|

Received: 14 June 2019    Accepted: 28 August 2019

DOI: 10.1111/rda.13558

ORIGINAL ARTICLE

An approach to study the local embryo effect on gene

expression in the bovine oviduct epithelium in vivo

Beatriz Rodríguez‐Alonso1,2 | Meriem Hamdi1 | José María Sánchez2 | Veronica Maillo1 |

Alfonso Gutierrez‐Adan1 | Pat Lonergan2  | Dimitrios Rizos1

1
Department of Animal Reproduction, INIA,
Madrid, Spain Abstract
2
School of Agriculture and Food This study aimed to examine the local embryo effect on the transcriptomic response
Science, University College Dublin, Dublin,
of the epithelial cells of the oviduct in vivo. Fifteen heifers were synchronized and
Ireland
artificially inseminated to a standing heat. All heifers were slaughtered on Day 2.5
Correspondence
after oestrus. The oviducts from 13 animals were isolated, trimmed free of tissue and
Dimitrios Rizos, Department of Animal
Reproduction, National Institute for divided between ampulla/isthmus. The ipsilateral isthmus was divided into smaller
Agricultural and Food Research and
sections (2 cm). Each section was sequentially flushed until the embryo was located
Technology (INIA), Ctra. De la Coruña KM
5.9, Madrid, Spain. (4/13) and then opened and scraped longitudinally to obtain the epithelial cells. Cells
Email: drizos@inia.es
were snap‐frozen in LN2 for gene expression analysis. All recovered embryos were
Funding information found at the beginning of the isthmus. The 2 cm sections selected for the transcrip‐
European Union H2020 Marie Sklodowska‐
tomic analysis were as follows: embryo section (in which the embryo was found);
Curie (MSCA) Innovative Training Network
(ITN), Grant/Award Number: REP‐BIOTECH proximal section (through which the embryo had passed); distal section (on the uter‐
‐ 675526; Spanish Ministry of Science,
ine side of the embryo); and contralateral section (section from the contralateral isth‐
Innovation and Universities, Grant/Award
Number: AGL2015‐70140‐R to D. Rizos and mus). The expression pattern of eight genes (STK32A, KERA, QRFPR, MCTP1, PRELP,
AGL2015‐66145‐R to; Science Foundation
VAT1L, SOCS3 and CCL20) differentially expressed between the isthmus of pregnant
Ireland, Grant/Award Number: 13/IA/1983
(multiple embryo model) and cyclic heifers were assessed by RT‐qPCR. One‐way
ANOVA and t test was used for statistical analysis. Comparisons between ipsilateral
and contralateral oviduct or along the ipsilateral oviduct resulted in no differences
for all genes. Despite the failure to detect a site‐specific response of a single embryo
on the abundance of distinct transcripts in the bovine oviduct in vivo on Day 2.5, the
current methodology with proposed modifications would be useful for future studies
to examine the local embryo effect.

KEYWORDS
BOEC, bovine, embryo, embryo–maternal communication, oviduct

1 | I NTRO D U C TI O N of pregnancy. The deciphering of embryo–maternal interactions may

Embryonic mortality is a major contributor to reproductive effi‐
ciency in cattle (Diskin & Morris, 2008). About 20%–50% of high‐
producing lactating dairy cows experience pregnancy loss during the
first week of gestation (Wiltbank et al., 2016). Thus, interaction be‐
tween the developing embryo and the maternal reproductive tract
during the preimplantation period is essential for the establishment
allow the development of new therapeutic strategies to enhance
embryonic survival and improve reproductive efficiency.
While there is clear evidence for a two‐way interaction between
the uterus and developing conceptus in cattle (Sánchez, Mathew,
Passaro, Fair, & Lonergan, 2018), little is known about the recip‐
rocal crosstalk during the transit of the early embryo through the
oviduct. Thus, embryo–oviductal crosstalk remains one of the most

