See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/236461065

Critical role of Hyaluronidase-2 during preimplantation embryo

development.

Article  in  Molecular Human Reproduction · April 2013

DOI: 10.1093/molehr/gat032 · Source: PubMed

CITATIONS READS

18 226

3 authors:

Waleed Fawzy Abdelaziz Marei Mazdak Salavati

University of Antwerp The Roslin Institute
49 PUBLICATIONS   556 CITATIONS    36 PUBLICATIONS   88 CITATIONS   

SEE PROFILE SEE PROFILE

Ali A Fouladi-Nashta
Royal Veterinary College
72 PUBLICATIONS   1,374 CITATIONS   

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

GplusE View project

GplusE project View project

All content following this page was uploaded by Waleed Fawzy Abdelaziz Marei on 23 January 2016.

The user has requested enhancement of the downloaded file.

Molecular Human Reproduction, Vol.19, No.9 pp. 590–599, 2013
Advanced Access publication on April 25, 2013 doi:10.1093/molehr/gat032

ORIGINAL RESEARCH

Critical role of hyaluronidase-2 during

preimplantation embryo development
Waleed F.A. Marei1,2, Mazdak Salavati 1, and Ali A. Fouladi-Nashta 1,*
1
Reproduction, Genes and Development Group, Department of Comparative Biomedical Sciences, Royal Veterinary College, Hatfield AL9 7TA,
UK 2Department of Theriogenology, Faculty of Veterinary Medicine, Cairo University, Giza 12211, Egypt

*Correspondence address. Tel: 44-1707-666662; Fax: 44-1707-666371; E-mail: afouladi@rvc.ac.uk

Submitted on October 2, 2012; resubmitted on April 15, 2013; accepted on April 23, 2013

abstract: Biological functions of hyaluronan (HA) depend on its molecular size. Small size HAs are known to regulate cell proliferation;
however, the expression of HA synthases (HASs) and hyaluronidase-2 (HYAL2) and their role during early embryo development have not

Downloaded from http://molehr.oxfordjournals.org/ by guest on January 7, 2016

been previously identified. In this paper, we have shown by immunostaining that HA is produced by bovine in vitro-produced embryos at all
stages of early development to blastocyst. Addition of HA-synthesis inhibitor (4-methylumbelliferone; 4MU) to in vitro embryo culture inhibited
blastocyst formation. HASs HAS2 and HAS3 mRNA were expressed at all stages of embryo development; however, relative mRNA expression of
HAS2 was significantly reduced as the embryos develop to the blastocyst stage. HAS1 was detected during 2- and 4-cell stages but was barely
detectable in subsequent stages. HYAL2 mRNA expression was detected in oviducts at the early luteal phase but was only detected in the
embryos at morula and blastocyst stages (Day 6 and 7 post-fertilization). Addition of HYAL2 to embryo culture media at Day 2 post-fertilization
increased phosphorylated mitogen-activated protein kinases (MAPK1 and 3) in the embryos and improved development to the blastocyst stage
and increased embryo cell numbers. Addition of an anti-CD44 antibody or an MAPK inhibitor (U0126) abrogated the positive effects of HYAL2 on
blastocyst rates. In conclusion, we demonstrate that the expression of different HAS genes and HYAL2 in bovine embryos varies according to the
stage of development and that the supplementation of HYAL2 in vitro mimics oviductal conditions and is shown to improve the blastocyst rate and
embryo quality, an effect which requires CD44 activity and MAPK signalling.

Key words: HYAL2 / blastocyst / CD44 / MAPK / IVF media

Introduction
IVF is a widely used treatment, but success rates remain low, and the
number of IVF cycles performed and the number of patients being
treated have continued to rise over the last few years (HFEA, 2010).
Culture of IVF-produced embryos in the oviduct improves development
to the blastocyst stage (Lazzari et al., 2010). This can be attributed to a
number of supporting factors present in the oviduct, although it is fluid
but still missing from routine IVF protocols. Among those factors is hya-
luronic acid (HA), a ubiquitous component of the extracellular matrix of
vertebrates. HA is present in the follicular, oviductal and uterine fluids
and is known to play an important role in the regulation of many repro-
ductive events like ovulation (Salustri et al., 1989), fertilization (Shimada
et al., 2008) and embryogenesis (Camenisch et al., 2000).
HA is a linear polysaccharide which belongs to the family of glycosami-
noglycans (GAGs). It is composed of repeating alternating units of
D-glucuronic acid (GlcUA) and N-acetyl-D-glucosamine (GlcNAc)
forming up to 25 000 disaccharides with a molecular mass of up to 10
million Da (Laurent, 1998). HA is synthesized by hyaluronic acid-
synthase (HAS) enzymes (Itano and Kimata, 2002) located at the inner
cytoplasmic face of the plasma membrane which adds units of GlcUA
and GlcNAc while extruding the HA chain through the membrane
during its synthesis to the outside of the cell (Laurent, 1998). There
are three different mammalian HASs which synthesize HA chains with
different molecular stability average lengths (molecular sizes) and differ-
ent biological functions (Dougherty and van de Rijn, 1993; Crater and van
de Rijn, 1995; Itano and Kimata, 2002; Stern, 2005). Polymer size, loca-
tion and concentration govern the function of HA (Stern et al., 2006).
The functions of high-molecular-weight (HMW) HA polymers
(.1000–5000 disaccharides) are mainly attributed to the hydrodynam-
ic properties of the molecule. HMW HA is space-filling hydrating
molecule that impedes cell differentiation and it is anti-angiogenic
(Feinberg and Beebe, 1983) and immunosuppressive (McBride and
Bard, 1979; Delmage et al., 1986). On the other hand, the functions of
low-molecular-weight (LMW) HA is mainly mediated through their
interaction with HA receptors, like CD44 and receptor for HA-mediated
motility (RHAMM). LMW HA competes with the larger molecules for
receptors and acts in an opposing manner; they are anti-apoptotic and
function as a survival factor and stimulate cell proliferation (Xu et al.,
2002). LMW HAs are also angiogenic (West et al., 1985) and immunos-
timulatory molecules (Alaniz et al., 2011).
HA has the high rate of turnover at cellular and tissue levels mainly by
enzymatic hydrolysis by hyaluronidases (HYALs) which include HYAL1,
HYAL2, HYAL3, HYAL4, HYALP1 and PH-20. Predominantly, HYAL1

