was therefore the longest encoding gene region, 1ab (21,285 nucleotides).
used to verify the RmYN02 genome sequence using the However, RmYN02 exhibited far lower sequence identity to
RmYN02-specific primers (Table S2). The partially amplified SARS-CoV-2 in the S gene (nucleotide 71.8%, amino acid
gene fragments were 10,000 bp in length covering the spike 72.9%), compared to 97.4% amino acid identity between
(Figure S2A) and 1b genes of RmYN02, and results from Sanger RaTG13 and SARS-CoV-2 (Table 1). Strikingly, RmYN02 only
sequencing were consistent with those from metagenomic possessed 62.4% amino acid identity to SARS-CoV-2 in the
sequencing. Notably, 20 positions in the RmYN02 genome dis- RBD, whereas the pangolin beta-CoV from Guangdong had
played nucleotide polymorphisms in the NGS data, although amino acid identity of 97.4% [6], and was the closest relative
these did not include the S1/S2 cleavage site (Figure S2B). of SARS-CoV-2 in this region. A similarity plot estimated using
Only a few reads in the remaining 55 pools could be mapped Simplot [10] also revealed that RmYN02 was more similar to
to the reference CoV genomes. The sequence identity between SARS-CoV-2 than RaTG13 in most genome regions (Fig-
RmYN01 and Cp/Yunnan2011 across the aligned regions was ure 1A). Again, in the RBD, the pangolin/MP789/2019 virus
96.9%, whereas that between RmYN01 and SARS-CoV-2 was shared the highest sequence identity to SARS-CoV-2
only 79.7% across the aligned regions and 70.4% in the spike (Figure 1B).
gene. Results from homology modeling [2], in vitro assays [3], and
In contrast, RmYN02 was closely related to SARS-CoV-2, resolved three-dimensional structure of the S protein [11] have
exhibiting 93.3% nucleotide sequence identity, although it revealed that like SARS-CoV, SARS-CoV-2 could also use
was less similar to SARS-CoV-2 than RaTG13 (96.1%) across ACE2 as a cell receptor. We analyzed the RBD of RmYN02,
the genome as a whole (Table 1). RmYN02 and SARS-CoV-2 RaTG13, and the two pangolin beta-CoVs using homology

Current Biology 30, 1–8, June 8, 2020 3

 Please cite this article in press as: Zhou et al., A Novel Bat Coronavirus Closely Related to SARS-CoV-2 Contains Natural Insertions at the S1/S2
Cleavage Site of the Spike Protein, Current Biology (2020), https://doi.org/10.1016/j.cub.2020.05.023

ll
Report

A RmYN02 B RaTG13 C pangolin/MP789/2019

Cys480 Cys476
Cys488 Cys484

external
subdomain

core subdomain

D pangolin/GX/P5L/2017 E SARS-CoV-2 / pangolin/MP789/2019 F SARS-CoV-2 / RmYN02

dele on
Cys478
Cys486
dele on

G
Consensus SARS-CoV-2 Y L Y R L F R K S N L K P F E R D I S T E I Y Q A G S T P C N G V E G F N C Y F P L Q S Y G F Q P T N G V G Y Q P Y R
RmYN02 Y F Y R S H R A V K L K P F E R D L S S D E - - - - - - - - N G V R - - - - - - T L S T Y D F N P N V P L D Y Q A T R
RaTG13 Y L Y R L F R K A N L K P F E R D I S T E I Y Q A G S K P C N G Q T G L N C Y Y P L Y R Y G F Y P T D G V G H Q P Y R
ZC45 Y F Y R S H R S T K L K P F E R D L S S D E - - - - - - - - N G V R - - - - - - T L S T Y D F N P N V P L E Y Q A T R
ZXC21 Y F Y R S H R S T K L K P F E R D L S S D E - - - - - - - - N G V R - - - - - - T L S T Y D F N P N V P L E Y Q A T R
pangolin/MP789/2019 Y L Y R L F R K S N L K P F E R D I S T E I Y Q A G S T P C N G V E G F N C Y F P L Q S Y G F H P T N G V G Y Q P Y R
pangolin/GX/P5L/2017 Y L Y R L F R K S K L K P F E R D I S T E I Y Q A G S T P C N G Q V G L N C Y Y P L E R Y G F H P T T G V N Y Q P F R
SARS-CoV GZ02 Y K Y R Y L R H G K L R P F E R D I S N V P F S P D G K P C T P - P A L N C Y W P L N D Y G F Y T T T G I G Y Q P Y R
RmYN01 Y Y Y R S S R K T K L K P F E R D L S S D E - - - - - - - - N G V R - - - - - - T L S T Y D F Y P S V P L E Y Q A T R
SARS-CoV-2 Numbering 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509

Receptor binding domain

（685/686, SARS-CoV-2 Numbering）

S1 S2
Consensus
Iden ty
Consensus SARS-CoV-2
RmYN02
RaTG13
ZC45
ZXC21
pangolin/MP789/2019
pangolin/GX/P5L/2017
SARS-CoV GZ02
RmYN02

H Polybasic cleavage site

SARS-CoV-2 Numbering 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693
Consensus SARS-CoV-2 G A G I C A S Y Q T Q T N S P R R A R S V A S Q S I I
RmYN02 G A G V C A S Y - - - - N S P - A A R - V G T N S I I
RaTG13 G A G I C A S Y Q T Q T N S - - - - R S V A S Q S I I
ZC45 G A G I C A S Y H T A S I L - - - - R S T S Q K A I V
ZXC21 G A G I C A S Y H T A S I L - - - - R S T G Q K A I V
pangolin/MP789/2019 G A G I C A S Y Q T Q T N S - - - - R S V S S X A I I
pangolin/GX/P5L/2017 G A G I C A S Y H S M S S F - - - - R S V N Q R S I I
SARS-CoV GZ02 G A G I C A S Y H T V S L L - - - - R S T S Q K S I V
RmYN01 G A G I C A S Y H T A S L L - - - - R N T G Q K S I V
O-linked glycan residues

Figure 2. Homology Modeling of the RBD Structures and Molecular Characterizations of the S1/S2 Cleavage Site of RmYN02 and Represen-
tative Beta-CoVs
(A–D) Homology modeling and structural comparison of the RBD structures of RmYN02 and representative beta-CoVs, including (A) RmYN02, (B) RaTG13, (C)
pangolin/MP789/2019, and (D) pangolin/GX/P5L/2017. The three-dimensional structures of the RBD from Bat-SL-CoV RmYN02, RaTG13, pangolin/MP789/
2019, and pangolin/GX/P5L/2017 were modeled using the Swiss-Model program [13] employing the RBD of SARS-CoV (PDB: 2DD8) as a template. All the core
subdomains are colored magenta, and the external subdomains of RmYN02, RaTG13, pangolin/MP789/2019, and pangolin/GX/P5L/2017 are colored cyan,
green, orange, and yellow, respectively. The conserved disulfide bond in RaTG13, pangolin/GD, and pangolin/GX is highlighted, while it is missing in RmYN02 due
to a sequence deletion.
(legend continued on next page)