1516  |  wileyonlinelibrary.com/journal/rda

© 2019 Blackwell Verlag GmbH Reprod Dom Anim. 2019;54:1516–1523.
RODRÍGUEZ‐ALONSO et al.
challenging subjects in reproductive biology. Although it has been
clearly demonstrated that the oviduct exerts a positive influence on
the quality of the early embryo (reviewed by Fernandez‐Fuertes et
al., 2018), relatively little evidence exists for a reciprocal effect of
the early embryo on the oviduct. In recent years, a small number of
studies have shown that the presence of the embryo has an impact
on the oviduct by regulating its gene expression, mainly by genes
related to the immune system response (Maillo et al., 2015; Smits
et al., 2016). This control might help to avoid the rejection of the
preimplantation embryo by enhancing the maternal immune toler‐
ance, a process which is still not fully elucidated (Ott, 2019). Most
studies assessing the embryo effect on the oviductal transcriptome
have been performed in litter‐bearing species such as mice (Lee, Yao,
Kwok, Xu, & Yeung, 2002) or swine (Almiñana et al., 2012), in which
it has been shown that the presence of embryos alters the expres‐
sion of selected genes in the oviduct during the preimplantation
period. In contrast, in mono‐ovulatory species a limited number of
studies have reported detectable effects exerted by the presence
of a single embryo. Smits et al., (2016) reported a local influence of
the equine embryo on the oviductal epithelium transcriptome in the
ampullary–isthmic junction, where the equine embryo stays during
its early development (Weber, Woods, & Aguilar, 1996). In a previ‐
ous study from our group, in cattle, we failed to detect any changes
in the global transcriptome of the oviduct when only one embryo
was present; it was necessary to transfer multiple embryos (up to
50) into the oviducts of heifers to detect an embryo effect on the
oviductal transcriptome (Maillo et al., 2015). Given the size of the
bovine embryo (approximately 120 microns in diameter), it is very
likely that any effects on the oviductal epithelium induced by the
embryo are very local in nature. In agreement with this hypothesis,
Sponchiado et al., (2017) reported the alteration of a small number
of transcripts in the endometrium induced by the presence of a Day
7 embryo. To date, methods used to examine gene expression in the
bovine oviduct have involved collecting tissue from the whole ovi‐
duct (Bauersachs et al., 2003) or the entire isthmus (Locatelli et al.,
2019; Maillo et al., 2015). In order to detect such local embryo‐in‐
duced changes in gene expression if they exist, it is necessary to
limit the sampling area to the location where embryo is in ‘direct
contact’ with the oviduct. Hence, here we describe a new method‐
ology consisting of the dissection and flushing of small sections of
the bovine oviduct (2 cm long) in order to recover the epithelium
in direct contact with the embryo. We hypothesized that the pres‐
ence of the embryo induces changes in the abundance of specific
transcripts in the oviduct at the precise site at which it is located. To
test this hypothesis, the overall aim of this study was to examine the
local embryo effect on the mRNA abundance of specific genes in the
epithelial cells of the bovine oviduct in vivo.
2 | M ATE R I A L S A N D M E TH O DS
All experimental procedures involving animals were sanctioned by
the Animal Research Ethics Committee of University College Dublin
|
      1517
and were licensed by the Health Products Regulatory Authority,
Ireland, in accordance with Statutory Instrument No. 543 of 2012
under Directive 2010/63/EU on the Protection of Animals used for
Scientific Purposes.
2.1 | Animal model
The experimental design is illustrated in Figure 1. Briefly, the re‐
productive tracts of 15 Charolais‐ or Limousin‐cross heifers
(27.6 ± 1.1 months old and 605.7 ± 11.3 kg; mean ± SEM) were ex‐
amined via transrectal using a portable ultrasound machine (Easy‐
Scan™; BCF Technology Ltd). None of the heifers enrolled in the
study had uterine/ovarian disease (i.e., endometritis, freemartins,
ovarian cyst) or were pregnant. All animals were housed indoors on
slats for the duration of the study and fed a diet consisting of grass
and maize silage supplemented with a standard beef ration. Oestrous
cycles were synchronized using an 8‐day progesterone‐releasing in‐
travaginal device (PRID Delta, containing 1.55 g progesterone; Ceva
Sante Animale) with administration of a gonadotrophin‐releasing
hormone (GnRH) analogue (Ovarelin, 2 ml, 100 μg gonadorelin; Ceva
Sante Animale) at PRID insertion and prostaglandin F2α (Enzaprost,
5 ml equivalent to 25 mg dinoprost; Ceva Sante Animale) given on
the day before PRID removal. Heifers were checked for signs of oes‐
trus six times per day, commencing 30 hr after PRID removal. Only
those heifers observed in standing oestrus (Day 0) were used and
artificially inseminated 12 and 24 hr after first standing in oestrus
with frozen‐thawed semen from a bull of proven fertility.
2.2 | Sample collection
Animals were slaughtered in a commercial abattoir 2.5–3 days
(68.4 ± 1.9 hr) after the onset of oestrus. Following slaughter, and in
a period of time no longer than 20 min, the reproductive tract was
removed and sealed in a plastic bag placed on ice. Tracts were then
transported to the laboratory (within the first hour after sample re‐
covery), and oviducts were processed on ice presumably hindering
the embryo movement within the oviduct by post‐mortem peristal‐
tic contractions. The oviducts ipsilateral and contralateral to the cor‐
pus luteum (CL) were trimmed free of tissue and, after removal of the
infundibulum and the utero–tubal junction, each was divided into
two parts through the ampullary–isthmic junction, identified where
the oviduct diameter first exhibited a marked reduction in size, going
from ampulla to isthmus (Kobayashi, Wakamiya, Kohka, Yamamoto,
& Okuda, 2013; Maillo et al., 2016). The ipsilateral isthmus was then
divided into 2 cm sections, and each section was separately flushed
with 200 μl of PBS. The presence, location (oviductal section) and
the stage of the embryo (when present) were verified under a stere‐
omicroscope. After flushing, each section of the oviduct was opened
longitudinally and gently scraped with a blade to recover the epi‐
thelial cells. The same procedure has been previously performed by
us (Maillo et al., 2016) in which the epithelial nature of the recov‐
ered cells was confirmed by ‘flow cytometry analysis’ using antibod‐
ies anti‐bovine‐pancadherin (C1821), anti‐bovine‐pancytokeratin
 |
1518       RODRÍGUEZ‐ALONSO et al.