& The Author 2013. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved.
For Permissions, please email: journals.permissions@oup.com
HYAL2 and embryo development
and HYAL2 are considered the major HA-degrading enzymes in somatic
tissue, whereas PH-20 is abundant in spermatozoa (Bastow et al., 2008).
As formulated by Stern (2003, 2004), a sequence of enzymatic reac-
tions cleave the HMW HA progressively generating HA fragments of de-
creasing sizes. HYAL2 is a glycosylphosphatidylinositol-anchored
enzyme attached to the external surface of the plasma membrane
expressed in many tissues (Lepperdinger et al., 2001). HYAL2 initially
cleaves HMW HA into fragments 20 000 Da (50 –60 saccharides) in
size. CD44 –HYAL2 interaction facilitates the endocytosis of HA
which undergoes further degradation by lysosomal HYAL1 into
smaller HA fragments (4 –8 saccharides in size) enabling cellular migra-
tion, proliferation and mitosis (Lepperdinger et al., 2001). Moreover,
the interaction between HA and CD44 has been shown to induce cell
signalling (Ohno-Nakahara et al., 2004), involving multiple signalling path-
ways like Rac1-mitogen-activated protein kinase (MAPK), PI3-AKT and
NFkB (Toole, 2001), and in some cases, influences cell proliferation
(Bourguignon et al., 1997).
Genes and proteins involved in HA synthesis and its receptor
CD44 are expressed in cumulus –oocyte complexes (COCs) in dif-
ferent animal species (Tirone et al., 1997; Kimura et al., 2002;
Schoenfelder and Einspanier, 2003) as well as human (Campbell
et al., 1995) and were considered as valuable and indirect markers
of oocyte competence in bovine and human (McKenzie et al., 2004;
Assidi et al., 2008; Gebhardt et al., 2011). Moreover, HA receptors
CD44 and RHAMM were shown to be expressed in all stages of
embryo development (Furnus et al., 2003; Palasz et al., 2006;
Choudhary et al., 2007). In some studies, the addition of HA to
culture media has been shown to stimulate the in vitro embryonic de-
velopment of cows (Furnus et al., 1998; Lane et al., 2003) and mice
(Gardner et al., 1999). HA has also been shown to improve the cryo-
tolerance of blastocysts, which then leads to increased birth rates, in
cows (Lane et al., 2003), mice (Palasz et al., 1993) and lambs (Dattena
et al., 2007). HA is also an important component of oviductal fluids in
which fertilization and early embryo development take place (Stojko-
vic et al., 2002). These data suggest that HA production may play an
important role in cell proliferation and survival during early embryo
development. However, the expression and the role of HYAL2
during this stage of embryo development have not been previously
investigated. As mentioned above, HA fragments produced by the
action of HYAL2 have been shown to stimulate intracellular signalling
and promote mitosis and cell proliferation and have anti-apoptotic
effect, all of which are critical for embryo development.
In this paper, we have investigated the expression of different
HAS enzymes and HYAL2 in embryos at different stages of develop-
ment and in the oviduct. We also studied the effect of HA fragments
generated by HYAL2 supplementation on the development and
quality of bovine embryos in vitro and whether this effect is mediated
through HA-receptor CD44. In addition, we examined the effect of
HA synthesis inhibitor 4-methylumbelliferone (4MU) on embryo devel-
opment and quality. Bovine embryos were used for these experiments
as they are readily available in adequate numbers, enabling a reliable
assessment of effects.
Materials and Methods
All chemicals were obtained from Sigma Chemical Company (Poole, Dorset,
UK) unless stated otherwise.
591
Collection of ovaries and retrieval of COCs
Bovine ovaries were collected from a local abattoir and transported to the
laboratory in phosphate-buffered saline (PBS) in a thermos container at
378C within 2 h after slaughter, and they were washed in fresh PBS immedi-
ately after arrival. Follicular fluid was aspirated from antral follicles 3 –8 mm in
diameter with a 19-gage needle mounted on a 10-ml syringe and left to settle
in a 50-ml conical centrifuge tube for 5 min. The cellular precipitate was trans-
ferred to a 90-mm sterile petri dish and mixed with washing medium; M-199
supplemented with 20 mM HEPES and 0.4% (w/v) bovine serum albumin
(BSA). Grade 1 and 2 COCs, characterized by dark homogenous ooplasm
and more than four layers of compact cumulus cells, were selected under a
stereomicroscope as previously described by Fouladi-Nashta et al. (2007).
In vitro maturation
Selected COCs were washed twice in washing medium and twice in matur-
ation medium; M199 supplemented with 0.6% (w/v) fatty acid-free BSA,
5 mg/ml follicle-stimulating hormone (follitropin; Bioniche Animal Health,
Belleville, ON, Canada), 5 mg/ml luteinizing hormone (leutropin; Bioniche
Downloaded from http://molehr.oxfordjournals.org/ by guest on January 7, 2016
Animal Health), 1 mg/ml estradiol and 50 mg/ml gentamycin. Groups of
COCs were then cultured in 4-well dishes (NUNC, Thermo Fisher Scientific,
Loughborough, Leicestershire, UK) using 20 ml maturation medium per
COC. COCs were incubated for 24 h at 38.58C under 5% CO2 in humidified
air. About 30 COCs were used per treatment per repeat.
IVF and embryo culture
After in vitro maturation, oocytes were fertilized using frozen semen from a
single bull as previously described by Fouladi-Nashta and Campbell (2006).
Briefly, motile sperm were selected by swim-up for 45 min in calcium-free