4 Current Biology 30, 1–8, June 8, 2020

 Please cite this article in press as: Zhou et al., A Novel Bat Coronavirus Closely Related to SARS-CoV-2 Contains Natural Insertions at the S1/S2
Cleavage Site of the Spike Protein, Current Biology (2020), https://doi.org/10.1016/j.cub.2020.05.023
Report
modeling (Figures 2A–2F and S3 for sequence alignment). The
amino acid deletions in RmYN02 RBD made two loops near
the receptor binding site that are shorter than those in
SARS-CoV-2 RBD (Figures 2A and 2F). Importantly, the
conserved disulfide bond in the external subdomain of
SARS-CoV (PDB: 2DD8) [12], SARS-CoV-2 (PDB: 6LZG),
RaTG13 (Figure 2B), pangolin/MP789/2019 (Figure 2C), and
pangolin/GX/P5L/2017 (Figure 2D) was missing in RmYN02
(Figure 2F). We speculate that these deletions may cause
conformational variations and consequently reduce the bind-
ing of RmYN02 RBD with ACE2 or even cause non-binding.
It is possible that the bat SARS-related CoVs with loop
deletions, including RmYN02, ZXC21, and ZC45, use a
currently unknown receptor. In contrast, RaTG13 (Figure 2B),
pangolin/MP789/2019 (Figure 2C), and pangolin/P5L/2017
(Figure 2D) did not have the deletions, and had similar confor-
mations at their external domains, indicating that they may
also use ACE2 as cell receptor, although with the exception
of pangolin/MP789/2019 (see below), all exhibited amino
acid variation to SARS-CoV-2. Indeed, the pangolin/MP789/
2019 virus showed highly structural homology with SARS-
CoV-2 (Figure 2E).
Six amino acid residues at the RBD (L455, F486, Q493, S494,
N501, and Y505) have been reported to be major determinants
of efficient receptor binding of SARS-CoV-2 to ACE2 [14]. As
noted above, and consistent with the homology modeling,
pangolin/MP789/2019 possessed the identical amino acid res-
idues to SARS-CoV-2 at all six positions [6]. In contrast,
RaTG13, RmYN02, and RmYN01 possessed the same amino
acid residue as SARS-CoV-2 at only one of the six positions
each (RaTG13, L455; RmYN02, Y505; RmYN01, Y505) (Fig-
ure 2G), despite RaTG13 being the closest relative in the spike
protein. Such an evolutionary pattern is indicative of a complex
combination of recombination and natural selection [6, 15].
The S protein of CoVs is functionally cleaved into two sub-
units, S1 and S2 [16], in a similar manner to the haemaggluti-
nin (HA) protein of avian influenza viruses (AIVs). The insertion
of polybasic amino acids at the cleavage site in the HAs of
some AIV subtypes is associated with enhanced pathogenicity
[17, 18]. Notably, SARS-CoV-2 is characterized by a four-
amino-acid insertion at the junction of S1 and S2, not
observed in other lineage B beta-CoVs [19][20]. This insertion,
which represents a poly-basic (furin) cleavage site, is unique to
SARS-CoV-2 and is present in all SARS-CoV-2 sequenced so
far. The insertion of three residues, PAA, at the junction of S1
and S2 in RmYN02 (Figure 2H; Figure S2A for results from
Sanger sequencing) is therefore of major importance.
Although the inserted residues (and hence nucleotides) are
not the same as those in RmYN02, and hence are indicative
of an independent insertion event, that they are presented in
wildlife (bats) strongly suggests that they are of natural origin
and have likely been acquired by recombination. As such,
(E and F) Superimposition of the RBD structure of pangolin/MP789/2019 (E) and RmYN02 (F) with that of SARS-CoV-2. The two deletions located in respective
loops in RmYN02 are highlighted using dotted cycles.
(G) Molecular characterizations of the RBD of RmYN02 and the representative beta-CoVs.
(H) Molecular characterizations of the cleavage site of RmYN02 and the representative beta-CoVs.
See also Figures S2 and S3 and Table S2.
ll
these data are strongly suggestive of a natural zoonotic origin
of SARS-CoV-2.
We next performed a phylogenetic analysis of RmYN02,
RaTG13, SARS-CoV-2, and the pangolin beta-CoVs. Consistent
with previous research [6], the pangolin beta-CoVs formed two
well-supported sub-lineages, representing animal seized by
anti-smuggling authorities in Guangxi (pangolin-CoV/GX) and
Guangdong (pangolin-CoV/GD) provinces (Figures 3A and
S4A). However, whether pangolins are natural reservoirs for
these viruses, or they acquired these viruses independently
from bats or other wildlife, requires further sampling [6]. More
notable was that RmYN02 was the closest relative of SARS-
CoV-2 in most of the virus genome, although these two viruses
were still separated from each other by a relatively long branch
length (Figures 3A and S4A). In the spike gene tree, SARS-
CoV-2 clustered with RaTG13 and was distant from RmYN02,
suggesting that the latter virus has experienced recombination
in this gene (Figures 3B and S4B). In phylogeny of the RBD,
SARS-CoV-2 was most closely related to pangolin-CoV/GD,
with the bat viruses falling in more divergent positions, again
indicative of recombination (Figures 3C and S4C). Finally, phylo-
genetic analysis of the complete RNA-dependent RNA polymer-
ase (RdRp) gene, which is often used in the phylogenetic analysis
of RNA viruses, revealed that RmYN02, RaTG13, and SARS-
CoV-2 formed a well-supported sub-cluster distinct from the
pangolin viruses (Figures 3D and S4D).
We confirmed the bat host of RmYN02, Rhinolophus ma-
layanus, by analyzing the sequence of the cytochrome b
(Cytb) gene from the NGS data; this revealed 100% sequence
identity to a Rhinolophus malayanus isolate (GenBank:
MK900703). Both Rhinolophus malayanus and Rhinolophus
affinis are widely distributed in southwest China and southeast
Asia. Generally, they do not migrate over long distances and
are highly gregarious such that they are likely to live in the
same caves, which might facilitate the exchange of viruses
between them and the occurrence of recombination. Notably,
RaTG13 was identified from anal swabs and RmYN02 was
identified from feces, which is a simple, but feasible way for
bats to spread the virus to other animals, especially species
that can utilize cave environments.
Our study reaffirms that bats, particularly those of the genus
Rhinolophus, are important natural reservoirs for coronaviruses
and currently harbor the closest relatives of SARS-CoV-2,
although this picture may change with increased wildlife sam-
pling. In this context it is striking that the RmYN02 virus identified
here in Rhinolophus malayanus is the closest relative of SARS-
CoV-2 in the long 1ab replicase gene, although the virus itself
has a complex history of recombination. Finally, the observation
that RmYN02 contains an insertion of multiple amino acids at the
S1/S2 cleavage site in the spike protein clearly indicates that
events of this kind are a natural and expected component of co-
ronavirus evolution [22].
Current Biology 30, 1–8, June 8, 2020 5
 Please cite this article in press as: Zhou et al., A Novel Bat Coronavirus Closely Related to SARS-CoV-2 Contains Natural Insertions at the S1/S2
Cleavage Site of the Spike Protein, Current Biology (2020), https://doi.org/10.1016/j.cub.2020.05.023

