letters
Engineering phosphorus metabolism in plants to
produce a dual fertilization and weed control system
Damar Lizbeth López-Arredondo & Luis Herrera-Estrella
High crop yields depend on the continuous input of
orthophosphate (PO4−3)-based fertilizers and herbicides1,2.
Two major challenges for agriculture are that phosphorus
is a nonrenewable resource and that weeds have developed
broad herbicide resistance3–5. One strategy to overcome both
problems is to engineer plants to outcompete weeds and
© 2012 Nature America, Inc. All rights reserved.
microorganisms for limiting resources, thereby reducing the
requirement for both fertilizers and herbicides. Plants and most
microorganisms are unable to metabolize phosphite (PO3−3),
so we developed a dual fertilization and weed control system
by generating transgenic plants that can use phosphite as a
sole phosphorus source. Under greenhouse conditions, these
transgenic plants require 30–50% less phosphorus input when
fertilized with phosphite to achieve similar productivity to that
obtained by the same plants using orthophosphate fertilizer
and, when in competition with weeds, accumulate 2–10 times
greater biomass than when fertilized with orthophosphate.
Drought, poor soil fertility and aggressive weeds pose major con-
straints to meeting the increasing demand for global food produc-
tion. Starting with the green revolution in the 1960s, higher yields
have been accompanied by a steady increase in the use of fertiliz-
ers and herbicides1,2. Fertilizers based on orthophosphate attract
npg
special attention because in addition to an essential role in central
metabolic processes for all living organisms6, phosphorus is a non-
renewable resource (with a rapidly increasing price) that may only
last from an estimated 70–200 years if current use is maintained3,4.
Orthophosphate availability is a key determinant of plant productivity
as it is the only chemical form of phosphorus that can be assimilated
by plants to meet their nutritional requirements. However, ortho-
phosphate availability is limiting for plant growth in about 67% of
cultivated soils7. Low orthophosphate availability is mainly due to
high reactivity of orthophosphate with soil components and rapid
conversion by soil bacteria of orthophosphate to organic forms that
cannot be taken up by plants. Owing to both of these factors, as little
as 20–30% of the orthophosphate that is applied as fertilizer is actually
used by cultivated plants8,9. The inefficient utilization of orthophos-
phate present in fertilizer is further aggravated by the competition of
weeds with crops for soil resources2. Moreover, because many weeds
have developed herbicide resistance, excessive applications of both
orthophosphate fertilizers and herbicides are nowadays routine,
Laboratorio Nacional de Genómica para la Biodiversidad, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional, Irapuato, Guanajuato,
México. Correspondence should be addressed to L.H.-E. (lherrera@langebio.cinvestav.mx).
Received 7 May; accepted 1 August; published online 26 August 2012; doi:10.1038/nbt.2346
nature biotechnology  VOLUME 30  NUMBER 9  SEPTEMBER 2012 889
which not only increases production costs and food prices, but
also poses serious environmental problems2,5,10. Orthophosphate-
agricultural run-off can increase orthophosphate concentrations by
two- to threefold in rivers and oceans, thereby promoting the forma-
tion of toxic algae blooms that are a major ecological problem11.
With orthophosphate reserves rapidly declining, research has focused
on the development of alternative fertilization schemes to reduce
orthophosphate application, cost-effective technologies for phos-
phorus recycling and the design of more effective weed-management
systems3,6,12. Because orthophosphate cannot be substituted in plant
nutrition, relatively little attention has been given to the use of other
chemical forms of phosphorus to formulate effective and potentially
less environmentally hazardous fertilizers. Phosphite, a reduced form
of phosphorus, was proposed as a promising alternative fertilizer after
the Second World War, owing to its distinct chemical and biochemi-
cal properties compared with orthophosphate12,13, including higher
solubility, lower reactivity with soil components and the inability of
most microorganisms to use it as a phosphorus source14–16. However,
plants cannot metabolize phosphite, limiting its use as a fertilizer17–23.
As phosphite inhibits plant growth, its use as a broad-spectrum,
nonselective, weed-management system has been proposed 13,24.
The reported beneficial effects of phosphite on productivity of
plants could be due to inhibition of weed growth, and other well-
­documented properties such as reducing the incidence of diseases
caused by Phythophthora species (phosphite inhibits the growth of
oomycetes and activates plant defense mechanisms)21,24,25.
A few bacterial strains that are capable of oxidizing phosphite
to produce orthophosphate have been described previously 16. In
Pseudomonas stutzeri WM88, the ptxD gene encodes a phosphite-
specific oxido­reductase that oxidizes phosphite using NAD+ as a
cofactor, to produce orthophosphate and NADH as products26,27.
To test whether a pathway to convert phosphite into orthophosphate
could be engineered into plants, we produced transgenic Arabidopsis
lines expressing the ptxD coding sequence (ptxDAt lines) under the
control of the constitutive CaMV 35S promoter (35SøPTXD) (Fig. 1
and Supplementary Fig. 1). To confirm that 35S:PTXD plants are
capable of using phosphite as a phosphorus source, we germinated
seeds from transgenic lines and nontransformed siblings in media
lacking orthophosphate and supplemented with phosphite. As previ-
ously reported17–23, control seedlings are unable to metabolize phos-
phite, displaying restricted development and achieving a maximum
 letters
Figure 1  Transgenic Arabidopsis plants that express a phosphite
oxidoreductase can use phosphite as a phosphorus source. (a) Comparative
growth of seedlings from ptxDAt-3, 5 and 7 lines, and WT (Col-0) in solid
media containing 1 mM phosphate (Pi) or 1 mM phosphite (Phi).
(b) Transgenic Arabidopsis lines and WT control grown in vertical plates
containing 1 mM phosphite. (Phi) (c) Transgenic and WT plants grown in a
sterilized mixture of sand and vermiculite (left to right) not fertilized
(left-hand panel, control) or fertilized with either orthophosphate (middle
panel) or phosphite (right-hand panel) as phosphorus source (phosphite
and orthophosphate applied at 40 mg kg−1). Inset: top view of WT plants
with phosphite. Plants are representative of two independent experiments