medium followed by centrifugation at 300g at room temperature and re-
suspension of the pellet in fertilization medium [TALP supplemented with
0.6% (w/v) fatty acid-free BSA, 1 mg/ml heparin, 50 ng/ml epinephrine
and 50 ng/ml hypotaurine]. Groups of 30 COCs were washed twice in fer-
tilization medium and transferred into 400 ml of fertilization medium contain-
ing 1 × 106 sperm/ml and cultured for 18 h at 38.58C in a humidified
incubator of 5% CO2 in air. At 24 h after fertilization, presumptive zygotes
were denuded from cumulus cells by gentle pipetting and cultured in
500 ml of SOFaaci (Holm et al., 1999) supplemented with 0.4% (w/v) fatty
acid-free BSA and cultured at 38.58C in a humidified incubator with 5%
O2, 5% CO2 and 90% N2. On Day 2 following fertilization, all embryos at
the 4-cell stage or further were divided equally between treatment groups.
The culture was continued up to Day 8. The rate of blastocyst per cleaved
embryos was recorded on Day 8 and all blastocysts were differentially
stained for quality assessment.
Differential staining of blastocysts associated
with terminal deoxynucleotidyl
transferase-mediated dUDP nick-end
labelling
Day 8 blastocysts were differentially stained for counting cells in the inner cell
mass (ICM) and trophectoderm (TE) and apoptotic cells as previously
described (Fouladi-Nashta et al., 2005) with some modifications. Briefly,
embryos were permeabilized using 0.2% solution of Triton X-100 in
SOFaaci containing 30 mg/ml propidium iodide (PI, stains the TE cells red)
for 20 s. Embryos were then washed and fixed in 4% paraformaldehyde con-
taining 30 mg/ml bisbenzimide (Hoechst 33342, stains all cells blue) for
20 min. Apoptotic cells were then detected by terminal deoxynucleotidyl
transferase-mediated dUDP nick-end labelling (TUNEL) using an FITC-
conjugated in situ cell death detection kit, fluorescein (Roche, Penzberg,
Germany) according to the manufacturer’s instructions. Briefly, embryos
592
were permeabilized by incubating in 0.1% Triton for 5 min and incubated in
the kit reagent in a humid chamber for 45 min at 378C. Embryos were then
washed and mounted in small droplets of anti-fading Vectashield mounting
medium (Vector Laboratories, Inc., Burlingame, USA, A94010) and exam-
ined under a Leica epiflourescent microscope (Leica). Images were acquired
for each fluorescent stain then merged as shown in Fig. 1. Because not all the
cells are in focus at one plane image, cells in each compartment were counted
directly under the epiflourescent microscope while finely changing the focus.
RNA extraction and reverse transcription –
polymerase chain reaction
Bovine oviducts from healthy cows in the early luteal phase were collected
ipsilateral to ovaries containing corpus haemorrhagica. Surrounding tissue
was carefully removed, then segments from the ampulla and isthmus were
frozen in dry ice within 15 min after slaughter. Bovine embryos were pro-
duced in vitro as mentioned above. Groups of 30 embryos were collected
at each stage of development as previously described by Stojkovic et al.
(2003). Briefly, 2-, 4-, 8-, 16- and 32-cell stages as well as compact
morulas and blastocysts were collected at 24, 36, 48, 70, 120, 144 and
168 h post-insemination (hpi). Embryos were washed in SOFaaci and imme-
diately snap frozen in liquid nitrogen. All samples were kept at 2808C until
RNA extraction.
Total RNA was extracted from frozen samples using RNeasy kit (Qiagen)
following the manufacturer’s instructions. The concentration and integrity of
the RNA was determined using nanodrop. The extracted RNA was treated
Figure 1 Representative images for differential staining of embryos associated with TUNEL. (A) Trophoectoderm stained with PI (red), (B) all cells
stained with Hoechst (blue), (C) apoptotic cells labelled with TUNEL (green) and (D) image merge of the PI and Hoecht staining.
Marei et al.
with RNase-free DNase (Promega) to exclude genomic DNA contamination
before reverse transcription (RT).
RT– polymerase chain reaction
RT was carried out at 378C for 1 h using the Omniscript RT kit (Qiagen) for
oviduct samples (500 ng/reaction) or Sensiscript RT kit (Qiagen) for embryo
samples (50 ng/reaction), in combination with oligo-dT and random
hexamer primers (Ambion). Conventional polymerase chain reaction
(PCR) was performed using Multiplex plus Q-solution master mix (Qiagen)
in a thermal cycler (G-Storm GSX machine, GRI, Braintree, UK) for
40 cycles. About 25 ng of cDNA per reaction and 0.2 mM PCR primers
specific for HAS1, HAS2, HAS3, HYAL2 and GAPDH (glyceraldehyde-3-
phosphatedehydrogenase) (Table I) were used. PCR products were visua-
lized on 2% agarose gel (w/v) using ethidium bromide staining. Images
were obtained using Syngene Gel doc facility (SYNGENE, Cambridge,
UK). PCR bands were quantified using Quantity-one software (Bio-Rad
Laboratories, Hemel Hempstead, Hertfordshire, UK) to calculate relative
expression compared with GAPDH.
Downloaded from http://molehr.oxfordjournals.org/ by guest on January 7, 2016
Immunofluorescence staining of HA
Ten to 15 embryos from each stage were removed from SOFaaci medium,
washed in PBS and placed on polylysine-coated slides, dried, fixed with 4%
paraformaldehyde in PBS for 10 min and dehydrated in increasing concentra-
tions of ethanol (30 – 100%). Slides were kept at 2208C until all embryo
stages were collected and ready for staining. For HA staining, slides were
HYAL2 and embryo development 593