ll
Report
100
A 100 SARS-CoV B 100
100
SARS-CoV
YN2018B|Yunnan|R. affinis 100 LYRa11
100 96 LYRa3
Rs3367|Yunnan|R. sinicus
100 Rf4092|Yunnan|R. ferrumequinum 100 BtKY72
BM48-31/BGR
BtRs-BetaCoV/YN2013|Yunnan|R. sinicus HKU3-13
99
Rs672|Yunnan|R. sinicus 100 HKU3-3
100 HKU3-12
100 100 Yunnan2011|C. plicata 100
BetaCoV/LYRa11|China|R. affinis Longquan_140
BtRl-BetaCoV/SC2018|China|Rhinolophus sp. BtRs-BetaCoV_GX2013
96 BtCoV/279/2005
100 279|Hubei|R. macro s 85 Rp3
87 Rm1|Hubei|R. macro s Rs672
BtRs-BetaCoV/HuB2013|R. sinicus 100 Rs4237
85 Shaanxi2011|R. pusillus As6526
99 YN2018A
Rf1|R. ferrumequinum Rs4247
HKU3-3|Hongkong|R. sinicus Jiyuan_84
HKU3-13|Hongkong|R. sinicus BtRf-BetaCoV/HeB2013
HKU3-12|Hongkong|R. sinicus BtRf-BetaCoV/HuB2013
99 BtCoV/273/2005
HKU3-7|Guangdong|R. sinicus 100
Rf1
Longquan-140|China|R. monoceros 85 100 BtRf-BetaCoV/JL2012
Wuhan/WH-01/2019 JTMC15
100 Wuhan/WH-03/2020 SARS-CoV-2 86
Yunnan2011
100 87
Wuhan/WH-04/2020 100 BtRl-BetaCoV/SC2018
100 Rp/Shaanxi2011
RmYN02|R. malayanus 100 Anlong_112
100 RaTG13|R. affinis BtRs-BetaCoV/YN2013
100 MP789 Guangxi/P2V
Pangolin-CoV/GD Guangxi/P5L
Guangdong/P2S Guangxi/P5E Pangolin-CoV/GX
100 Guangxi/P1E 100 Guangxi/P1E
Guangxi/P5L Guangxi/P3B
Guangxi/P2V 92 Guangxi/P4L
Guangxi/P5E Pangolin-CoV/GX Wuhan/WH-03/2020
100
100 100 Wuhan/WH-04/2020 SARS-CoV-2
Guangxi/P4L 100 100 Wuhan/WH-01/2019
Guangxi/P3B RaTG13
Bat-SL-CoVZXC21|Zhejiang|R. sinicus 100 100 MP789
Guangdong/P2S Pangolin-CoV/GD
100
Bat-SL-CoVZC45|Zhejiang|R. sinicus 100 100 Bat-SL-CoVZXC21
100 BtKY72|Kenya|Rhinolophus sp. Bat-SL-CoVZC45
BM48-31/BGR|Bulgaria|R. blasii RmYN02
0.05 0.07

98
C 70
99
SARS-CoV D 83 SARS-CoV
100 BtKY72 YNLF_31C
BM48-31/BGR BtRl-BetaCoV/SC2018
Wuhan/WH-01/2019 WIV1
100 Wuhan/WH-04/2020 SARS-CoV-2 Rf4092
100 83 Wuhan/WH-03/2020 Rs672
MP789 WIV16
80 100
Guangdong/P2S Pangolin-CoV/GD 100
BtRs-BetaCoV/YN2018B
RaTG13 BtRs-BetaCoV/GX2013
Guangxi/P4L 94 HKU3-7
87
Guangxi/P5L HKU3-3
Guangxi/P2V Pangolin-CoV/GX 100 HKU3-12
Guangxi/P1E 100
bat-SL-CoVZC45
100 Guangxi/P5E 100 Longquan-140
Guangxi/P3B 73 bat-SL-CoVZXC21
Rs4081 99 BtRs-BetaCoV/HuB2013
Rs4087-2 BtCoV/279/2005
Rs4096 100 JTMC15
YN2018D BtRf-BetaCoV/JL2012
Rs672 100
100 BtRf-BetaCoV/HuB2013
Rs4237 Jiyuan_84
100
Rs4255 BtRf_BetaCoV_SX2013
88
Rs4108 Rp/Shaanxi2011
100 As6526 MLHJC35
YN2018C 100 BM48-31/BGR
Rp3 BtKY72
Rs4085 Wuhan/WH-04/2020
98 Rs4247 100 Wuhan/WH-01/2019 SARS-CoV-2
98
Rs3267-2 97 Wuhan/WH-03/2020
Rs3262-2 RaTG13
BtRs-BetaCoV/YN2018A 100 RmYN02
BtRl-BetaCoV/SC2018 Guangdong/P2S
BtRs-BetaCoV/HuB2013 100
MP789 Pangolin-CoV/GD
100 100 bat-SL-CoVZXC21 Guangxi/P5E
bat-SL-CoVZC45 100
YNLF-31C Guangxi/P1E
100 Guangxi/P4L
YNLF-34C Guangxi/P5L Pangolin-CoV/GX
100 Rs4092 100 Guangxi/P3B
Rf4092 Guangxi/P2V
0.08 RmYN02 0.02

Figure 3. Phylogenetic Analysis of SARS-CoV-2 and Representative Viruses from the Subgenus Sarbecoronavirus
(A) Phylogenetic tree of the full-length virus genome.
(B) The S gene.
(C) The RBD.
(D) The RdRp.
Phylogenetic analysis was performed using RAxML [21] with 1,000 bootstrap replicates, employing the GTR nucleotide substitution model. RBD is delimited as
the gene region 991–1,572 of the spike gene according to [6]. All the trees are midpoint rooted for clarity.
See also Figure S4.