(n = 8–10 plants/treatment each). Scale bars, 5 cm.
size of 3–6 mm in length before their growth is completely arrested.
In contrast, transgenic seedlings harboring the 35S:PTXD construct
can use phosphite as a phosphorus source to sustain growth similar
to that observed for transgenic and control plants grown in media
containing orthophosphate (Fig. 1a). ptxDAt lines cultivated in
vertically oriented agar plates displayed vigorous growth with well-
developed root systems, whereas control seedlings were arrested at
the cotyledonary stage, developing short primary roots with little or
no lateral root formation (Fig. 1b). These results show that transgenic
© 2012 Nature America, Inc. All rights reserved.
plants expressing ptxD are unaffected by the growth-inhibitory effect
of phosphite and can use phosphite as a phosphorus source.
To determine whether PTXD Arabidopsis plants could efficiently use
phosphite as a phosphorus source under greenhouse conditions, ptxDAt
and control seedlings were transferred to pots containing a sterilized
mixture of sand and vermiculite supplemented with orthophosphate or
phosphite as phosphorus sources. ptxDAt lines fertilized with phosphite
clearly showed vigorous growth, produced biomass and accumulated
phosphorus at levels indistinguishable from those of control and trans-
genic plants grown with orthophosphate (Fig. 1c and Supplementary
Fig. 2), whereas control plants grown with phosphite as the sole phos-
phorus source displayed more restricted growth than those grown in
unfertilized substrate and survived for a maximum of 20 d (Fig. 1c).
These results confirm that the addition of phosphite further reduces
plant growth when orthophosphate availability is low22,23 and suggest
the possibility of controlling the growth of plants that are unable to
metabolize phosphite, such as weeds, under these conditions.
To determine whether expression of the ptxD gene could enable
npg
other plant species to use phosphite as a phosphorus source, we pro-
duced transgenic tobacco plants harboring the 35SøPTXD construct
(ptxDNt lines) (Supplementary Fig. 3). Transgenic and control seed-
lings were transferred to plastic bags containing a sterilized mixture
of sand and vermiculite amended with either phosphite or ortho-
phosphate as the phosphorus source. Both WT and transgenic plants
showed considerably poorer growth in the unfertilized substrate com-
pared with plants fertilized with orthophosphate (Fig. 2a). Upon sup-
plementation of the growth substrate with phosphite, the development
of WT plants was completely arrested and the plants died a few days
after transplantation, whereas ptxDNt plants had vigorous growth,
normal shoot and root pheno­types, and performed quantitatively as
well as WT and ptxDNt plants fertilized with orthophosphate (Fig. 2a
and Supplementary Fig. 4). As orthophosphate is essential for CO2
fixation in the chloroplast, and plants suffering from orthophosphate
starvation have reduced levels of photosynthesis28, we measured the
rate of photosynthesis in transgenic and control plants under dif-
ferent phosphorus treatments. When fertilized with either ortho-
phosphate or phosphite, ptxDNt plants had rates of photosynthesis
similar to those observed for control plants grown in orthophos-
phate (Supplementary Fig. 4), suggesting that expression of ptxD or
phosphite fertilization has no measurable effect on photosynthesis
890 VOLUME 30  NUMBER 9  SEPTEMBER 2012  nature biotechnology
a Pi Phi b Phi
ptxDAt-
WT ptxDAt-3 WT ptxDAt-3 7 5 3 WT
ptxDAt-7 ptxDAt-5 ptxDAt-7 ptxDAt-5
T2
c No P Pi Phi
WT ptxDAt-3 ptxDAt-5 WT ptxDAt-3 ptxDAt-5 WT ptxDAt-3 ptxDAt-5
activity in these plants. Although phosphite is not toxic to animals
or humans according to the US Food and Drug Administration, it
was important to determine whether phosphite was still present in
ptxDNt plants. Phosphite content in leaves, flowers and fruits of
ptxDNt plants fertilized with phosphite was below detection levels
(< 0.1 nmoles g−1) and only orthophosphate was present, suggesting
that most, if not all, phosphite had been oxidized to orthophosphate
in adult tobacco plants (Supplementary Fig. 5). Phosphite accumu-
lation and its effect on photosynthesis and development in control
plants fertilized with phosphite could not be evaluated because these
plants died soon after transplantation.
A crucial step to validate the potential of our strategy was to deter-
mine whether the system works in soils in which microorganisms are
present. Therefore, we performed greenhouse experiments using a non-
sterile, low orthophosphate, alkaline soil obtained directly from a field
of the central agricultural region of Mexico (Guanajuato State), that
contained cations, organic matter and native soil microflora (Online
Methods). In these experiments, unfertilized and orthophosphate-
fertilized ptxDNt and WT plants had similar phenotypes (Fig. 2b).
When fertilized with phosphite, germination of WT seeds was delayed
and seedling growth was compromised, causing death 8–15 d after
germination. In contrast, ptxDNt plants germinated normally and
seedlings showed vigorous growth (Fig. 2b). In the different phosphite
fertilization treatments, capsule, seed and total biomass of ptxDNt
plants was 15–25% higher than that produced by plants fertilized
with the same amount of orthophosphate (Fig. 2c). Moreover, total
biomass and seed production of ptxDNt plants fertilized with
30 mg kg−1 of phosphite was similar to that produced by plants fer-
tilized with 60 mg kg−1 of orthophosphate. ptxDNt plants fertilized
with 60 mg kg−1 of phosphite produced 16% and 20% higher total
­biomass and seed production, respectively, than plants fertilized with
the same amount of orthophosphate (Fig. 2c). Similar results were
obtained when WT and ptxDNt plants were grown in a low ortho-
phosphate, nonsterile acidic soil, obtained from a field in the north-
west agricultural region of Mexico (Sinaloa State) (Online Methods
and Supplementary Fig. 6). Together, these results suggest that the
native microbial activity in these agricultural soils is insufficient
either to convert phosphite into sufficient orthophosphate to support
the growth of WT plants or to eliminate the plant growth inhibitory
activity of the supplied phosphite.
In addition to not being metabolized by WT plants, phosphite also
inhibits the growth of plants and weeds by interfering with the ­signaling
pathways that induce the rescue system activated in orthophosphate-
starved plants22,23. Therefore, cultivation of transgenic plants express-
ing the ptxD gene combined with phosphite as a ­phosphorus fertilizer
 letters