Table I Details of primers used for RT– PCR.

PCR product (bp) Annealing (88 C) Primer sequence Accession number

.............................................................................................................................................................................................
HAS1a 184 59 Forward:GGTACAACCAGAAGTTCCTGGG AB017803.1
Reverse: CGGAAGTACGACTTGGACCAG
HAS2 125 57.5 Forward:GGGGGAGATGTCCAGATTTT NM_174079.2
Reverse: ATGCACTGGACACATCCGA
HAS3 134 57.5 Forward:TCATGTCGCTCTACTCCCTTCT NM_001192867.1
Reverse:GATGAGGCCAATAAAGTTCACC
HYAL2 280 59 Forward: GGACTCCCACACAGTTCCTG NM_174347.2
Reverse: ACCCTCGTTAGGTGAAGCCT
GAPDH 218 59 Forward:CCAACGTGTCTGTTGTGGATCTGA NM_001034034.1
Reverse:GAGCTTGACAAAGTGGTCGTTGAG
a
As in Palasz et al. (2006).

Downloaded from http://molehr.oxfordjournals.org/ by guest on January 7, 2016

thawed, rehydrated in decreasing concentrations of ethanol (100– 30%) and
washed in PBS. Slides were blocked in normal goat serum (1:20 in PBS) for 2 h
using avidin-biotin blocking kit for 15 min at room temperature. Slides were
then incubated with biotinylated-HA-binding protein (b-HABP) at 1:3000 in
PBS at 48C overnight following washing and incubation with FITC-conjugated
streptavidin (ebioscience, San Diego, Ca, USA) for 2 h at room temperature
in the dark. Slides were then counterstained with Hoechst (30 mg/ml in PBS),
washed and mounted in small droplets of anti-fading Vectashield mounting
medium (Vector Laboratories, Inc.) and examined under a Leica epifloures-
cent microscope (Leica).
Western blotting for detection of
phosphorylated and total MAPK1 and 3
Cleaved bovine embryos (in groups of 30 – 50 embryos) were randomly allo-
cated into SOFaaci media supplemented with or without Hyal2 (300 unit/
ml). After 24 h in culture, embryos were washed in protein-free SOFaaci con-
taining 0.4% polyvinylpyrrolidone, then transferred into 1.5 ml microcentri-
fuge tubes and snap-frozen in liquid nitrogen awaiting analysis. Embryos
were lysed by repeated freezing and thawing in liquid nitrogen in 10 ml of
lysis buffer containing Tris (63.5 mM, pH 6.8), 10% glycin, 4% SDS, sodium
orthovanadate 2 mM, sodium fluoride 200 mM and protease inhibitor cock-
tail 1× (Calbiochem, Darmstadt, Germany). After lysis, b-mercapto ethanol
was added and samples were boiled at 1008C for 10 min. Lysates were
loaded on a SDS – polyacrylamide gel electrophoresis of 4% stacking gel over-
laying 10% resolving gel. Pre-stained protein ladder (10 ml; Fermentas,
Loughborough, UK) was loaded in the first lane. Electrophoresis was
carried out at 170 V  24 mA for 1 h35 m. Afterwards, the proteins were
transferred from the gel to polyvinylidene difluoride membrane (GE Health-
care, Hatfield, UK) at 100 V  51 mA for 1 h40 m. The membranes were
then blocked in 10% Skimmed milk overnight. On the next day, membranes
were washed for 5 min in PBS-Tween-20 (0.05% v/v) and blotted with
primary antibodies against phosphorylated MAPK (1:500 dilution; Cell Signal-
ing, Boston, MA, USA) followed by thorough washing (6 × 15 min) and
probing with donkey anti-rabbit IgG-horse-radish peroxidase-conjugated
(1:125 000) secondary antibody (SantaCruz, CA, USA). The membranes
were then developed using ECL Select (GE Healthcare) and a gel documen-
tation facility (SYNGENE). After saving the image from phosphorylated
bands, the membranes were stripped by washing in the stripping buffer
(Tris– HCL, pH 6.8, 2% SDS, 1% Tween-20, 0.1% 2-mercaptoethanol) for
15 min with maximum agitation. Then, the membranes were blocked and
re-probed as above using total rabbit anti-MAPK1 and three primary
antibodies (1:500 dilution; Cell Signaling).
Images obtained from the developed membranes were analysed using
Alpha Ease FC software v.3.1.2 (AlphaInnotech; Protein Simple, CA, USA)
for band densitometry (integrated density value). The background value
was deduced automatically from the analysis. The percentage of phospho-
MAPK1 and 3 was calculated from the total MAPK1 and 3, respectively,
as described by Marei et al. (2009).
Statistical analysis
In all the experiments, the data were from at least three independent repeats.
Binominal data from all experiments were converted to percentages. All data
were tested for homogeneity by Levene’s test and were normally distributed.
Data were then analysed in SPSS (version 19) using a linear mixed model with
randomized block analysis. The effect of different treatments was considered
the fixed effect, whereas the different batches of ovaries were taken into con-
sideration as a random effect. If the main treatment effect was significant,
Bonferroni post hoc tests were performed for pairwise comparisons. Differ-
ences in P-values of ≤0.05 were considered as significant.
Results
mRNA expression of different HAS and
HYAL2 in bovine embryos
HAS2 and HAS3 were expressed in all stages of embryo development,
whereas HAS1 was expressed predominantly in 2- and 4-cell stages
and was faintly detectable thereafter. In contrast, HYAL2 expression
was only detectable at Days 6 and 7 in compact morula and blastocyst
stages but not detected earlier (Fig. 2A). The relative expression of
these genes to GAPDH showed that HAS1 and HAS2 expression dramat-
ically decrease during development to the blastocyst stage, whereas
HAS3 was more stable (Fig. 2B).
HYAL2 expression in bovine oviduct
HYAL2 was expressed in the isthmus and ampulla of bovine oviducts
collected at the early luteal phase (Fig. 3A). The relative expression
of HYAL2 to GAPDH in isthmus was significantly higher than in the
ampulla (Fig. 3B).
594
Figure 2 (A) Representative gel images of RT – PCR products for
HAS1, HAS2, HAS3 and HYAL2 mRNA in bovine embryos at different
stages of development. hpi, hours post insemination; -ve, no-template
negative control; 2C,4C, 8C, 16C and 32C, from 2- to 32-cell stage
embryos; M, compact morula; Bl, expanded blastocysts. (B) Relative ex-
pression of HAS1 –3 and HYAL2 in bovine expression. Density of the
PCR bands were quantified using Quantity-one software and the
mRNA expression of the gene of interest are shown relative to
GAPDH mRNA expression. Data are presented as the mean + SEM
from three independent repeats.
Immunofluorescence staining for HA
in embryos
Immunostaining with the b-HABP followed by FITC-conjugated strepta-
vidin (green) show the presence of HA in all stages of early embryo de-
velopment. Staining at 2- and 4-cell stages was less intense compared
with subsequent stages (Fig. 4).
The effect of HYAL2 treatment of cleaved
embryos on the blastocyst rate and quality
As shown in Table II, the treatment of cleaved embryos with HYAL2
resulted in higher blastocyst rates and increased total cell number, TE
Marei et al.
Downloaded from http://molehr.oxfordjournals.org/ by guest on January 7, 2016
Figure 3 (A) mRNA transcripts of HYAL2 gene in ampulla and
isthmus regions of bovine oviduct. Gel images following the conventional
PCR are shown in duplicate as a representative of three independent
repeats. GAPDH was used as a reference gene. (B) Relative HYAL2
mRNA expression. PCR band densities were quantified using
Quantity-one software and the mRNA expression of HYAL2 is shown
relative to GAPDH mRNA expression. Data are presented as the
mean + SEM from three independent repeats. Bar with asterisk is sig-
nificantly different at P , 0.05.
and ICM of the embryos, which was significantly different at 300 unit/
ml (P , 0.05) compared with the control group. HYAL2 did not affect
the percentage of apoptotic cells in the treated embryos or the TE/
ICM ratio.
The effect of 4MU treatment of cleaved
embryos on the blastocyst rate and quality
Cleaved embryos were treated with increasing concentration of the hya-
luronan synthesis inhibitor (4MU) in embryo culture medium starting
from Day 2. A concentration-dependent inhibition of blastocyst forma-
tion was observed in 4MU-treated embryos where no blastocyst was
produced in the presence of 1 mM 4MU (P , 0.05 compared with the
control). 4MU at 0.1 or 0.5 mM did not affect the blastocyst quality as
shown by cell counts (Table III).
Embryo development in the presence of
HYAL2 with or without anti-CD44 antibody
Bovine embryos were treated with either HYAL2 (300 unit/ml),
anti-CD44 antibody (2 mg/ml) or both, starting at 48 hpi until Day
8. Blastocyst formation from embryos treated with anti-CD44 tend to
be lower but was not significantly different from control (12 + 3.5
versus 20 + 0.7; P ¼ 0.63). Supplementation of embryos with HYAL2
HYAL2 and embryo development 595

Downloaded from http://molehr.oxfordjournals.org/ by guest on January 7, 2016

Figure 4 Localization of HA in bovine embryos at different stages of development. Immunoflurescence staining of HA was done using b-HABP followed
by streptavidin-FITC. Green, HA staining; Blue, counter staining with Hoechst; hpi, hours post insemination; -ve control, blastocyst was used as a negative
control with the omission of the HABP.