F I G U R E 1   Experimental design. A group of 15 heifers were artificially inseminated and slaughtered 2.5–3 days after oestrus. The
reproductive tracts were collected and processed as shown. Briefly, the oviducts were trimmed free of tissue and cut into 2‐cm sections.
Embryo location was assessed and oviduct epithelial cells (OEC) were collected for the gene expression analysis

(C2931) and anti‐bovine‐vimentin (V2258). The cells obtained after
centrifugation (18.8 g for 1 min at 4°C) were snap‐frozen and stored
at −80°C until gene expression analysis. The experimental groups
consisted of four 2 cm oviductal portions—three from the ipsilateral
oviduct: (a) embryo section (ES, in which the embryo was found);
(b) proximal section (PS, through which the embryo had passed); (c)
distal section (DS, on the uterine side of the embryo) and a fourth
section collected from the contralateral oviduct: (d) contralateral
section (CS, section from the contralateral isthmus corresponding to
that in which the embryo was found in the ipsilateral isthmus—that
is same distance from the UTJ). The experimental groups are repre‐
sented in Figure 1.
RODRÍGUEZ‐ALONSO et al. |
      1519

TA B L E 1   Details of primers used for

GenBank accession
the RT‐qPCR
Gene no. Primer sequence (5'−3') Size (bp)

ACTB AF191490.1 Forward: GAGAAGCTCTGCTACGTCG 264

Reverse: CCAGACAGCACCGTGTTGG
CCL20 NM_174263.2 Forward: CTGCAGCAAGTCAGAAGCAAG 118
Reverse: GATGTCACAGGCTTCATTGGC
KERA NM_173910.1 Forward: CAAAGGTGTTCATGGTGACCG 195
Reverse:ATGCCATTATAGTATCTTGCTG
TCC
MCTP1 NM_001104987.1 Forward: AGGGTAGGGACAACTCCAGA 232
Reverse: GAAGAGCCAGGGCTTGGTAA
PRELP NM_174434.3 Forward: 158
CAGCATCGAGAAAATCAATGGGA
Reverse: AGCACATCATGAGGTCCAGC
QRFPR NM_001192681.1 Forward: CTGCTTGGAAGAGTGGAGCA 212
Reverse: CTCGCTTCTTCTTCCTGGCTAT
SOCS3 NM_174466.2 Forward: GCGAGAAGATCCCTCTGGTG 167
Reverse: CTAAAGCGGGGCATCGTACT
STK32A NM_001105047.1 Forward: CTCTCAGACATGCCTTCTTCA 149
Reverse: ATCGAGGCATTGCAAGTCAA
VAT1L NM_001046624.2 Forward: AAGGATTTGAGATCGGGGACC 161
Reverse: CATCATGTAGGCGGTGACGA