Figure 2  Effect of phosphite fertilization on a No P Phosphate Phosphite

WT and transgenic tobacco plants in a low- WT ptxDNt-36 WT ptxDNt-36
phosphate nonsterile soil. (a) 65-d-old WT and
ptxDNt-36 plants fertilized with orthophosphate

WT
or phosphite in a sterile sand and vermiculite
mixture. (b) 4-month-old ptxDNt-80 and WT

ptxDNt-36
plants grown under different orthophosphate
(left) or phosphite (right) fertilization regimes
in the nonsterile alkaline agricultural soil 2 20 40 80 20 40 80 20 40 80 20 40 80 mg kg
-1

(Online Methods). (c) Total biomass (leaves

plus stem biomass), capsule and seed biomass b c 80
70
*
produced by 4-month-old ptxDNt-80 (black *

Total biomass
60

(g per plant)
bars) and WT (white bars) plants grown under 50 *
40
different orthophosphate (Pi) or phosphite (Phi) 30
fertilization regimes in the nonsterile alkaline 20
agricultural soil 2. Treatment with no addition 10
0

WT
of P fertilizer (No P) was used as a control. mg kg–1

0
10
30
60
10
30
60
Data represent the average of two independent
Pi Phi
experiments (n = 10 plants/treatment/line). *,
P < 0.005, compared to corresponding control. 30 *
Error bars, mean ± s.e.m. 25 *

(g per plant)
20

Capsules
15
could serve as a weed control system in soils 10
© 2012 Nature America, Inc. All rights reserved.

with low orthophosphate availability. To assess 5

this possibility, we first tested whether the grass 0
weed false brome (Brachypodium distachyon) mg kg–1

0
10
30
60
10
30
60
and the broad-leaved weed tall morning-glory Pi Phi
ptxDNt-80

20
(Ipomoea purpurea) were able to use phosphite *
as a phosphorus source. We found that neither 15 *

(g per plant)
of these two weeds is able to sustain growth

Seed
10
*
in soil fertilized with phosphite (Fig. 3a and 5
Supplementary Fig. 7). Then, we carried out
0
greenhouse growth competition experiments
mg kg–1

0
10
30
60
10
30
60
between ptxDNt plants and B. distachyon using 0 10 30 60 10 30 60
–1 Pi Phi
a nonsterile alkaline soil obtained directly from mg kg

a field of the northeast agricultural region of

Mexico (Coahuila State), fertilized with either phosphite or orthophos-
phate. Both unfertilized B. distachyon and tobacco plants grew poorly in
comparison to the same plants fertilized with orthophosphate (Fig. 3b).
Supplementation with orthophosphate resulted in weeds growing
significantly faster (P < 0.005) than tobacco plants (Fig. 3b). In con-
npg
the efficacy of this technology. A possible solution to this problem
would be to apply phosphite as a foliar fertilizer rather than incorpo-
rating it into the soil. Foliar application of phosphite was shown to be
effective in providing phosphorus to support the growth of ptxDNt
plants and to inhibit the growth of WT plants (Supplementary Fig. 11).