Table II The blastocyst rate and quality following treatment of Day 2 cleaved embryos with increasing concentration
of HYAL2.

Control 50 U 100 U 300 U P-value

.............................................................................................................................................................................................
Blastocyst (%) 21.8 + 0.4 22.6 + 5.9 29.6 + 5.6 38.1 + 4.8* 0.03
Number of total cells 78.0 + 14.5 86.3 + 5.8 96.7 + 6.4 114.6 + 13.3* 0.03
ICM 22.3 + 3.9 26.0 + 3.6 26.2 + 1.4 34.4 + 3.4* 0.00
TE 55.8 + 14.2 60.3 + 6.7 66.5 + 5.7 75.2 + 14.0 0.05
ICM:TE ratio 0.50 + 0.19 0.48 + 0.12 0.32 + 0.19 0.61 + 0.13 0.34
Apoptotic (%) 5.6 + 3.52 2.9 + 0.3 4.5 + 0.7 6.3 + 2.9 0.30

Data are presented as the mean + SEM from five independent repeats. ICM, inner cell mass; TE, trophoectoderm cells.
* Significant difference at P , 0.05 compared with the control.

resulted in a significant increase in the blastocyst rate (35 + 2.9; P ¼
0.017); however, this effect was abolished in the presence of
anti-CD44 (17 + 0.9; P ¼ 1.0 when compared with control; Fig. 5A).
Hyal2 supplementation resulted in an increase in the total cell count
(P , 0.05). This increase was abrogated in the presence of an
anti-CD44 antibody (Fig. 5B).
Effect of HYAL2 on phosphorylated MAPK1
and 3
Supplementation of the cleaved embryo (on Day 2) with HYAL2
(300 unit/ml) in SOFaaci medium for 24 h significantly increased the
percentage of phosphorylated/total MAPK1 and 3 in embryos when
compared with the controls (Fig. 6).
Embryo development in the presence of
HYAL2 with or without MAPK kinase inhibitor
(U0126)
Bovine embryos were treated with either HYAL2 (300 unit/ml), MAPK
kinase inhibitor U0126 (10 mM) or both, starting at 48 hpi until Day
8. Supplementation of embryos with HYAL2 resulted in a significant in-
crease in the blastocyst rate (48 + 4.1 versus 28 + 3.0; P , 0.01).
The blastocyst rate from embryos treated with U0126 was significantly
596 Marei et al.

Table III The blastocyst rate and quality following after treatment of Day 2 cleaved embryos with increasing concentration
of 4MU.

Control 0.1 mM 0.5 mM 1.0 mM

.............................................................................................................................................................................................
Blastocyst (%) 22.7 + 4.8 19.2 + 5.9 9.3 + 5.4* 0.0 + 0.00*
Total cells 82.6 + 6.9 86.4 + 5.5 85.3 + 4.4
TE 54.2 + 4.2 49.2 + 6.4 60.3 + 11.3
ICM 28.3 + 4.1 37.2 + 7.6 25.0 + 8.2
ICM:TE ratio 0.5 + 0.1 0.8 + 0.3 0.5 + 0.3
% of apoptosis 5.2 + 2.7 12.0 + 4.3 5.3 + 5.3

Data are presented as the mean + SEM from five independent repeats. ICM, inner cell mass; TE, trophoectoderm cells.
*Significant difference at P , 0.05 compared with the control.