STAR+METHODS d KEY RESOURCES TABLE

d RESOURCE AVAILABILITY
Detailed methods are provided in the online version of this paper B Lead Contact
and include the following: B Materials Availability

6 Current Biology 30, 1–8, June 8, 2020

 Please cite this article in press as: Zhou et al., A Novel Bat Coronavirus Closely Related to SARS-CoV-2 Contains Natural Insertions at the S1/S2
Cleavage Site of the Spike Protein, Current Biology (2020), https://doi.org/10.1016/j.cub.2020.05.023
Report
B Data and Code Availability
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
d METHOD DETAILS
B Sample collection
B Next generation sequencing
B Genome assembly and annotation
B Bioinformatics analyses
B Sanger sequencing
d QUANTIFICATION AND STATISTICAL ANALYSIS
SUPPLEMENTAL INFORMATION
Supplemental Information can be found online at https://doi.org/10.1016/j.
cub.2020.05.023.
ACKNOWLEDGMENTS
This work was supported by the Academic Promotion Programme of Shandong
First Medical University (2019QL006 and 2019PT008), the Strategic Priority
Research Programme of the Chinese Academy of Sciences (XDB29010102
and XDA20050202), the Chinese National Natural Science Foundation
(32041010 and U1602265), the National Major Project for Control and Prevention
of Infectious Disease in China (2017ZX10104001-006), and the High-End Foreign
Experts Program of Yunnan Province (Y9YN021B01). W.S. was supported by the
Taishan Scholars Programme of Shandong Province (ts201511056). Y.B. is sup-
ported by the NSFC Outstanding Young Scholars (31822055) and Youth Innova-
tion Promotion Association of CAS (2017122). E.C.H. is supported by an ARC
Australian Laureate Fellowship (FL170100022). A.C.H. was supported by the
Chinese National Natural Science Foundation (grant no. U1602265), Mapping
Karst Biodiversity in Yunnan, and the the High-End Foreign Experts Program
of Yunnan Province (Y9YN021B01, Yunnan Bioacoustic monitoring program).
We thank all the scientists, especially Professor Wuchun Cao and Professor Yi
Guan, who kindly shared their genomic sequences of the coronaviruses used
in this study.
AUTHOR CONTRIBUTIONS
W.S., Y.B., and A.C.H. designed and supervised research. X.C. and A.C.H.
collected the samples. H.Z. and Y.L. processed the samples. T.H. and J.L. per-
formed genome assembly and annotation. H.Z., J.L., and T.H. performed the
genome analysis and interpretation. H.S. performed homology modeling.
W.S., Y.B., and A.C.H. wrote the paper. X.C., P.W., D.L., J.Y., and E.C.H. as-
sisted in data interpretation and edited the paper.
DECLARATION OF INTERESTS
The authors declare no competing interests.
Received: April 16, 2020
Revised: May 1, 2020
Accepted: May 6, 2020
Published: May 11, 2020
REFERENCES
1. Zhu, N., Zhang, D., Wang, W., Li, X., Yang, B., Song, J., Zhao, X., Huang,
B., Shi, W., Lu, R., et al.; China Novel Coronavirus Investigating and
Research Team (2020). A novel coronavirus from patients with pneumonia
in China, 2019. N. Engl. J. Med. 382, 727–733.
2. Lu, R., Zhao, X., Li, J., Niu, P., Yang, B., Wu, H., Wang, W., Song, H.,
Huang, B., Zhu, N., et al. (2020). Genomic characterisation and epidemi-
ology of 2019 novel coronavirus: implications for virus origins and receptor
binding. Lancet 395, 565–574.
3. Zhou, P., Yang, X.L., Wang, X.G., Hu, B., Zhang, L., Zhang, W., Si, H.R.,
Zhu, Y., Li, B., Huang, C.L., et al. (2020). A pneumonia outbreak associated
with a new coronavirus of probable bat origin. Nature 579, 270–273.
ll
4. Su, S., Wong, G., Shi, W., Liu, J., Lai, A.C.K., Zhou, J., Liu, W., Bi, Y., and
Gao, G.F. (2016). Epidemiology, genetic recombination, and pathogenesis
of coronaviruses. Trends Microbiol. 24, 490–502.
5. Gorbalenya, A.E., Baker, S.C., Baric, R.S., de Groot, R.J., Drosten, C.,
Gulyaeva, A.A., Haagmans, B.L., Lauber, C., Leontovich, A.M., Neuman,
B.W., et al.; Coronaviridae Study Group of the International Committee
on Taxonomy of Viruses (2020). The species severe acute respiratory syn-
drome-related coronavirus: classifying 2019-nCoV and naming it SARS-
CoV-2. Nat. Microbiol. 5, 536–544.
6. Lam, T.T., Shum, M.H., Zhu, H.C., Tong, Y.G., Ni, X.B., Liao, Y.S., Wei, W.,
Cheung, W.Y., Li, W.J., Li, L.F., et al. (2020). Identifying SARS-CoV-2
related coronaviruses in Malayan pangolins. Nature. Published online
March 26, 2020. https://doi.org/10.1038/s41586-020-2169-0.
7. Xiao, K., Zhai, J., Feng, Y., Zhou, N., Zhang, X., Zou, J.-J., Li, N., Guo, Y.,
Li, X., Shen, X., et al. (2020). Isolation and characterization of 2019-nCoV-
like coronavirus from Malayan pangolins. bioRxiv. https://doi.org/10.
1101/2020.02.17.951335.
8. Zhang, T., Wu, Q., and Zhang, Z. (2020). Probable pangolin origin of
SARS-CoV-2 associated with the COVID-19 outbreak. Curr. Biol. 30,
1346–1351.e2.
9. Wu, Z., Yang, L., Ren, X., He, G., Zhang, J., Yang, J., Qian, Z., Dong, J.,
Sun, L., Zhu, Y., et al. (2016). Deciphering the bat virome catalog to better
understand the ecological diversity of bat viruses and the bat origin of
emerging infectious diseases. ISME J. 10, 609–620.
10. Lole, K.S., Bollinger, R.C., Paranjape, R.S., Gadkari, D., Kulkarni, S.S.,
Novak, N.G., Ingersoll, R., Sheppard, H.W., and Ray, S.C. (1999). Full-
length human immunodeficiency virus type 1 genomes from subtype C-in-
fected seroconverters in India, with evidence of intersubtype recombina-
tion. J. Virol. 73, 152–160.
11. Wrapp, D., Wang, N., Corbett, K.S., Goldsmith, J.A., Hsieh, C.L., Abiona,
O., Graham, B.S., and McLellan, J.S. (2020). Cryo-EM structure of the
2019-nCoV spike in the prefusion conformation. Science 367, 1260–1263.
12. Prabakaran, P., Gan, J., Feng, Y., Zhu, Z., Choudhry, V., Xiao, X., Ji, X., and
Dimitrov, D.S. (2006). Structure of severe acute respiratory syndrome co-
ronavirus receptor-binding domain complexed with neutralizing antibody.
J. Biol. Chem. 281, 15829–15836.
13. Waterhouse, A., Bertoni, M., Bienert, S., Studer, G., Tauriello, G.,
Gumienny, R., Heer, F.T., de Beer, T.A.P., Rempfer, C., Bordoli, L., et al.
(2018). SWISS-MODEL: homology modelling of protein structures and
complexes. Nucleic Acids Res. 46 (W1), W296–W303.
14. Wan, Y., Shang, J., Graham, R., Baric, R.S., and Li, F. (2020). Receptor
recognition by the novel coronavirus from Wuhan: an analysis based on
decade-long structural studies of SARS coronavirus. J. Virol. 94, 94.
15. Wong, M.C., Javornik Cregeen, S.J., Ajami, N.J., and Petrosino, J.F.
(2020). Evidence of recombination in coronaviruses implicating pangolin
origins of nCoV-2019. bioRxiv. https://doi.org/10.1101/2020.02.07.
939207.
16. He, Y., Zhou, Y., Liu, S., Kou, Z., Li, W., Farzan, M., and Jiang, S. (2004).
Receptor-binding domain of SARS-CoV spike protein induces highly
potent neutralizing antibodies: implication for developing subunit vaccine.
Biochem. Biophys. Res. Commun. 324, 773–781.
17. Monne, I., Fusaro, A., Nelson, M.I., Bonfanti, L., Mulatti, P., Hughes, J.,
Murcia, P.R., Schivo, A., Valastro, V., Moreno, A., et al. (2014).
Emergence of a highly pathogenic avian influenza virus from a low-patho-
genic progenitor. J. Virol. 88, 4375–4388.
18. Zhang, F., Bi, Y., Wang, J., Wong, G., Shi, W., Hu, F., Yang, Y., Yang, L.,
Deng, X., Jiang, S., et al. (2017). Human infections with recently-emerging
highly pathogenic H7N9 avian influenza virus in China. J. Infect. 75, 71–75.
19. Andersen, K.G., Rambaut, A., Lipkin, W.I., Holmes, E.C., and Garry, R.F.
(2020). The proximal origin of SARS-CoV-2. Nat. Med. 26, 450–452.
20. Li, X., Duan, G., Zhang, W., Shi, J., Chen, J., Chen, S., et al. (2020). A furin
cleavage site was discovered in the S protein of the 2019 novel coronavi-
rus. Chinese Journal of Bioinformatics (In Chinese) 18, 1–4.
Current Biology 30, 1–8, June 8, 2020 7
 Please cite this article in press as: Zhou et al., A Novel Bat Coronavirus Closely Related to SARS-CoV-2 Contains Natural Insertions at the S1/S2
Cleavage Site of the Spike Protein, Current Biology (2020), https://doi.org/10.1016/j.cub.2020.05.023