trast, fertilization with phosphite resulted in limited growth of weed
plants and vigorous growth of ptxDNt plants (Fig. 3b). Upon addition of
120 mg kg−1 of phosphite to the growth substrate, the biomass of ptxDNt
plants increased 1,000%, whereas that of the grass weed decreased 50%
compared with supplementation with orthophosphate fertilization
(Fig. 3c). Similar results were obtained in competition experiments
between transgenic tobacco and three other agronomically impor-
tant weeds, namely tall morning-glory, Alexander grass (Brachiaria
plantaginea) and smooth pigweed (Amaranthus hybridus)
(Supplementary Figs. 8–10), for which resistance to herbicides has
already been reported2,5. In competition experiments using the alkaline
agricultural soil from Coahuila State, weeds were not killed by phos-
phite fertilization, which is in line with the proposed strategies of an
agro-ecological agriculture, in which the use of weed control systems
aims to allow cultivated plants to attain optimal production without
killing weeds.
Evaluation of transgenic tobacco plants in agricultural soils showed
that the presence of native micro-flora in the soil does not interfere
with the effectiveness of phosphite as a weed control and phosphorus-
fertilization system. However, it is possible that bacteria that are able to
metabolize reduced forms of phosphorus could be enriched in the soil
through repeated use of phosphite as a fertilizer, ­potentially ­reducing
The design of foliar fertilization schemes using phosphite could pre-
vent or delay the enrichment of soil bacteria capable of metaboliz-
ing phosphite or reduce the potential impact of such bacteria on the
efficacy of this technology.
The transgenic system reported here exploits the chemical and
biological properties of phosphite to increase the capacity of cul-
tivated plants to compete with weeds and soil microorganisms for
limiting resources such as nutrients and water, potentially providing
significant advantages over current orthophosphate fertilizer systems.
Although the system remains to be tested under field conditions, our
results suggest that in soils with low orthophosphate availability, the
use of PTXD transgenic plants in conjunction with phosphite ferti-
lization might reduce production costs and energy consumption by:
(i) reducing the amount of phosphorus fertilizer needed to achieve
optimal plant productivity, (ii) achieving fertilization and weed con-
trol with a single treatment, and (iii) reducing or eliminating the cost
of additional herbicides. The results obtained by incorporating phos-
phite into the soil, or by foliar application, suggest that phosphite
could be used as both a pre- and post-emergence weed control agent.
A potential additional benefit of the phosphite-based system is that
in contrast to resistance to herbicides that can be achieved by differ-
ent mechanisms, such as those preventing uptake, sequestering the

nature biotechnology  VOLUME 30  NUMBER 9  SEPTEMBER 2012 891

 letters

a No P Phosphate Phosphite b No P Phosphate Phosphite

Figure 3  Effectiveness of the PTXD/phosphite system for weed control in a

nonsterile soil. (a,b) Comparative growth of the grass weed Brachypodium
distachyon alone (a) or in competition with ptxDNt-80 transgenic tobacco
plants (b) in the nonsterile alkaline soil 2 (Online Methods), respectively,
© 2012 Nature America, Inc. All rights reserved.

treated with no addition of a P source (No P) as a control or amended with

120 mg kg−1 of orthophosphate (phosphate) or phosphite 40 d after c 2.5
germination. (c) Quantification of biomass production of B. distachyon *
(white bars) and transgenic tobacco plants (black bars) of the plants shown 2.0

Biomass (g per plant)

in b under orthophosphate (phosphate, Pi) or phosphite (Phi) 80 or
120 mg kg−1 regimens. The data represent the average and standard error 1.5
of two independent experiments with three replicates per treatment.
*, P < 0.005, compared to corresponding control. Error bars, mean ± s.e.m. 1.0 *
0.5 *
herbicide in specific subcellular compartments or making the target *
enzyme resistant to the herbicide5, the only effective mechanisms by 0
0 80 120 80 120
–1
mg kg
which weeds could escape phosphite control would be the acquisition Pi Phi
of the capacity to metabolize phosphite.
It will be crucial to assess any potential hazards due to genetic mod- orthophosphate fertilization, and of the potential negative or posi-
ification. Phosphite is classified as an organic fertilizer and is already tive environmental impacts of this technology. Such data would also
extensively used in agriculture in several countries, and in 1997 it inform the potential for the evolution of phosphite-metabolizing
was approved by the US Environmental Protection Agency for use as weeds and microorganisms, which could interfere with the efficacy
a fungicide in many food and non-food crops because it is innocu- of large-scale phosphite fertilizer application. In summary, the pro-
ous to humans and animals. Moreover, the products of the reaction, duction of transgenic crop plants able to utilize phosphite, together
npg