Abbreviations: ACTB, actin, beta; CCL20, chemokine (C‐C motif) ligand 20; KERA, keratocan;
MCTP1, multiple C2 domains, transmembrane 1; PRELP, proline/arginine‐rich end leucine‐rich re‐
peat protein; QRFRP, pyroglutamylated RFamide peptide receptor; SOCS3, suppressor of cytokine
signalling 3; STK32A, serine/threonine kinase 32A; VAT1L, vesicle amine transport 1‐like.

2.3 | RNA extraction, reverse transcription and
quantitative real‐time PCR
Four biological replicates (i.e., heifers in which an embryo was found)
were used for the assessment. The mRNA abundance of the selected
genes was determined by reverse transcription‐quantitative polymer‐
ase chain reaction (RT‐qPCR). Eight of the top up‐ and down‐regulated
genes previously reported to be differentially expressed between
the isthmus of pregnant (multiple embryos) and cyclic heifers (Maillo
et al., 2015) were selected as candidate genes. RNA extraction from
the oviduct epithelial cells was performed with the FavorPrep Tissue
Total RNA Purification Mini Kit (Favorgen Biotech Corp) and tran‐
scribed into cDNA following the manufacturer's instruction (Epicentre
Technologies Corp). As described by (Maillo et al., 2015), all RT‐qPCR
reactions were carried out in duplicate (i.e., eight technical replicates)
on the Rotorgene 6000 Real‐Time Cycler (Corbett Research) by adding
2 μl of each sample to the PCR mix (GoTaq qPCR Master Mix; Promega)
containing the specific primers selected to amplify: serine/threonine
kinase 32A (STK32A); keratocan (KERA); pyroglutamylated RFamide
peptide receptor (QRFPR); multiple C2 domains; transmembrane 1
(MCTP1); proline/arginine‐rich end leucine‐rich repeat protein (PRELP);
vesicle amine transport 1‐like (VAT1L); suppressor of cytokine signal‐
ling 3 (SOCS3); and chemokine (C‐C motif) ligand 20 (CCL20). Each PCR
mix was done for each primer pair. All the primers used were tested in
previous study (Maillo et al., 2015). Primer sequences and the approxi‐
mate sizes of the amplified fragments of all transcripts are shown in
Table 1. Cycling conditions were 94ºC for 3 min followed by 35 cycles
of 94ºC for 15 s, 56ºC for 30 s and 72ºC for 10 s, with 10 s of fluores‐
cence acquisition. To avoid primer–dimer artefacts, fluorescence was
acquired in each cycle at a temperature higher than the melting tem‐
perature of primer–dimers (specific for each product). Then, the cycle
threshold (CT) or the cycle during the log‐linear phase of the reaction
at which fluorescence increased above background was determined
for each sample. The ΔCT value was determined by subtracting the
endogenous control (ACTB; reference gene previously tested in ovi‐
duct epithelial cells in in vivo (Maillo et al., 2015) and in vitro (García et
al., 2017) studies) CT value for each sample from each gene CT value
of the sample. Calculation of ΔΔCT involved using the highest sample
ΔCT value (i.e., the sample with the lowest target expression) as a con‐
stant to subtract from all other ΔCT sample values. Fold‐changes in
the relative gene expression of the target were determined using the
equation 2–ΔΔCT (Schmittgen & Livak, 2008).
2.4 | Statistical analysis
Gene expression comparisons between two groups (i.e., ES vs. CS)
were performed with the Student t test for normally distributed
data. For non‐normally distributed data, the Mann–Whitney U test
was used. Differences in gene expression among three groups (i.e.,
comparisons along the ipsilateral oviduct: PS, ES and DS) were ana‐
lysed by one‐way analysis of variance (ANOVA). All statistical analy‐
ses were performed with the SigmaStat (Jandel Scientific) software.
Values were considered significantly different when the p value was
lower than .05.
 |
1520       RODRÍGUEZ‐ALONSO et al.