ll
21. Stamatakis, A. (2014). RAxML version 8: a tool for phylogenetic
analysis and post-analysis of large phylogenies. Bioinformatics 30,
1312–1313.
22. Hu, B., Zeng, L.-P., Yang, X.-L., Ge, X.-Y., Zhang, W., Li, B., Xie, J.-Z.,
Shen, X.-R., Zhang, Y.-Z., Wang, N., et al. (2017). Discovery of a rich
gene pool of bat SARS-related coronaviruses provides new insights into
the origin of SARS coronavirus. PLoS Pathog. 13, e1006698.
23. Chen, S., Zhou, Y., Chen, Y., and Gu, J. (2018). fastp: an ultra-fast all-in-
one FASTQ preprocessor. Bioinformatics 34, i884–i890.
24. Langmead, B., and Salzberg, S.L. (2012). Fast gapped-read alignment
with Bowtie 2. Nat. Methods 9, 357–359.
Report
25. Grabherr, M.G., Haas, B.J., Yassour, M., Levin, J.Z., Thompson, D.A.,
Amit, I., Adiconis, X., Fan, L., Raychowdhury, R., Zeng, Q., et al. (2011).
Full-length transcriptome assembly from RNA-Seq data without a refer-
ence genome. Nat. Biotechnol. 29, 644–652.
26. Chen, J., Zhao, Y., and Sun, Y. (2018). De novo haplotype reconstruction in
viral quasispecies using paired-end read guided path finding.
Bioinformatics 34, 2927–2935.
27. Nakamura, T., Yamada, K.D., Tomii, K., and Katoh, K. (2018).
Parallelization of MAFFT for large-scale multiple sequence alignments.
Bioinformatics 34, 2490–2492.
28. Ronquist, F., and Huelsenbeck, J.P. (2003). MrBayes 3: Bayesian phyloge-
netic inference under mixed models. Bioinformatics 19, 1572–1574.

8 Current Biology 30, 1–8, June 8, 2020

 Please cite this article in press as: Zhou et al., A Novel Bat Coronavirus Closely Related to SARS-CoV-2 Contains Natural Insertions at the S1/S2
Cleavage Site of the Spike Protein, Current Biology (2020), https://doi.org/10.1016/j.cub.2020.05.023

ll
Report

STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Bacterial and Virus Strains
BetaCoV/bat/Yunnan/RmYN01/2019 This manuscript N/A
BetaCoV/bat/Yunnan/RmYN02/2019 This manuscript N/A
Biological Samples
Samples are provided in the Table S1 This manuscript N/A
Chemicals, Peptides, and Recombinant Proteins
RNAlater Stabilization Solution Invitrogen Cat#AM7021
RNAiso Plus reagent TAKARA Cat#9109
ReverTra Ace qPCR RT Kit TOYOBO Cat#FSQ-101
PerfectStart II Probe qPCR SuperMix TransGen Cat#AQ711
TransStart Tip Green qPCR SuperMix TransGen Cat#AQ141
Exp Taq DNA Polymerase (Mg2+ and AG Cat#AG11411
dNTPs plus)
Critical Commercial Assays
RNeasy Mini Kit QIAGEN Cat# 74104
Deposited Data
Raw and analyzed data This manuscript NMDC1001304; China National
Microbiological Data Center
RmYN01 genome This manuscript EPI_ISL_412976/NMDC60013004-01;
GISAID/China National Microbiological
Data Center
RmYN02 genome This manuscript EPI_ISL_412977/NMDC60013004-02;
GISAID/China National Microbiological
Data Center
partial sequence of spike gene This manuscript NMDCN0000001; China National
of RmYN02 Microbiological Data Center
partial sequence of RdRp gene This manuscript NMDCN0000002; China National
of RmYN02 Microbiological Data Center
partial sequence of cytochrome b This manuscript NMDCN0000003; China National
(cytb) gene of Rhinolophus Microbiological Data Center
malayanus isolate YN-190625
SARS-CoV-2 reference genome GenBank / GISAID N/A
sequences from databases are
provided in the Table S3
Oligonucleotides
Primer sequences are provided in This manuscript N/A
the Table S2
Software and Algorithms
Fastp v0.20.0 [23] https://github.com/OpenGene/fastp
Bowtie2 v2.3.3.1 [24] https://bowtiebio.sourceforge.io/bowtie2
Trinity v2.5.1 [25] https://github.com/trinityrnaseq/
trinityrnaseq/releases
Geneious v11.1.5 The Biomatters https://www.geneious.com/
development team
PeHaplo [26] https://omictools.com/pehaplo-tool
MAFFT v7.450 [27] https://mafft.cbrc.jp/alignment/software/
(Continued on next page)