orthophosphate and NADH, are also innocuous and present in all
living cells. Additionally, because phosphite is not naturally present
in soils, the potential escape of PTXD-encoding transgenes into wild
species should have no effect on genetic diversity or survival outside
agricultural systems. Another potential advantage of the phosphite/
PTXD fertilization scheme is that its use could decrease the environ-
mental impact of current orthophosphate-based fertilization systems
on aquatic ecosystems. In contrast to orthophosphate runoff that
even at micromolar concentrations promotes massive algal growth
that leads to oxygen depletion in rivers, lakes and oceans, causing
the death of other organisms such as fish10, phosphite is not metabo-
lized by algae29 and therefore cannot promote toxic algae blooms.
Moreover, at the micromolar range, in which orthophosphate is
present in contaminated rivers or oceans, phosphite has little or no
toxicity to algae and other aquatic organisms, making a negative effect
on aquatic biodiversity unlikely.
Although under greenhouse conditions this technology was effec-
tive in reducing fertilizer use and in reducing the growth of the tested
weeds, field experiments in multiple testing sites with a variety of
soil chemistries will be required to validate its commercial viability.
These field studies should include a careful evaluation of the amount
of leaching of phosphite into runoff in comparison with traditional
with the application of phosphite as a source of phosphorus, might
potentially become an effective phosphorus-fertilization and weed
control scheme in the almost 67% of cultivated land with low ortho-
phosphate availability.
Methods
Methods and any associated references are available in the online
version of the paper.
Accession codes. Sequence data from this article can be found in the
Arabidopsis Information Resource or GenBank/EMBL database under
the following accession numbers: ACT2 (At3g18780), ACTINNT
(GQ339768), PTXD (AF061070).
Note: Supplementary information is available in the online version of the paper.
Acknowledgments
We thank O. Martínez for advice in statistical analysis; M.A. Leyva, A. Vera and
J.L. Cabrera for technical support; K. Wrobel and K. Wrobel for the phosphite
detection method; V. Limones for assistance in Tobacco transformation and
C. Castro and E. Alva in Arabidopsis greenhouse experiments. We are grateful
to A. Estrada, J.D. Frier and Universidad Autónoma Chapingo for providing
Brachypodium distachyon, Amaranthus hybridus and Ipomoea purpurea and
Brachiaria plantaginea seeds, respectively; and C. Morales for assistance in