F I G U R E 2   Relative mRNA abundance of 8 candidate genes (STK32A, KERA, QRFPR, MCTP1, CCL20, SOCS3, VAT1L, PRELP) assessed
in BOECs between the Embryo Section (ES) and the Contralateral Section (CS). Bars represent the relative abundance of the transcripts
analysed and normalized to ACTB as housekeeping gene. Results are expressed as means ± SEM

F I G U R E 3   Relative mRNA abundance of 8 candidate genes (STK32A, KERA, QRFPR, MCTP1, CCL20, SOCS3, VAT1L, PRELP) assessed
in BOECs between the sections within the ipsilateral oviduct: Proximal Section (PS), Embryo Section (ES) and Distal Section (DS). Bars
represent the relative abundance of the transcripts analysed and normalized to ACTB as housekeeping gene. Results are expressed as
means ± SEM
RODRÍGUEZ‐ALONSO et al.
3 |  R E S U LT S
3.1 | Embryo recovery
Of the 15 animals synchronized, 15 exhibited standing oestrus and
were inseminated. Two heifers did not have CL at slaughter and were
removed from the study. Embryos were found in 4 out of the 13 heif‐
ers (recovery rate of 30.8%). All recovered embryos were located at
the isthmus close to the ampullary–isthmic junction of the oviduct ip‐
silateral to the CL. Of the 4 embryos recovered, 3 were at 2‐cell stage
and 1 at 8‐cell stage.
3.2 | Local embryo effect in the oviduct epithelium
Comparison of transcript abundance between the oviduct section
in which the embryo was found (ES), and the corresponding section
from the contralateral oviduct (CS) revealed no significant difference
(p > .05) (Figure 2).
Gene expression analysis in oviduct epithelial cells recovered
from the oviductal sections along the oviduct ipsilateral to the CL
(PS, ES and DS) revealed that no transcripts were differentially ex‐
pressed due to the presence of the embryo (p > .05) (Figure 3).
4 | D I S CU S S I O N
Results of this study do not provide evidence for a site‐specific re‐
sponse of the oviduct to the presence of a single bovine embryo
on Day 2.5. Despite the attempt to assess early embryo–maternal
dialogue by decreasing the embryo to oviduct tissue ratio through
analysis of the oviduct surface that was in direct contact with the
embryo and its immediate surroundings, no differences were found
for any of the genes analysed.
The hypothesis that the presence of an embryo is able to elicit
changes in the oviduct epithelium transcriptome is based on find‐
ings from mammals such as mice (Lee et al., 2002), swine (Almiñana
et al., 2012) and horses (Smits et al., 2016). Furthermore, in support
of the hypothesis that the embryo is able to communicate with the
oviduct, in vitro studies have shown that bovine oviduct epithelial cell
(BOEC) transcriptome is affected by the embryo presence (García et
al., 2017; Schmaltz‐Panneau et al., 2014). In cattle, while the presence
of multiple embryos in the oviduct resulted in the detection of dif‐
ferentially expressed genes (Maillo et al., 2015), attempts to detect
the effect of a single bovine embryo on the oviductal isthmus were
unsuccessful (Maillo et al., 2015). Those findings suggested that if the
embryo has any effect, it must be very local in nature, undetectable
under those conditions. Therefore, the methodology from the present
study aimed to decrease the embryo to oviduct tissue ratio in order to
detect a local embryo effect on the oviduct epithelium at the precise
point where the embryo is located and in its immediate surroundings.
However, contrary to our initial hypothesis and in line with previous
studies (Maillo et al., 2015), the abundance of specific transcripts in
the oviduct at the precise site at which a single embryo is located did
|
      1521
not differ. Of the 8 genes analysed, VAT1L was the only one showing a
statistical trend when comparisons between the embryo section (ipsi‐
lateral oviduct) and the corresponding section from the contralateral
oviduct were carried out (p = .106), exhibiting lower relative mRNA
abundance in the presence of the embryo (Figure 2). The molecular
function of VAT1L is related with (a) oxidoreductase activity and (b)
zinc ion binding (interacting selectively and non‐covalently with zinc
ions). Interestingly, the presence of a single equine embryo in the mare
oviduct regulates a gene, SLC39A2, involved with zinc ion homeostasis
(Smits et al., 2016).
Failure to provide evidence for a site‐specific response of the ovi‐
duct to the embryo under these experimental conditions could be
due to several factors. The methodological difficulties in the sample
handling due to the multiple cuts in the isthmic portion of the oviduct