Current Biology 30, 1–8.e1–e3, June 8, 2020 e1

 Please cite this article in press as: Zhou et al., A Novel Bat Coronavirus Closely Related to SARS-CoV-2 Contains Natural Insertions at the S1/S2
Cleavage Site of the Spike Protein, Current Biology (2020), https://doi.org/10.1016/j.cub.2020.05.023

ll
Report

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
RAxML v8.1.6 [21] https://cme.h-its.org/exelixis/web/
software/raxml/index.html
MrBayes v3.2.6 [28] http://nbisweden.github.io/MrBayes/
Simplot v3.5.1 [10] https://www.mybiosoftware.com/
simplot-3-5-1-sequence-similarity-plotting.html
SWISS-MODEL [13] https://swissmodel.expasy.org/
Other
Sequencing systems Illumina NovaSeq 6000

RESOURCE AVAILABILITY

Lead Contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Weifeng
Shi (shiwf@ioz.ac.cn).

Materials Availability
This study did not generate new unique reagents.

Data and Code Availability

Sequence data that support the findings of this study have been deposited in the China National Microbiological Data Center
(project accession number NMDC1001304 and sequence accession numbers: NMDC60013004-01, NMDC60013004-02, and
NMDCN0000001-NMDCN0000003). The sequences of RmYN01 and RmYN02 generated during this study are also available at
the GISAID with accession numbers: EPI_ISL_412976 and EPI_ISL_412977.

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Twenty different species of bats were tested in this study (Table S1). Samples were collected between May and October, 2019 from
Mengla County, Yunnan Province in southern China (101.27156323E, 21.91889683N and 21.5932019N, 101.2200914E). Xishuang-
banna Tropical Botanical Garden has an ethics committee which provided permission for trapping and bat surveys within this study.

METHOD DETAILS

Sample collection
Between May and October, 2019, a total of 302 samples from 227 bats were collected from Mengla County, Yunnan Province in
southern China (Table S1). These bats belonged to 20 different species, with the majority of samples taken from Rhinolophus
malayanus (n = 48, 21.1%), Hipposideros larvatus (n = 41, 18.1%) and Rhinolophus stheno (n = 39, 17.2%). The samples included
patagium (n = 219), lung (n = 2) and liver (n = 3), and feces (n = 78). All but three bats were sampled alive and subsequently released.
All samples were first stored in RNAlater and then kept at 80 C until use.

Next generation sequencing

Based on the bat species primarily identified according to morphological criteria and confirmed through DNA barcoding, the 224
tissue and 78 fecal samples were merged into 38 and 18 pools, respectively, with each pool containing 1 to 11 samples of the
same type (Table S1). Fecal samples were transferred into the RNAiso Plus reagent (TAKARA) for homogenization with steel beads.
Total RNA was extracted and subsequently purified using EZNA Total RNA Kit (OMEGA). And tissue samples were extracted using
RNeasy Mini Kit (QIAGEN). Libraries were constructed using the NEB Next Ultra RNA Library Prep Kit (NEB). rRNA of feces or tissues
was removed using the TransNGS rRNA Depletion (Bacteria) Kit and TransNGS rRNA Depletion (Human/Mouse/Rat) Kit (TransGen),
respectively. Paired-end (150 bp) sequencing of each RNA library was performed on the NovaSeq 6000 platform (Illumina) carried out
by Novogene Bioinformatics Technology (Beijing, China).

Genome assembly and annotation

Raw reads were obtained from the 56 pools and were then adaptor- and quality- trimmed with the Fastp program [23]. The clean
reads were then mapped to reference genomes of representative CoV genomes using Bowtie 2 [24], including SARS-CoV-2
(MDC60013002-01), SARS-CoV (AY508724, AY485277, AY390556 and AY278489), SARS-like-CoV (DQ084200, DQ648857,
GQ153542, GQ153547, JX993987, JX993988, KF294455, KF294457, KJ473814, KJ473815, KJ473816, KT444582, KY417142,

e2 Current Biology 30, 1–8.e1–e3, June 8, 2020

 Please cite this article in press as: Zhou et al., A Novel Bat Coronavirus Closely Related to SARS-CoV-2 Contains Natural Insertions at the S1/S2
Cleavage Site of the Spike Protein, Current Biology (2020), https://doi.org/10.1016/j.cub.2020.05.023

ll
Report

KY417145, KY417146, KY417148, KY417151, KY417152, KY770859, MK211374, MK211376, and MK211377), ZC45 (MG772933),
ZXC21 (MG772934), MERS-CoV (JX869059), other representative beta-CoV genomes (AY391777, EF065505, EF065509, EF065513,
FJ647223, KC545386, KF636752, KM349744, KU762338, and MK167038) and alphacoronavirus genomes (NC_002645, AY567487).
A total of 11,954 and 64,224 reads in pool no. 39 (a total of 78,477,464 clean reads) were mapped to both a bat coronavirus Cp/
Yunnan2011 (JX993988) [9] and SARS-CoV-2, generating two preliminary consensus sequences, named BetaCoV/Rm/Yunnan/
YN01/2019 (RmYN01) and BetaCoV/Rm/Yunnan/YN02/2019 (RmYN02), respectively. However, there were only few reads in the re-
maining 55 pools that could be mapped to these reference CoV genomes. Pool 39 comprised 11 fecal samples from Rhinolophus
malayanus collected between May 6 and July 30, 2019.
To validate the two novel CoV genomes, the clean reads of pool 39 were then de novo assembled using Trinity [25] with default
settings. The assembled contigs were compared with the consensuses obtained in the previous step and merged using Geneious
(version 11.1.5) (https://www.geneious.com). We found that contigs with high and low abundance corresponded to RmYN02 and
RmYN01, respectively, with the abundance of RmYN02 5-10 times greater than that of RmYN01. The gaps between contigs of
RmYN02 were complemented by re-mapping the reads to the ends of the contigs, which produced the full-length genome sequence
of RmYN02. However, due to the limited number of reads available, only a partial genome sequence of RmYN01 was obtained
(23395 bp). Reads were then mapped to the full-length genome sequence of RmYN02 using Bowtie 2 to check base consistency
at each nucleotide site. Moreover, to perform de novo assembly for pool 39 and to further distinguish RmYN01 and RmYN02, we
used PeHaplo [26] with various overlap parameters (70, 80, 100, and 120). The consensus of each run of PeHaplo was then
compared, generating the final full-length genome of RmYN02 (29671 bp). The sequence identity between RmYN01 and
Cp/Yunnan2011 across the aligned regions was 96.9%, whereas that between RmYN01 and SARS-CoV-2 was only 79.7%.