892 VOLUME 30  NUMBER 9  SEPTEMBER 2012  nature biotechnology


photosynthesis measurements. We thank S. Gillmore and V. Albert for critical
reading this manuscript. This work was supported in part by grant from the
Howard Hughes Medical Institute (grant 55005946) to L.H.-E. D.L.L.-A. is
indebted to CONACyT, México, for a PhD fellowship (no. 207308). pWM302
was a gift from W.W. Metcalf.
AUTHOR CONTRIBUTIONS
D.L.L.-A. and L.H.-E. designed experiments, analyzed data and wrote the paper.
D.L.L.-A. performed experiments.
COMPETING FINANCIAL INTERESTS
The authors declare no competing financial interests.
Published online at http://www.nature.com/doifinder/10.1038/nbt.2346. starvation response in Brassica nigra seedlings. Plant Physiol. 110, 105–110
Reprints and permissions information is available online at http://www.nature.com/
reprints/index.html.
1. Tilman, D. et al. Agricultural sustainability and intensive production practices.
Nature 418, 671–677 (2002).
2. Gianessi, L.P. & Reigner, N.P. The value of herbicides in US crop production. Weed
Technol. 21, 559–566 (2007).
3. Dawson, C.J. & Hilton, J. Fertiliser availability in a resource-limited world: production
and recycling of nitrogen and phosphorus. Food Policy 36, S14–S22 (2011).
4. Cordell, D., Drangert, J.-O. & White, S. The story of phosphorus: global food security
© 2012 Nature America, Inc. All rights reserved.
and food for thought. Glob. Environ. Change 19, 292–305 (2009).
5. Powles, S.B. & Yu, Q. Evolution in action: plants resistant to herbicides. Annu.
Rev. Plant Biol. 61, 317–347 (2010).
6. Gilbert, N. The disappearing nutrient. Nature 461, 716–718 (2009).
7. Cakmak, I. Plant nutrition research: priorities to meet human needs for food in
sutainable ways. Plant Soil 247, 3–24 (2002).
8. Hinsinger, P. Bioavailability of soil inorganic P in the rhizosphere as affected by
root-induced chemical changes: a review. Plant Soil 237, 173–195 (2001).
9. Syers, J.K., Johnston, A.E. & Curtis, D. Efficiency of soil and fertilizer phosphorus
use: reconciling changing concepts of soil phosphorus behavior with agronomic
information. Fertilizer and Plant Nutrition Bulletin 18 (Food and Agriculture
Organization of the United Nations, 2008).
10. Carpenter, S.R. Phosphorus control is critical to mitigating eutrophication.
Proc. Natl. Acad. Sci. USA 105, 11039–11040 (2008).
11. Downing, J.A., Watson, S.B. & McCauley, E. Predicting cyanobacterial dominance in
lakes. Rapid communication. Can. J. Fish. Aquat. Sci. 58, 1905–1908 (2001).
12. Abelson, P.H. A potential phosphate crisis. Science 283, 2015 (1999).
npg
nature biotechnology  VOLUME 30  NUMBER 9  SEPTEMBER 2012 893
letters
13. Ruthbaum, H.P. & Baille, W.J.H. The use of red phosphorus as a fertilizer. Part 4.
Phosphite and phosphate retention in soil. N. Z. J. Sci. 7, 446–451 (1964).
14. Morton, S. et al. Analysis of reduced phosphorus in samples of environmental
interest. Environ. Sci. Technol. 39, 4369–4376 (2005).
15. Pasek, M. Rethinking early earth phosphorus geochemistry. Proc. Natl. Acad. Sci.
USA 105, 853–858 (2008).
16. White, A.K. & Metcalf, W.W. Microbial metabolism of reduced phosphorus
compounds. Annu. Rev. Microbiol. 61, 379–400 (2007).
17. Schroetter, S., Angeles-Wedler, D., Kreuzig, R. & Schnug, E. Effects of phosphite
on phosphorus supply and growth of corn (Zea mays). Landbauforschung Völkenrode
56, 87–99 (2006).
18. Ouimette, D.G. & Coffey, M.D. Phosphonate levels in avocado (Persea amercana)
seedlings and soil following treatment with Fosetyl-Al or potassium phosphonate.
Plant Dis. 73, 212–215 (1989).
19. Carswell, C. et al. The fungicide phosphonate disrupts the phosphate-
(1996).
20. Carswell, M.C., Grant, B.R. & Plaxton, W.C. Disruption of the phosphate-starvation
response of oilseed rape suspension cells by the fungicide Phosphonate. Planta
203, 67–74 (1997).
21. Förster, H. et al. Effect of phosphite on tomato and pepper plants and on
susceptibility of pepper to Phytophthora root and crown rot in hydroponic culture.
Plant Dis. 82, 1165–1170 (1998).
22. Ticconi, C.A., Delatorre, C.A. & Abel, S. Attenuation of phosphate starvation
responses by phosphite in Arabidopsis. Plant Physiol. 127, 963–972 (2001).
23. Varadarajan, D.K. et al. Phosphite, an analogue of phosphate, suppresses the
coordinated expression of genes under phosphate starvation. Plant Physiol. 129,
1232–1240 (2002).
24. McDonald, A.E., Grant, B.R. & Plaxton, W.C. Phosphite (phosphorus acid): its
relevance in the environment and agriculture and influence on plant phosphate
starvation response. J. Plant Nutr. 24, 1505–1519 (2001).
25. Saindrenan, P., Barchietto, T. & Gilbert, B. Modification of the phosphite induced
resistance response in leaves of cowpea infected with Phytophthora cryptogea by
α-aminooxyacetate. Plant Sci. 58, 245–252 (1988).
26. Costas, A.M.G., White, A.K. & Metcalf, W.W. Purification and characterization of a
novel phosphorus-oxidizing enzyme from Pseudomonas stutzeri WM88. J. Biol.
Chem. 276, 17429–17436 (2001).
27. Metcalf, W.W. & Wolfe, R.S. Molecular genetic analysis of phosphite and
hypophosphite oxidation by Pseudomonas stutzeri WM88. J. Bacteriol. 180,
5547–5558 (1998).
28. Rao, I.M., Arulanantham, A.R. & Terry, N. Leaf phosphate status, photosynthesis
and carbon partitioning in sugar beet. II. Diurnal changes in sugar phosphates,
adenylates, and nicotinamide nucleotides. Plant Physiol. 90, 820–826 (1989).
29. Lee, T.-M. The effects of phosphite on phosphate starvation responses of Ulva
lactuca (Ulvales, Chlorophyta). J. Phycol. 41, 975–982 (2005).
 ONLINE METHODS