and the flushing of such small oviductal sections (2 cm) resulted in a
lower embryo recovery (30.8%) compared to that typically achieved
when flushing the entire oviduct or isthmus (72.7%; Maillo et al.,
2015). Despite the multiple manipulations needed for oviduct trans‐
port, dissection and cutting, all of the embryos were found in the same
oviductal area (after the ampullary–isthmic junction). Moreover, this
location of the embryos within the oviduct is in concordance with the
timing of embryo recovery (Day 2.5 after oestrus). Therefore, it seems
reasonable to hypothesize that the embryo was found at the site in
which it was located before slaughter. Sample recovery on Day 2.5 was
performed in order to be certain that (a) the embryo would be found
within the oviduct and (b) that the embryo location enabled the col‐
lection of the oviductal portions surrounding the embryo section (i.e.,
proximal and distal sections). However, as described, this early embryo
recovery entailed finding the embryos around the ampullary–isthmic
junction, which may mask the embryo effect due to the spatial dif‐
ferences in gene expression between the two sections of the oviduct
(Maillo et al., 2016). In line with this, the fact that three out of the four
embryos recovered at Day 2.5 were at the 2‐cell stage—that is before
major embryo genome activation, which in cattle occurs around the
8‐cell stage (Graf et al., 2014)—could have influenced the oviduct re‐
sponse, which in vitro has been demonstrated to be embryo stage‐
specific (Hamdi et al., 2019). Furthermore, comparison of the oviduct
section containing the embryo and the corresponding contralateral
section could be potentially misleading based on results describing an
effect of the CL proximity (i.e., differences between the ipsilateral and
contralateral oviducts) on the oviduct transcriptome in cyclic heifers at
Day 1 (Fontes et al., 2018), 3 (Locatelli et al., 2019) or 3.5 after oestrus
(Bauersachs et al., 2003). Use of technologies such as RNA sequencing
may be more convenient in order to have a wider view of the embryo
effect on oviduct gene expression. Future approaches should consider
all these factors to increase the recovery of embryos at the most ade‐
quate stage of development (8 to 16 cell) possibly in shorter oviductal
sections in order to further decrease the embryo/oviduct tissue ratio.
In conclusion, although this study failed to detect embryo‐induced
changes in the abundance of specific transcripts in the bovine ovi‐
duct in vivo, current methodology with modifications may be useful
for future studies to examine the local embryo effect. Given that the
interaction between the early embryo and the maternal environment
 |
1522       RODRÍGUEZ‐ALONSO et al.
has potentially short‐ and long‐term consequences for the embryo,
studying the embryo in its natural environment would lead to poten‐
tial benefits improving current assisted reproductive technologies and
promoting new strategies enhancing fertility in dairy cattle.
AC K N OW L E D G E M E N T S
This study was supported by the European Union H2020 Marie
Sklodowska‐Curie (MSCA) Innovative Training Network (ITN)
project ‘Biology and Technology of Reproductive Health—REP‐
BIOTECH—675526', the Spanish Ministry of Science, Innovation and
Universities—(AGL2015‐70140‐R to D. Rizos and AGL2015‐66145‐R
to A. Gutierrez‐Adan) and Science Foundation Ireland—13/IA/1983.
The authors are members of the COST Action 16119 ‘In vitro 3‐D
total cell guidance and fitness (Cellfit)'.
C O N FL I C T O F I N T E R E S T
None of the authors have any conflict of interest to declare.
AU T H O R C O N T R I B U T I O N S
D Rizos and P Lonergan designed the study. B Rodriguez‐Alonso, M
Hamdi, JM Sanchez, V Maillo, P Lonergan and D Rizos obtained the
samples. B Rodriguez‐Alonso and A Gutierrez‐Adan performed the
gene expression analysis. B Rodriguez‐Alonso and D Rizos analysed
the data and drafted the manuscript. All authors contributed to the
manuscript corrections.
DATA AVA I L A B I L I T Y S TAT E M E N T
The data that support the findings of this study are available from
the corresponding author upon reasonable request.
ORCID
Pat Lonergan  https://orcid.org/0000-0001-5598-5044
Dimitrios Rizos  https://orcid.org/0000-0001-6813-3940
REFERENCES
Almiñana, C., Heath, P. R., Wilkinson, S., Sanchez‐Osorio, J., Cuello, C.,
Parrilla, I., … Fazeli, A. (2012). Early developing pig embryos mediate
their own environment in the maternal tract. PLoS ONE, 7, e33625.