Bioinformatics analyses
Reference virus genomes were obtained from NCBI/GenBank (https://www.ncbi.nlm.nih.gov/) using Blastn with SARS-CoV-2 as a
query. The beta-CoVs from pangolins (Table S3) were retrieved from GISAID (https://www.gisaid.org/). The open reading frames
(ORFs) of the verified genome sequences were predicted using Geneious (version 11.1.5). Pairwise sequence identities were also
calculated using Geneious. Potential recombination events were investigated using Simplot (version 3.5.1) [10].
The three-dimensional structures of RBD from RmYN02, RaTG13, pangolin/GD and pangolin/GX were modeled using Swiss-
Model program [13] using SARS-CoV RBD structure (PDB: 2DD8) [12] as a template.
Multiple sequence alignment of SARS-CoV-2 and the reference sequences was performed using Mafft [27]. Phylogenetic analyses
of the complete genome and major encoding regions were performed using RAxML [21] with 1000 bootstrap replicates, employing
the GTR nucleotide substitution model (Figure 3). Phylogenetic analysis was also performed using MrBayes [28], employing the GTR
nucleotide substitution model (Figure S4). Ten million steps were run, with trees and parameters sampled every 1,000 steps.

Sanger sequencing
Based on the spike gene sequence of RmYN02, a TaqMan-based qPCR was performed to test the feces of pool 39 (Table S2). Pool
39 comprised 11 feces from Rhinolophus malayanus collected between May 6 and July 30, 2019. However, only eight original sam-
ples remained after NGS. The results indicated that the fecal sample no. 123 from R. malayanus, collected on June 25, 2019, was
positive for RmYN02 (Figure S1). To further confirm the S1/S2 cleavage site and the 1b (RdRp) gene sequence of RmYN02, five
pair primers, F1/R1-F4/R4 and F6/R6, were designed for Sanger sequencing (Table S2). The consensus gene sequence of Sanger
sequencing of the amplified products was consistent with those from NGS (Figure S2).

QUANTIFICATION AND STATISTICAL ANALYSIS

No statistical analyses were conducted as part of this study.

Current Biology 30, 1–8.e1–e3, June 8, 2020 e3

Current Biology, Volume 30

Supplemental Information

A Novel Bat Coronavirus Closely Related

to SARS-CoV-2 Contains Natural Insertions
at the S1/S2 Cleavage Site of the Spike Protein
Hong Zhou, Xing Chen, Tao Hu, Juan Li, Hao Song, Yanran Liu, Peihan Wang, Di Liu, Jing
Yang, Edward C. Holmes, Alice C. Hughes, Yuhai Bi, and Weifeng Shi
Figure S1. Detection of RmYN02 using real-time PCR primers and Taqman probes in the

eight fecal samples from pool 39, related to Sanger sequencing of STAR Methods. Two

replicates were set for each original sample. (A) TaqMan-based qPCR was performed to

detect the existence of RmYN02 in the eight additional fece samples of pool 39. Two replicates

were set for each original sample. (B) RmYN01 and RmYN02 were identified in sample 123

using Tip green supermix (TransGen). Nuclease-free water was used as negative control.
Figure S2. Comparison of NGS consensus and Sanger sequencing of RmYN02, related to

Figure 2 and Genome assembly and annotation of STAR Methods. (A) NGS consensus and

Sanger sequencing results of the RBD and the cleavage site of RmYN02. The insertion of the

multiple amino acids at the S1/S2 cleavage site is highlighted. (B) Sites in the RmYN02

genome that display nucleotide polymorphisms in the NGS data. The positions of these sites

in RmYN02 were provided at the bottom of the figure. “/”: Sanger sequencing was not

performed.
Figure S3. Sequence alignment of the RBDs from RmYN02 and representative beta-CoVs,

related to Figure 2. The blue triangles indicate amino acids from the SARS-CoV S protein

that impact binding to ACE2. The yellow rectangles highlight the three deletions in sequence

resulting two loops shorten in RmYN02.

Figure S4. Bayesian phylogenetic analysis of SARS-CoV-2 and representative viruses of

the subgenus Sarbecoronavirus, related to Figure 3. (A) Phylogenetic tree of the full-length

virus genome. (B) the spike gene. (C) the RBD. (D) the RdRp gene. Phylogenetic analysis was

also performed using MrBayes, employing the GTR nucleotide substitution model. Ten million

steps were run, with trees and parameters sampled every 1,000 steps. The tree is midpoint

rooted for clarity. RBD is delimited as the gene region 991-1572 of the spike gene according

to the reference [6].

 Species Individual number Number Sample number

May Jun Jul Aug Sep Oct May-Oct of Samples Patagiu Lung Liver Fece

Libraries per library m s

Rhinolophus 6 24 9 39 5 10, 10, 37 11

malayanusa 8, 9, 11

Rhinolophus 14 12 16 6 48 7 10, 5, 10, 44 16

sthenoa 10, 9, 7, 9

Hipposideros 4 8 12 5 7 5 41 8 10, 10, 10, 40 1 1 14

larvatus 10, 7, 7, 1,

(complex) a 1

Rhinolophus 4 4 4 3 2 17 3 10, 7, 8 17 8

sinicusa

Myotis lanigera 7 2 9 1 9, 9

Rhinolophus 1 3 1 2 1 8 2 8, 3 8 3

siamensisa

Hipposideros 1 4 7 1 13 3 8, 5, 8 13 8

pomonaa

Kerivoula 1 1 1 3 1 3, 3

hardwickiia

Murina cyclotisa 1 2 2 2 7 2 7, 3 7 3

Aselliscus 1 2 1 1 5 2 5, 3 5 3

stoliczkanusa

Myotis 3 1 2 1 1 8 1 8, 8

muricolaa

Kerivoula sp. a 2 2 2 2, 1 2 1

Rhinolophus 1 1 2 1, 1 1 1

paradoxolophus

Kerivoula 1 1 2 1 2, 2

papillosaa

Tylonycteris 1 1 1 1, 1

robustulaa
Harpiocephalus 1 1 2 1, 1 1 1

harpiaa

Hipposideros 1 2 3 3 2, 1, 1 3 1

armigera

Rhinolophus 3 3 6 3 6, 2, 3 6 5

pearsoniia

Chaerephon 4 4 3 4, 2, 1 4 1 2

plicatab

Taphozous 9 9 4 8, 1, 1, 1 8 1 1 1

melanopogonb

Total 43 57 65 35 14 13 56 219 2 3 78

Table S1. Summary of the bat samples collected in the present study and the pooling

strategy used for next-generation sequencing, related to Sample collection and Next

generation sequencing of STAR Methods. Note: aSamples were collected from Mengla,

Xishuangbanna, Yunan (101.27156323E, 21.91889683N). bSamples were collected from Mengla,

Xishuangbanna, Yunan (21.5932019N, 101.2200914E). Different colors represent different sample

types. Patagium, black; Lung, purple; Liver, blue; Feces, red.