Downloaded from http://molehr.oxfordjournals.org/ by guest on January 7, 2016

Figure 5 The effect of HYAL2 in the presence or the absence of an
anti-CD44 antibody on (A) blastocyst and hatching percentages
(from cleaved embryos) and (B) total cell count in blastocysts. Bovine
embryos were treated with HYAL2 (300 unit/ml) + anti-CD44 anti-
body (2 mg/ml) at 48 h post-fertilization until Day 8. Data are presented
as the mean + SEM from three independent repeats. Columns with dif-
ferent superscripts are significantly different (a – c or x and y) at P , 0.05.
lower than control (6 + 0.9; P , 0.05). Combined treatment with
HYAL2 and U0126 was also significantly lower than control (15 + 6.0;
P , 0.05; Fig. 7).
Figure 6 The effect of HYAL2 on MAPK1 and 3 phosphorylation in
early developing embryos. (A) Representative immunoreactive bands
from western blotting phosphorylated and total MAPK1 and 3. (B) Per-
centage (+SE) of phosphorylated/total MAPK1 and 3. Data are from
three independent experiments. Bars with asterisk are significantly dif-
ferent from control (*P , 0.01 and **P , 0.05).
Discussion
The aim of this study was to investigate the expression of different HASs
and HYAL in embryos at different stages of development and in the
oviduct, as well as to study the importance of HA synthesis and the
effect of HYAL2 supplementation on the development and quality of
embryos in vitro and whether this effect is mediated through the
HA-receptor CD44/MAPK pathway.
HYAL2 and embryo development
Figure 7 The effect of HYAL2 in the presence or the absence of the
MAPK inhibitor (U0126) and the blastocyst rate. Bovine embryos were
treated with HYAL2 (300 unit/ml) + U0126 (10 mM) at 48 h post-
fertilization until Day 8. Data are presented as the mean + SEM from
four independent repeats. Columns with different superscripts are sig-
nificantly different (a – c) at P , 0.05.
In the present study, we have shown by immunofluorescence that HA
is produced by bovine embryos at all stages of early development particu-
larly after the 4-cell stage. This observation is in accordance with Stojko-
vic et al. (2003) who showed that embryos secrete HA into culture
medium in vitro. HA is known to be produced by actively dividing cells
during mitosis (Brecht et al., 1986). We also show that the inhibition of
HA synthesis by 4MU supplementation resulted in a partial to complete
the inhibition of blastocyst formation in a concentration-dependent
manner. These findings suggest that the presence of HA is vital for
embryo development. In vivo oviduct also contributes to HA production,
since HAS2 and HAS3 were found to be expressed in the bovine oviduct,
and HA could be detected by immunostaining (Ulbrich et al., 2004;
Bergqvist et al., 2005).
The expression of different HAS genes is tissue and cell specific (Weigel
et al., 1997). Here, we demonstrated that the expression of different HAS
genes in bovine embryos varies according to the stage of development.
HAS2 and HAS3 were expressed at all stages of embryo development;
however, the relative expression of HAS2 was significantly reduced as
the embryos develop to the blastocyst stage. HAS1 was detected
during 2- and 4-cell stages but was barely detectable in subsequent
stages. Considering the fact that HAS2 produces the largest molecular
weight HA (.2 × 106 Da), whereas HAS3 produces the smaller size
HA (0.1 –1 × 106 Da; Stern et al., 2006), our observations suggest
that the HA fragments produced by the embryos may get smaller in
size as the embryos develop.
In addition, we detected HYAL2 expression in compact morulae and
blastocysts at Days 6 and 7 post-fertilization. We also found that
HYAL2 is expressed in the oviduct collected at the early luteal phase
and was significantly higher in the isthmus region compared with the
ampulla. To our knowledge, HYAL2 expression in embryos and oviduct
has not been shown previously. HYAL2 is normally located on cell
surface and is critical for degrading the HMW HA to fragments of
20 kDa in size (Duterme et al., 2009). These findings suggest that
the depolymerization of HA by HYAL2 into smaller fragments may be
required during embryo development and that HYAL2 will not be
597
available in vitro, since embryos do not express it before the morula
stage. To test this hypothesis, we examined the effect of HYAL2 supple-
mentation on early embryo development in vitro.
In the present study, we show evidence that HYAL2 supplementation
to embryos at 48 h post-fertilization are beneficial for preimplantation
embryo development and embryo quality. We observed an increase in
the blastocyst rate and embryonic cell numbers when embryos were
treated with 300 unit/ml of HYAL2. In contrast, a previous study
shows that the addition of HA (700 000 Da) to bovine embryos
culture 48 h post-fertilization suppressed embryo development to the
blastocyst stage (Palasz et al., 2006). Based on our observations, small
HA fragments may be required to support embryonic development fol-
lowing fertilization. In contrast to large size HA which functions mainly
depend on its structure and physical characteristics, small HA fragment
functions are receptor mediated (Laurent, 1998). The degradation of
HA by HYAL2 into smaller fragments is known to initiate CD44 cell sig-
nalling (Ohno-Nakahara et al., 2004). Recently, it has been shown that
fragmented HA produced by HAS2-HYAL2/CD44 system on the
Downloaded from http://molehr.oxfordjournals.org/ by guest on January 7, 2016
plasma membrane has autocrine effects in cancer cells (Saito et al.,
2011). CD44 which is expressed on the cell surface during all stages of
bovine embryo development (Furnus et al., 2003) can induce the signal-
ling cascade that augment the phosphorylation of MAP kinases and
protein kinase B (Sohara et al., 2001) both of which are important mo-
lecular regulators for cell division and apoptosis during embryo develop-
ment (Riley et al., 2005). In the present study, we have shown that
HYAL2 increases the phosphorylation of MAPK1 and 3 in developing
embryos and that the improvement of the blastocyst rate and embryo
quality by HYAL2 supplementation is abrogated in the presence of an
anti-CD44 antibody or an MAPK-kinase inhibitor (U0126), suggesting
that HYAL2 effect is mediated through CD44/MAPK signalling.
HA-CD44 binding can also result in direct or indirect interaction with
other signalling receptors like the epidermal growth factor (EGF) recep-
tor and thus may enhance EGF activity which again depends on MAPK
signalling (Wang and Bourguignon, 2006; Kim et al., 2008). EGF has
been shown to regulate embryo development in bovine (Buyalos and
Cai, 1994; Lonergan et al., 1996).
Based on our findings, it can be suggested that, under in vitro conditions,
the addition of HYAL2 can improve early embryo development by cleaving
HMW HA produced by the embryos generating biologically active frag-
ments that compete with HMW HA in binding to CD44 on the cell
surface of the embryo. The activation of CD44 will stimulate the activation
of the MAPK pathway which is required for embryo development. In this
context, it is also important to mention that the presence of HMW HA is
also required mainly for later stages during the hatching of the blastocyst
and implantation and may improve embryo survival after cryopreserva-