https​://doi.org/10.1371/journ​al.pone.0033625
Bauersachs, S., Blum, H., Mallok, S., Wenigerkind, H., Rief, S., Prelle, K.,
& Wolf, E. (2003). Regulation of ipsilateral and contralateral bovine
oviduct epithelial cell function in the postovulation period: A tran‐
scriptomics approach. Biology of Reproduction, 68, 1170–1177. https​
://doi.org/10.1095/biolr​eprod.102.010660
Diskin, M. G., & Morris, D. G. (2008). Embryonic and early foetal losses
in cattle and other ruminants. Reproduction in Domestic Animals, 43,
260–267. https​://doi.org/10.1111/j.1439-0531.2008.01171.x
Fernandez‐Fuertes, B., Rodríguez‐Alonso, B., Sánchez, J. M., Simintiras,
C. A., Lonergan, P., & Rizos, D. (2018). Looking at the big picture:
Understanding how the oviduct s dialogue with gametes and the em‐
bryo shapes reproductive success. Animal Reproduction, 15, 751–764.
https​://doi.org/10.21451/​1984-3143-AR2018-0036
Fontes, P. K., Ereno, R. L., Peixoto, A. R., Carvalho, R. F., Scarano, W. R.,
Trinca, L. A., … Castilho, A. C. d. S. (2018). Can the antral follicular
count modulate the gene expression of bovine oviducts in Aberdeen
Angus and Nelore heifers? PLoS ONE, 13, e0202017. https​://doi.
org/10.1371/journ​al.pone.0202017
García, E. V., Hamdi, M., Barrera, A. D., Sánchez‐Calabuig, M. J.,
Gutiérrez‐Adán, A., & Rizos, D. (2017). Bovine embryo‐oviduct
interaction in vitro reveals an early cross talk mediated by BMP
signaling. Reproduction, 153, 631–643. https​ ://doi.org/10.1530/
REP-16-0654
Graf, A., Krebs, S., Zakhartchenko, V., Schwalb, B., Blum, H., & Wolf, E.
(2014). Fine mapping of genome activation in bovine embryos by RNA
sequencing. Proceedings of the National Academy of Sciences of the
United States of America, 111, 4139–4144. https​://doi.org/10.1073/
pnas.13215​69111​
Hamdi, M., Sánchez‐Calabuig, M. J., Rodríguez‐Alonso, B., Roussi,
K., Gutierrez‐Adan, A., Sturmey, R., … Rizos, D. (2019). Gene ex‐
pression and metabolic response of bovine oviduct epithelial cells
to early embryo in vitro. Reproduction, https​://doi.org/10.1530/
REP-18-0561
Kobayashi, Y., Wakamiya, K., Kohka, M., Yamamoto, Y., & Okuda, K.
(2013). Summer heat stress affects prostaglandin synthesis in the bo‐
vine oviduct. Reproduction, 146, 103–110. https​://doi.org/10.1530/
REP-12-0479
Lee, K.‐F., Yao, Y.‐Q., Kwok, K.‐L., Xu, J.‐S., & Yeung, W. S. B. (2002).
Early developing embryos affect the gene expression patterns
in the mouse oviduct. Biochemical and Biophysical Research
Communications, 292, 564–570. https​://doi.org/10.1006/
bbrc.2002.6676
Locatelli, Y., Forde, N., Blum, H., Graf, A., Piégu, B., Mermillod, P., …
Saint‐Dizier, M. (2019). Relative effects of location relative to the
corpus luteum and lactation on the transcriptome of the bovine ovi‐
duct epithelium. BMC Genomics, 20, 233. https​://doi.org/10.1186/
s12864-019-5616-2
Maillo, V., de Frutos, C., O'Gaora, P., Forde, N., Burns, G. W., Spencer, T.
E., … Rizos, D. (2016). Spatial differences in gene expression in the
bovine oviduct. Reproduction, 152, 37–46. https​://doi.org/10.1530/
REP-16-0074
Maillo, V., Gaora, P. Ó., Forde, N., Besenfelder, U., Havlicek, V., Burns, G.
W., … Rizos, D. (2015). Oviduct‐embryo interactions in cattle: Two‐
way traffic or a one‐way street? Biology of Reproduction, 92, 144.
https​://doi.org/10.1095/biolr​eprod.115.127969
Ott, T. L. (2019). Symposium review: Immunological detection of the bo‐
vine conceptus during early pregnancy. Journal of Dairy Science, 102,
3766–3777. https​://doi.org/10.3168/jds.2018-15668​
Sánchez, J. M., Mathew, D. J., Passaro, C., Fair, T., & Lonergan, P. (2018).
Embryonic maternal interaction in cattle and its relationship with
fertility. Reproduction in Domestic Animals, 53, 20–27. https​ ://doi.
org/10.1111/rda.13297​
Schmaltz‐Panneau, B., Cordova, A., Dhorne‐Pollet, S., Hennequet‐Antier,
C., Uzbekova, S., Martinot, E., … Locatelli, Y. (2014). Early bovine em‐
bryos regulate oviduct epithelial cell gene expression during in vitro
co‐culture. Animal Reproduction Science, 149, 103–116. https​://doi.
org/10.1016/j.anire​prosci.2014.06.022
Schmittgen, T. D., & Livak, K. J. (2008). Analyzing real‐time PCR data by
the comparative CT method. Nature Protocols, 3, 1101–1108. https​://
doi.org/10.1038/nprot.2008.73
Smits, K., De Coninck, D. I. M., Van Nieuwerburgh, F., Govaere, J.,
Van Poucke, M., Peelman, L., … Van Soom, A. (2016). The equine
embryo influences immune‐related gene expression in the ovi‐
duct. Biology of Reproduction, 94, 36. https​://doi.org/10.1095/biolr​
eprod.115.136432
RODRÍGUEZ‐ALONSO et al. |
      1523