Design of 35S:ptxD. To obtain transgenic PTXD plants, the complete coding
sequence of ptxD gene from P. stutzeri WM88 was amplified from pWM302
(kind gift of W.W. Metcalf 8), and placed under the control of CaMV35S pro-
moter in vector pB7WG2D (Gateway Technology) using the following primers
and standard conditions:
PTXDFWB1 5′- GGGGACAAGTTTGTACAAAAAAGCAGGCTAAATGC­
TGCCGAAACTCGTTATAACTC-3′
PTXDRVB2 5′- GGGGACCACTTTGTACAAGAAAGCTGGGTATCAAC­
ATGCGGCAGGCTC-3′
The ptxD amplification fragment was subjected to two sequential site-
specific recombination reactions, using pDONR221 donor and pB7WG2D
destination vectors. Vectors were subjected to restriction analysis and DNA
sequencing to confirm the presence of the expected sequences.
Generation and selection of transgenic plants. pB7WG2D:ptxD was intro-
duced into Agrobacterium tumefaciens strain GV2260 and used to produce
ptxDAt lines following a modified floral dip transformation protocol30.
To select transgenic plants, seeds were sown on growth medium (MS salts,
5 g L−1 sucrose, 10 g L−1 agar, pH 5.7) supplemented with 20 mg L−1 phos-
phynotricin. Thirty independent Arabidopsis lines were transferred to
soil (perlite/vermiculite/Canadian peat moss; 1:1:1) and self-pollinated. T2
lines with a 3:1 segregation (χ2 test, P < 0.05) for phosphinotricin resistance
© 2012 Nature America, Inc. All rights reserved.
were selected and homozygous T3 seeds stocks obtained. Fifteen transgenic
lines were assayed for their capacity to utilize phosphite as a unique phos­
phorus source; all were found to have this capacity. Presence and expression
of 35SøPTXD construct were analyzed in seven of these lines by Southern
blot hybridizations31 and qRT-PCR analyses32, respectively. Two homozygous
lines with high- (ptxDAt-3 and 4) and two with low-expression levels
(ptxDAt-5 and 7) were selected for further characterization.
To transform Nicotiana tabacum L. cv Xanthi, the leaf-disk method33 was
used. After co-cultivation, explants were transferred to selection medium
(MS salts, 30 g L−1 sucrose, 1 g L−1 N6-benzyladenine, 2.5 g L−1 gelrite, pH 5.7)
supplemented with 5 mg L−1 phosphynotricin and subcultured in fresh medium
every 2–3 weeks. Regenerated shoots were cultured on selective medium
supplemented with 10 mg L−1 of indolacetic acid to induce root formation.
Growth of eight lines randomly selected lines in phosphite-containing media
confirmed that all were capable of using phosphite as a phosphorus source.
Presence and expression of the 35SøPTXD construct was confirmed in 80 and
7 randomly selected lines by genomic PCR and qRT-PCR32, respectively.
PCR and Southern blot analysis. For genomic PCR analysis, 200 ng of total
npg
genomic DNA were used to amplify the complete pxtD coding region using
the following primers and standard conditions:
PTXDFW 5′- ATGCTGCCGAAACTCGTTATAACTC -3′
PTXDRV 5′- TCAACATGCGGCAGGCTC -3′
For Southern blot hybridization analysis31, 15 µg of total DNA was digested
with EcoRI or EcoRV restriction enzyme (Invitrogen). A probe corresponding
to the first 400 bp of ptxD gene generated by PCR using PTXDRT primers was
used for hybridization experiments.
PTXDRTFW 5′- ATGCTGCCGAAACTCGTTATAACTC -3′
PTXDRTRV 5′- CTGCAAGCGATCAGCCATG -3′
Real time-PCR. Total RNA was isolated and Real-time qPCR determination
of ptxD transcripts (PTXDRT primers) was performed in an ABI PRISM
7500 thermocycler (Applied Biosystems) using the Arabidopsis Actin 2 (ACT2
primers) and tobacco ActinNt (ACTINNT primers) transcript levels for
normalization. Expression levels were obtained from at least three replicates.
ACT2FW 5′- ATATGGCATCATACCTTCTACAACGAGCTTCGTG-3′
ACT2RV 5′- ATATGGCATCATACCTTCTACAACGAGCTTCGTG-3′
ACTINNTFW5 5′- ATATGGCATCATACCTTCTACAACGAGCTTCGTG-´3
ACTINNTRV 5′- ATCCAACACAATACCAGTTGTACGACCACTAG-´3
Greenhouse experiments. For Arabidopsis greenhouse experiments, pots
were filled in with 0.3 kg of a sterile mixture of sand and vermiculite (1:1)
and mechanically mixed with either phosphate (KH2PO4) or phosphite
nature biotechnology
(NaH2PO3.5H2O) at 10, 20 and 40 mg kg−1. For tobacco experiments, 3 kg of
sterile sand and vermiculite mixture or a nonsterile agricultural soil (acidic
soil (from the northwest agricultural region of Mexico, Mocorito, Sinaloa):
pH 5.1, organic matter 1.4%, phosphorus (Bray) 5 mg kg−1, N 5 mg kg−1,
K 101.65 mg kg−1, Ca 3,607.2 mg kg−1, Mg 498.252 mg kg−1, Fe 7 mg kg−1,
Mn 26 mg kg−1; alkaline soil 1 (from the northeast agricultural region of
Mexico, Arteaga, Coahuila): pH 8.2, organic matter 0.39%, phosphorus (Bray)
3.62 mg kg−1, N 5.85 mg kg−1, K 64.20 mg kg−1, Ca 9,437.5 mg kg−1, Mg 404.75 mg kg−1,
Fe 3.32 mg kg−1, Mn 3.60 mg kg−1; alkaline soil 2 (from the central agricultural
region of Mexico, Celaya, Guanajuato): pH 8.7, organic matter 1.22%, phos-
phorus (Bray) 4.26 mg kg−1, N 17.56 mg kg−1, K 38.7 mg kg−1, Ca 14,000 mg
kg−1, Mg 712.5 mg kg−1, Fe 2.24 mg kg−1, Mn 1.66 mg kg−1) were weighed in
black plastic bags amended with different amounts of phosphorus (0, 10, 20,
30, 40 60 or 80 mg kg−1) as Pi (KH2PO4) or phosphite (KH2PO3) according
to each experiment. One plant per pot and 8–10 plants per line per treatment
were included. Pots were arranged following a completely random design in
the greenhouse. Arabidopsis aerial parts were cut off at the soil surface 36 d
after germination (dag), whereas tobacco aerial parts from alkaline and acidic
soil were harvested 4 months and 70 dag, respectively, and then dried in a
vacuum oven at 70–72 °C for biomass quantification. In both cases, experi-
ments with alkaline and acidic soils, capsules and seeds were collected by plant