tion. Palasz et al. (2006) stated that the addition of HA to bovine
embryos at 96 hpi did not affect embryo development to blastocyst but
increased hatching rates. Also, Lane et al. (2003) reported that the addition
of HA to bovine embryos did not affect the rate of blastocyst development,
degree of expansion, hatching, total cell number, ICM or TE. However,
HA-treated embryos had significantly higher re-expansion and hatching
following cryopreservation. In the present study, HYAL2 had no effect
on hatching. In vivo HA produced by cumulus cells during expansion, as
well as HA produced by the embryo and the oviduct together with the
presence of HYAL2 expressed by the oviduct and embryo, create a
balance of different fragment sizes of HA that provide a wide range of bio-
logical functions supporting early embryo development.
598
The continued rise in the need for IVF treatments has been associated
with the fast growth of companies specialized in the assisted reproductive
technology and the development of new media formulations trying to
mimic the conditions naturally found in the mother’s tissue which pro-
tects the embryo and make it stronger and more robust in the early im-
plantation period. It is noticed, however, that the success rate of IVF
treatments (24% live birth per IVF cycle in UK) is increasing at a slow
rate (0.4% annual increase; HFEA, 2010). Our results suggest that
HYAL2 is a naturally occurring oviductal factor that can be directly
added to embryo culture media to achieve higher rates of transferable
embryos of better quality; however, further studies are needed to
verify these effects in human. The likelihood of adverse effects following
transfer is considered minimal, as these products are naturally occurring
in the female genital tract and in male and female gametes and embryos of
animals and human.
In conclusion, our results show that HYAL2 is only expressed by
embryos at compact morula and blastocyst stages but not earlier
which suggest that in vitro embryo production is devoid from HYAL2
until these stages. Since HYAL2 is expressed by the oviduct just after ovu-
lation, supplementation of HYAL2 may mimic in vivo conditions and is
shown to improve embryo development and quality via CD44-MAPK
signalling. These findings present new aspects of the role of HA during
embryo development and give a scientific basis for new IVF media
formulation.
Authors’ roles
W.F.A.M. contributed to research ideas and experimental design, col-
lected all samples and did all the experiments and data analysis except
western blotting and wrote and edited the manuscript; M.S. optimized
and analysed samples by western blotting and contributed to writing
and data analyses; A.A.F.-N. is the project supervisor and contributed
with the main research ideas and experimental design and critically
revised the data and edited the manuscript.
Funding
The studies presented here were funded by BBSRC New Investigator
Award to A.A.F.-N. (BB/G008620/1).
Conflict of interest
None declared.
References
Alaniz L, Rizzo M, Garcia MG, Piccioni F, Aquino JB, Malvicini M,
Atorrasagasti C, Bayo J, Echeverria I, Sarobe P et al. Low molecular
weight hyaluronan preconditioning of tumor-pulsed dendritic cells
increases their migratory ability and induces immunity against murine
colorectal carcinoma. Cancer Immunol Immunother CII 2011;
60:1383 – 1395.
Assidi M, Dufort I, Ali A, Hamel M, Algriany O, Dielemann S, Sirard MA.
Identification of potential markers of oocyte competence expressed in
bovine cumulus cells matured with follicle-stimulating hormone and/or
phorbol myristate acetate in vitro. Biol Reprod 2008;79:209 –222.
Marei et al.
Bastow ER, Byers S, Golub SB, Clarkin CE, Pitsillides AA, Fosang AJ.
Hyaluronan synthesis and degradation in cartilage and bone. Cell Mol Life
Sci 2008;65:395– 413.
Bergqvist AS, Yokoo M, Heldin P, Frendin J, Sato E, Rodriguez-Martinez H.
Hyaluronan and its binding proteins in the epithelium and intraluminal
fluid of the bovine oviduct. Zygote 2005;13:207 – 218.
Bourguignon LY, Zhu H, Chu A, Iida N, Zhang L, Hung MC. Interaction
between the adhesion receptor, CD44, and the oncogene product,
p185HER2, promotes human ovarian tumor cell activation. J Biol Chem
1997;272:27913 – 27918.
Brecht M, Mayer U, Schlosser E, Prehm P. Increased hyaluronate synthesis is
required for fibroblast detachment and mitosis. Biochem J 1986;
239:445– 450.
Buyalos RP, Cai X. Preimplantation embryo development enhanced by
epidermal growth factor. J Assist Reprod Genet 1994;11:33 – 37.
Camenisch TD, Spicer AP, Brehm-Gibson T, Biesterfeldt J, Augustine ML,
Calabro A Jr, Kubalak S, Klewer SE, McDonald JA. Disruption of
hyaluronan synthase-2 abrogates normal cardiac morphogenesis and
hyaluronan-mediated transformation of epithelium to mesenchyme.
Downloaded from http://molehr.oxfordjournals.org/ by guest on January 7, 2016
J Clin Invest 2000;106:349 –360.
Campbell S, Swann HR, Aplin JD, Seif MW, Kimber SJ, Elstein M. CD44 is
expressed throughout pre-implantation human embryo development.
Hum Reprod 1995;10:425 – 430.
Choudhary M, Zhang X, Stojkovic P, Hyslop L, Anyfantis G, Herbert M,
Murdoch AP, Stojkovic M, Lako M. Putative role of hyaluronan and its
related genes, HAS2 and RHAMM, in human early preimplantation
embryogenesis and embryonic stem cell characterization. Stem Cells
2007;25:3045 – 3057.
Crater DL, van de Rijn I. Hyaluronic acid synthesis operon (has) expression in
group A streptococci. J Biol Chem 1995;270:18452 – 18458.
Dattena M, Mara L, Bin TA, Cappai P. Lambing rate using vitrified blastocysts
is improved by culture with BSA and hyaluronan. Mol Reprod Dev 2007;
74:42 – 47.
Delmage JM, Powars DR, Jaynes PK, Allerton SE. The selective suppression of
immunogenicity by hyaluronic acid. Ann Clin Lab Sci 1986;16:303– 310.
Dougherty BA, van de Rijn I. Molecular characterization of hasB from an
operon required for hyaluronic acid synthesis in group A streptococci.
Demonstration of UDP-glucose dehydrogenase activity. J Biol Chem
1993;268:7118 – 7124.
Duterme C, Mertens-Strijthagen J, Tammi M, Flamion B. Two novel functions
of hyaluronidase-2 (Hyal2) are formation of the glycocalyx and control of
CD44-ERM interactions. J Biol Chem 2009;284:33495 – 33508.
Feinberg RN, Beebe DC. Hyaluronate in vasculogenesis. Science 1983;
220:1177– 1179.
Fouladi-Nashta AA, Alberio R, Kafi M, Nicholas B, Campbell KH, Webb R.
Differential staining combined with TUNEL labelling to detect apoptosis
in preimplantation bovine embryos. Reprod Biomed Online 2005;
10:497 – 502.
Fouladi-Nashta AA, Campbell KH. Dissociation of oocyte nuclear and
cytoplasmic maturation by the addition of insulin in cultured bovine
antral follicles. Reproduction 2006;131:449 – 460.
Fouladi-Nashta AA, Gutierrez CG, Gong JG, Garnsworthy PC, Webb R.
Impact of dietary fatty acids on oocyte quality and development in
lactating dairy cows. Biol Reprod 2007;77:9 – 17.
Furnus CC, de Matos DG, Martinez AG. Effect of hyaluronic acid on
development of in vitro produced bovine embryos. Theriogenology 1998;
49:1489 – 1499.
Furnus CC, Valcarcel A, Dulout FN, Errecalde AL. The hyaluronic acid
receptor (CD44) is expressed in bovine oocytes and early stage
embryos. Theriogenology 2003;60:1633 – 1644.