Primers (nucleotide positions)a Sequence, 5’→3’ Product length, bp

Forward qF (21344-21366) ACCCAATTCAGTTGTCTTCCTAT 146

Reverse qR (21469-21489) TCTAACGATGAGCCTACCCTT

Probe qP (21411-21438) TGCTGTTATGTCTCTTAAGGAGGGACAA

Forward qF (YN02-21711) TAATTCCACTCTAACCTGGTATA 107

Reverse qR (YN02-21795) CAGCATTTGATTTATCTACAGTT

Forward qF (YN01-21311) GCACCTCACTCAGGATTAT 89

Reverse qR (YN01-21381) AATAGACTTGACGATCCGA

Forward F6 (23070-23092) TGGTGTTCTAACTGATTCAGATA 2370

Reverse R6 (25418-25439) TCTCTTTTTAAGGGTTATGATT

Forward F1 (12002-12024) CTTTCCATGCAGGGTGCTGTAGA 1488

Reverse R1 (13470-13489) CGCACGGTGTAAGACGGGCT

Forward F2 (13159-13180) TGGTCAGGCAATAACAGTTACA 2579

Reverse R2 (15715-15737) GATGCGTAAGTGCTATTAAAACA

Forward F3 (15625-15646) AGAGATGTTGACACAGACTTTG 1788

Reverse R3 (17390-17412) GTACACATAGTGCTTAGCACGTA

Forward F4 (17321-17345) CAGATATAGTTGTCTTTGATGAAAT 1937

Reverse R4 (19236-19257) AGGCAAGTTAAGGTTAGATAGC

Table S2. Oligonucleotide primers designed to detect RmYN02 and to amplify the spike

and 1b genes, related to Sanger sequencing of STAR Methods. aValues in parentheses

indicate primer positions corresponding to the genome sequence of RmYN02.

Accessi Virus name Location Collection Originating lab Submitting lab Authors

on ID date

EPI_ISL_ BetaCoV/bat/ Asia / 2013-07- Wuhan Institute Wuhan Institute Yan Zhu, Ping Yu,

402131 Yunnan/RaTG China / 24 of Virology, of Virology, Bei Li, Ben Hu,

13/2013 Yunnan / Chinese Chinese Hao-Rui Si, Xing-Lou

Pu'er Academy of Academy of Yang, Peng Zhou,

Sciences Sciences Zheng-Li Shi

EPI_ISL_ BetaCoV/ Asia / 2017 Beijing Institute Beijing Institute Wu-Chun Cao;

410539 pangolin/ China / of Microbiology of Microbiology Tommy Tsan-Yuk

Guangxi/P1E/ Guangxi and and Lam; Na Jia; Ya-Wei

2017 Epidemiology Epidemiology Zhang; Jia-Fu Jiang;

Bao-Gui Jiang

EPI_ISL_ BetaCoV/ Asia / 2017 Beijing Institute Beijing Institute Wu-Chun Cao;

410541 pangolin/ China / of Microbiology of Microbiology Tommy Tsan-Yuk

Guangxi/P5E/ Guangxi and and Lam; Na Jia; Ya-Wei

2017 Epidemiology Epidemiology Zhang; Jia-Fu Jiang;

Bao-Gui Jiang

EPI_ISL_ BetaCoV/ Asia / 2017 Beijing Institute Beijing Institute Wu-Chun Cao;

410540 pangolin/ China / of Microbiology of Microbiology Tommy Tsan-Yuk

Guangxi/P5L/2 Guangxi and and Lam; Na Jia; Ya-Wei

017 Epidemiology Epidemiology Zhang; Jia-Fu Jiang;

Bao-Gui Jiang

EPI_ISL_ BetaCoV/ Asia / 2017 Beijing Institute Beijing Institute Wu-Chun Cao;

410538 pangolin/ China / of Microbiology of Microbiology Tommy Tsan-Yuk

Guangxi/P4L/2 Guangxi and and Lam; Na Jia; Ya-Wei

017 Epidemiology Epidemiology Zhang; Jia-Fu Jiang;

Bao-Gui Jiang
 EPI_ISL_ BetaCoV/ Asia / 2017 Beijing Institute Beijing Institute Wu-Chun Cao;

410543 pangolin/ China / of Microbiology of Microbiology Tommy Tsan-Yuk

Guangxi/P3B/ Guangxi and and Lam; Na Jia; Ya-Wei

2017 Epidemiology Epidemiology Zhang; Jia-Fu Jiang;

Bao-Gui Jiang

EPI_ISL_ BetaCoV/ Asia / 2017 Beijing Institute Beijing Institute Wu-Chun Cao;

410542 pangolin/ China / of Microbiology of Microbiology Tommy Tsan-Yuk

Guangxi/P2V/ Guangxi and and Lam; Na Jia; Ya-Wei

2017 Epidemiology Epidemiology Zhang; Jia-Fu Jiang;

Bao-Gui Jiang

EPI_ISL_ BetaCoV/ Asia / 2019 Beijing Institute Beijing Institute Wu-Chun Cao;

410544 pangolin/ China / of Microbiology of Microbiology Tommy Tsan-Yuk

Guangdong Guangdo and and Lam; Na Jia; Ya-Wei

/P2S/2019 ng Epidemiology Epidemiology Zhang; Jia-Fu Jiang;

Bao-Gui Jiang

MT0840 MP789 China 2019-03- Chinese Jiang, J.-Z., Liu, P.

71.1 29 Academy of and Chen, J.-P.
Fishery Sciences
(SCSFRI, CAFS)

Table S3. Acknowledgement of sharing of SARS-CoV-2 genome sequences from the

GISAID and GenBank databases, related to Figure1. We gratefully thank the authors listed

below for sharing their genomic sequences of coronaviruses analyzed in this study.