4 months after germination. Photosynthesis rate was determined using a
portable Li-6200 photosynthesis system (Li-Cor, Lincoln, NE, USA) on fully
expanded, young leaves. Leaf area was calculated using the software ImageJ34.
To test the ability of weeds to use phosphite as a phosphorus source,
5 seeds of I. purpurea or B. distachyon were sown in 2 kg of nonsterile or sterile
sand and vermiculite mixture or 5 kg of nonsterile alkaline soil 2 amended
with phosphate or phosphite as phosphorus source. Weeds grown in sand and
vermiculite mixture were harvested for biomass quantification 20 dag and
that grown in alkaline soil 2 was harvested 37 dag. For growth competition
experiments, different proportions of seeds from ptxDNt-80 and the follow-
ing weeds were used (transgenic:weed): Ipomoea purpurea (13:30), Brachiaria
plantaginea (13:60), Amaranthus hybridus (5:15), Brachypodium distachyon
(50:50). Seeds were sown in a tray containing a nonsterile mixture of sand and
vermiculite (2 kg for experiments with Amaranthus hybridus and 6 kg for the
rest) or the alkaline agricultural soil (5 kg) as indicated for each experiment.
The source of phosphorus was provided trough either irrigation with a solution
(1 mM) or amendment in the soil with 60, 80 or 120 mg kg−1 of phosphate or
phosphite, as indicated in each experiment. Plants were harvested for biomass
quantification at 54 dag for Brachiaria and Brachypodium and at 40 dag for
Ipomoea and A. hybridus experiments using sand and vermiculite mixture. For
experiments with alkaline soil 2 Brachiaria and Brachypodium was harvested
at 57 or 70 dag, respectively, and for experiments with alkaline soil 1 both
was harvested at 50 dag. For foliar fertilization experiments, tobacco plants
growing in the alkaline soil 2 were sprayed with a 100 mM Pi (KH 2PO4) or
phosphite (KH2PO3) solution with Tween 20 0.1% (Sigma) every 15 d after
20 d old; deionized water was used as a control treatment. All parameters
were subjected to statistical analysis using ANOVA and Tukey tests (P < 0.05).
All plants were photographed when indicated for each experiment and photo­
graphs were adjusted in brightness and contrast when needed.
Phosphite and orthophosphate determination. Tissue from tobacco plants
was collected and lyophilized. Samples (40–50 mg) were extracted with 0.5 ml
of 10 mM EDTA pH 8.0, during 30 min in ultrasonic bath. After centrifuga-
tion (10,000g, 10 min), the supernatant was collected, cleaned up (Supelclean
LC-18 SPE tubes 3 ml, Supelco) and filtered (IC Acrodisc filter, 0.2 µm,
Sigma-Aldrich). Processed samples were analyzed in an Agilent series 1050
liquid chromatographic system equipped with a quaternary pump, a col-
umn oven and ChemStation (Agilent Technologies, Palo Alto, CA, USA).
The chromatographic column was Luna SAX18 (250 × 4.6 mm, 5 µm) from
Phenomenex. An ICP-MS platform (model 7500ce Agilent Technologies,
Tokyo, Japan) was used with a MiraMist Teflon nebulizer. The Peltier-cooled
chamber was operated at 2 °C. Tuning procedure was performed daily using
diluted Agilent solution (Li, Y, Tl, Ce, 1µg L−1 each). The HLPC-ICP-MC
instrument operating conditions were done using a 10 mM potassium phthal­
ate pH 4.0 mobile phase, isocratic elution, room temperature, 1.2 mL min–1
doi:10.1038/nbt.2346
 flow and 50 µL injection volume. The ICP-MS detection procedure was
performed using 1,500 W forward power, 0.9 l min−1 nebulizer gas flow,
0.1 l min−1 make-up gas, 100 ms dwell time, 3.5 mL min−1 He in the
collision/reaction cell, platinum sample and skimmer cones, 8-mm sample
depth, 31P channel monitored and time-resolved analysis acquisition mode.
To control polyatomic interferences from 15N 16O +, 14N 16O 1H + and
12C1H 16O+ ions potentially occurring at m/z = 31, the octopole reaction/
3
collision cell was used in kinetic energy discrimination mode. The gas flow
rate was selected to provide the highest possible signal to noise ratio, as
described elsewhere35. Commercial standards of two phosphorus species
were used for external calibration (between 0.2–2.5 nmoles of phosphate
and phosphite on column). The recovery of procedure, evaluated by standard
addition experiments, was 94.2% and 98.6% for Pi and phosphite, respec-
tively. Total phosphorus content was determined using vanadate-molybdate
colorimetric method36.
© 2012 Nature America, Inc. All rights reserved.
npg
doi:10.1038/nbt.2346
30. Martinez-Trujillo, M. et al. Improving transformation efficiency of Arabidopsis
thaliana by modifying the floral dip method. Plant Mol. Biol. Rep. 22, 63–70
(2004).
31. Sambrook, J. & Russell, D.W. Molecular Cloning: A Laboratory Manual (Cold Spring
Harbor Laboratory, 2001).
32. Livak, K.J. & Schmittgen, T.D. Analysis of relative gene expression data using real-
time quantitative PCR and the 2[-Delta Delta C (T)] method. Methods 25, 402–408
(2001).
33. Horsch, R.B. et al. A simple and general method for transferring genes into plants.
Science 227, 1229–1231 (1985).
34. Abramoff, M.D., Magelhaes, P.J. & Ram, S.J. Image processing with ImageJ.
Biophotonics Int. 11, 36–42 (2004).
35. Wrobel, K. et al. Phosphorus and osmium as elemental tags for the determination
of global DNA methylation- a novel application of high performance liquid
chromatography inductively coupled plasma mass spectrometry in epigenetic studies.
J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 878, 609–614 (2010).
36. Hesse, P.R. Soil phosphorus: its measurements and its uptake by plants. Aust. J.
Soil Res. 35, 227–239 (1971).
nature biotechnology