Gardner DK, Rodriegez-Martinez H, Lane M. Fetal development after
transfer is increased by replacing protein with the glycosaminoglycan
HYAL2 and embryo development
hyaluronan for mouse embryo culture and transfer. Hum Reprod 1999;
14:2575– 2580.
Gebhardt KM, Feil DK, Dunning KR, Lane M, Russell DL. Human cumulus cell
gene expression as a biomarker of pregnancy outcome after single embryo
transfer. Fertil Steril 2011;96:47– 52 e2.
HFEA. Fertility Facts and Figures 2008. The Human Fertilisation and
Embryology Authority, 2010.
Holm P, Booth PJ, Schmidt MH, Greve T, Callesen H. High bovine blastocyst
development in a static in vitro production system using SOFaa medium
supplemented with sodium citrate and myo-inositol with or without
serum-proteins. Theriogenology 1999;52:683 – 700.
Itano N, Kimata K. Mammalian hyaluronan synthases. IUBMB Life 2002;
54:195– 199.
Kim Y, Lee Y-S, Choe J, Lee H, Kim Y-M, Jeoung D. CD44-epidermal growth
factor receptor interaction mediates hyaluronic acid-promoted cell
motility by activating protein kinase C signaling involving Akt, Rac1,
Phox, reactive oxygen species, focal adhesion kinase, and MMP-2. J Biol
Chem 2008;283:22513– 22528.
Kimura N, Konno Y, Miyoshi K, Matsumoto H, Sato E. Expression of
hyaluronan synthases and CD44 messenger RNAs in porcine
cumulus-oocyte complexes during in vitro maturation. Biol Reprod 2002;
66:707– 717.
Lane M, Maybach JM, Hooper K, Hasler JF, Gardner DK. Cryo-survival and
development of bovine blastocysts are enhanced by culture with
recombinant albumin and hyaluronan. Mol Reprod Dev 2003;64:70– 78.
Laurent TC. The Chemistry, Biology and Medical Applications of Hyaluronan and
Its Derivatives. Wenner-Gren INternational Series. London: Portland Press
Ltd, 1998.
Lazzari G, Colleoni S, Lagutina I, Crotti G, Turini P, Tessaro I, Brunetti D,
Duchi R, Galli C. Short-term and long-term effects of embryo culture in
the surrogate sheep oviduct versus in vitro culture for different domestic
species. Theriogenology 2010;73:748– 757.
Lepperdinger G, Mullegger J, Kreil G. Hyal2 – less active, but more versatile?
Matrix Biol 2001;20:509– 514.
Lonergan P, Carolan C, Van Langendonckt A, Donnay I, Khatir H,
Mermillod P. Role of epidermal growth factor in bovine oocyte
maturation and preimplantation embryo development in vitro. Biol
Reprod 1996;54:1420 – 1429.
Marei WF, Wathes DC, Fouladi-Nashta AA. The effect of linolenic Acid on
bovine oocyte maturation and development. Biol Reprod 2009;
81:1064– 1072.
McBride WH, Bard JB. Hyaluronidase-sensitive halos around adherent cells.
Their role in blocking lymphocyte-mediated cytolysis. J Exp Med 1979;
149:507– 515.
McKenzie LJ, Pangas SA, Carson SA, Kovanci E, Cisneros P, Buster JE,
Amato P, Matzuk MM. Human cumulus granulosa cell gene expression: a
predictor of fertilization and embryo selection in women undergoing
IVF. Hum Reprod 2004;19:2869 – 2874.
Ohno-Nakahara M, Honda K, Tanimoto K, Tanaka N, Doi T, Suzuki A,
Yoneno K, Nakatani Y, Ueki M, Ohno S et al. Induction of CD44 and
MMP expression by hyaluronidase treatment of articular chondrocytes.
J Biochem 2004;135:567– 575.
Palasz A, Alkemade S, Mapletoft RJ. The use of sodium hyaluronate in freezing
media for bovine and murine embryos. Cryobiology 1993;30:172– 178.
Palasz AT, Rodriguez-Martinez H, Beltran-Brena P, Perez-Garnelo S,
Martinez MF, Gutierrez-Adan A, De la Fuente J. Effects of hyaluronan,
BSA, and serum on bovine embryo in vitro development, ultrastructure,
and gene expression patterns. Mol Reprod Dev 2006;73:1503 – 1511.
Riley JK, Carayannopoulos MO, Wyman AH, Chi M, Ratajczak CK,
Moley KH. The PI3K/Akt pathway is present and functional in the
preimplantation mouse embryo. Dev Biol 2005;284:377 – 386.
View publication stats
599
Saito T, Kawana H, Azuma K, Toyoda A, Fujita H, Kitagawa M, Harigaya K.
Fragmented hyaluronan is an autocrine chemokinetic motility factor
supported by the HAS2-HYAL2/CD44 system on the plasma
membrane. Int J Oncol 2011;39:1311 – 1320.
Salustri A, Yanagishita M, Hascall VC. Synthesis and accumulation of
hyaluronic acid and proteoglycans in the mouse cumulus cell-oocyte
complex during follicle-stimulating hormone-induced mucification. J Biol
Chem 1989;264:13840– 13847.
Schoenfelder M, Einspanier R. Expression of hyaluronan synthases and
corresponding hyaluronan receptors is differentially regulated during
oocyte maturation in cattle. Biol Reprod 2003;69:269 – 277.
Shimada M, Yanai Y, Okazaki T, Noma N, Kawashima I, Mori T, Richards JS.
Hyaluronan fragments generated by sperm-secreted hyaluronidase
stimulate cytokine/chemokine production via the TLR2 and TLR4
pathway in cumulus cells of ovulated COCs, which may enhance
fertilization. Development 2008;135:2001 – 2011.
Sohara Y, Ishiguro N, Machida K, Kurata H, Thant AA, Senga T, Matsuda S,
Kimata K, Iwata H, Hamaguchi M. Hyaluronan activates cell motility of
v-Src-transformed cells via Ras-mitogen-activated protein kinase and
Downloaded from http://molehr.oxfordjournals.org/ by guest on January 7, 2016
phosphoinositide 3-kinase-Akt in a tumor-specific manner. Mol Biol Cell
2001;12:1859 – 1868.
Stern R. Devising a pathway for hyaluronan catabolism: are we there yet?
Glycobiology 2003;13:105R– 115R.
Stern R. Hyaluronan catabolism: a new metabolic pathway. Eur J Cell Biol
2004;83:317 – 325.
Stern R. Hyaluronan metabolism: a major paradox in cancer biology. Pathol
Biol (Paris) 2005;53:372 – 382.
Stern R, Asari AA, Sugahara KN. Hyaluronan fragments: an information-rich
system. Eur J Cell Biol 2006;85:699 – 715.
Stojkovic M, Kolle S, Peinl S, Stojkovic P, Zakhartchenko V, Thompson JG,
Wenigerkind H, Reichenbach HD, Sinowatz F, Wolf E. Effects of high
concentrations of hyaluronan in culture medium on development and
survival rates of fresh and frozen-thawed bovine embryos produced in
vitro. Reproduction 2002;124:141 – 153.
Stojkovic M, Krebs O, Kolle S, Prelle K, Assmann V, Zakhartchenko V,
Sinowatz F, Wolf E. Developmental regulation of hyaluronan-binding
protein (RHAMM/IHABP) expression in early bovine embryos. Biol
Reprod 2003;68:60 – 66.
Tirone E, D’Alessandris C, Hascall VC, Siracusa G, Salustri A. Hyaluronan
synthesis by mouse cumulus cells is regulated by interactions between
follicle-stimulating hormone (or epidermal growth factor) and a soluble
oocyte factor (or transforming growth factor beta1). J Biol Chem 1997;
272:4787– 4794.
Toole BP. Hyaluronan in morphogenesis. Semin Cell Dev Biol 2001;12:
79 – 87.
Ulbrich SE, Schoenfelder M, Thoene S, Einspanier R. Hyaluronan in the
bovine oviduct–modulation of synthases and receptors during the
estrous cycle. Mol Cell Endocrinol 2004;214:9 – 18.
Wang SJ, Bourguignon LYW. Hyaluronan and the interaction between CD44
and epidermal growth factor receptor in oncogenic signaling and
chemotherapy resistance in head and neck cancer. Arch Otolaryngol Head
Neck Surg 2006;132:771 –778.
Weigel PH, Hascall VC, Tammi M. Hyaluronan synthases. J Biol Chem 1997;
272:13997– 14000.
West DC, Hampson IN, Arnold F, Kumar S. Angiogenesis induced
by degradation products of hyaluronic acid. Science 1985;228:
1324 – 1326.
Xu H, Ito T, Tawada A, Maeda H, Yamanokuchi H, Isahara K, Yoshida K,
Uchiyama Y, Asari A. Effect of hyaluronan oligosaccharides on
the expression of heat shock protein 72. J Biol Chem 2002;277:
17308 – 17314.