Sponchiado, M., Gomes, N. S., Fontes, P. K., Martins, T., del Collado, Theriogenology, 86, 239–253. https​://doi.org/10.1016/j.theri​ogeno​
M., de Pastore, A. A., … Binelli, M. (2017). Pre‐hatching embryo‐de‐ logy.2016.04.037
pendent and ‐independent programming of endometrial function
in cattle. PLoS ONE, 12, e0175954. https​ ://doi.org/10.1371/journ​
al.pone.0175954
How to cite this article: Rodríguez‐Alonso B, Hamdi M,
Weber, J. A., Woods, G. L., & Aguilar, J. J. (1996). Location of equine
Sánchez JM, et al. An approach to study the local embryo
oviductal embryos on day 5 post ovulation and oviductal transport
time of day 5 embryos autotransferred to the contralateral oviduct. effect on gene expression in the bovine oviduct epithelium in
Theriogenology, 46, 1477–2148. vivo. Reprod Dom Anim. 2019;54:1516–1523. https​://doi.
Wiltbank, M. C., Baez, G. M., Garcia‐Guerra, A., Toledo, M. Z., Monteiro, org/10.1111/rda.13558​
P. L. J., Melo, L. F., … Sartori, R. (2016). Pivotal periods for pregnancy
loss during the first trimester of gestation in lactating dairy cows.