Philippine Journal of Science

149 (3-a): 993-1003, October 2020

ISSN 0031 - 7683
Date Received: 18 May 2020

Assessment of the Genetic Diversity of Philippine

Arabica Coffee (Coffea arabica L.) Using SSR Markers

Miriam D. Baltazar1,2* and Jermaine Marie Ann O. Fabella2

1Department
of Biological Sciences
2National Coffee Research, Development and Extension Center
Cavite State University, Indang, Cavite 4122 Philippines

Arabica coffee (Coffea arabica L.) plays a significant contribution to the Philippine coffee
industry. Many important genes are continuously lost due to an increase in population,
urbanization, and the promotion of registered and popular varieties in the country. This study
was conducted to assess the genetic diversity of 27 Philippine C. arabica accessions currently
maintained at the Cavite State University – National Coffee Research, Development and
Extension Center (CvSU-NCRDEC) field genebank using 19 simple sequence repeat (SSR)
markers. Around 80% of the markers used showed polymorphism. A total of 56 alleles were
detected, 47 of which were polymorphic. The average number of alleles per locus (3.7) and
the polymorphism information content (PIC) (~ 0.40) found in this study were higher than
those reported in the literature. Duplicate accessions were identified despite their striking
morphological differences, and differentiation of synonymous accessions was also noted. The
average genetic similarity was 0.83 and ranged from 0.64–1.0. Overall, the genetic diversity
of Philippine C. arabica collection was low. Nonetheless, the higher number of alleles and PIC
obtained provide more information in the selection of materials that can be used as parents
in hybridization works. Cluster analysis showed three major clusters: Cluster I consisted of
most of the accessions from Benguet State University (BSU), while Cluster II consisted of all
accessions from the Bureau of Plant Industry (BPI) except Yellow Bourbon. MCA and Yellow
Bourbon banded in Cluster III. The cluster analysis offers valuable information in the selection
of parents for the development of vigorous F1 hybrids. Further, the results obtained in this
study can be utilized in developing strategies to widen the low genetic variability of C. arabica
through proper management of the country’s coffee genetic resources, development of effective
breeding and selection programs, and varietal registration and identification.

Keywords: Arabica coffee, coffee, Coffea arabica, genetic diversity, molecular markers, SSR markers

INTRODUCTION Woehl et al. 2020). The worldwide demand for coffee is

Coffee is a highly traded commodity that provides
livelihood for around 12.5 million households per annum
around the world (Browning 2018). The coffee industry
is estimated to generate some USD 74 bn (Pruvot-
*Corresponding Author: mdbaltazar@cvsu.edu.ph
continuously increasing. The Philippines consumes 3.0
M bags of coffee every year, and there has been a steady
increase in per capita coffee consumption from 0.7 kg per
person in 2008 to 1.5 kg and 1.7 kg in 2014 and 2017,
respectively. Net imports are 2.8 M bags of coffee or 93%
of total consumption (ICO 2017). Commercial production

993
Philippine Journal of Science
Vol. 149 No. 3-a, October 2020
is mainly attributed to Coffea arabica L. (Arabica coffee)
and C. canephora (known as Conillon when produced in
Brazil and Robusta in other parts of the world). However,
other less popular ones are also cultivated: C. liberica var.
liberica (Liberica coffee) and C. liberica var. dewevrei,
also known as Excelsa (IPNI 2020).
The center of origin of C. arabica is the South Western
forests of Ethiopia and the Boma Plateau of South Sudan.
From Ethiopia, seeds were introduced in Yemen in the
15th century. From Yemen, coffee was introduced to i)
Bourbon Island (today French Reunion Island), giving the
Bourbon-based varieties; and ii) to India and from India
to Indonesia, giving the Typica-based varieties in the late
17th and early 18th centuries (Pruvot-Woehl et al. 2020).
Instrumental to the introduction of the first coffee tree to
the Philippines was a Spanish Franciscan monk in 1740
in Lipa, Batangas, from which it eventually spread to the
whole province and nearby areas and the whole country
(Juan and Francisco 2007). This school of thought that is
believed by many must be treated with caution due to the
paucity of research and lack of refereed scholarly works
(Castro 2003).
Coffee belongs to the genus Coffea of Rubiaceae family.
It consists of 124 species (Davis 2011) with chromosome
number 2n = 22 except for C. arabica (2n = 4x = 44).
C. arabica is the only self-fertile among the other
commercially cultivated species (Lashermes et al. 1999). C.
arabica is prized over C. canephora and C. liberica due to
its superior quality. In 2018, it accounted for ~ 23% of the
Philippines’ total production (www.psa.gov.ph). Despite its
high cup quality, production is limited in high elevations.
They are mostly planted in the highlands of Sultan Kudarat,
Davao del Sur, Sulu, South Cotabato, Iloilo, Benguet, and
Mountain Province (www.psa.gov.ph).
As the wild coffee population is generally under threat due
to its natural habitat disturbance mainly by deforestation
and land-use change (Poncet et al. 2004; Teressa et al.
2010), the effect is also evident in the Philippines. There
was a continuous decline in the area of production of
C. arabica since 2001 with an average reduction of ~
270 ha/yr (www.psa.gov.ph). This situation, along with
continuous urbanization, could lead to the genetic erosion
of C. arabica in the country. Because of its high market
potential, the use of the National Seed Industry Council
(NSIC)-registered C. arabica varieties is promoted. This
– together with encroachment by agricultural activities,
population pressures, and economic hardships – also
contribute to this threat. The CvSU identified this gap of
the coffee industry, limiting coffee genetic diversity that
will greatly impact the sustainability of coffee production.
Thus, a formal exploration and collection of coffee genetic
resources throughout the country were initiated in 2013.
The collection is conserved in a field gene bank inside
994
Baltazar and Fabella: Genetic Diversity of
Philippine Arabica Coffee
the main campus.
Assessment of the genetic diversity of coffee is important.
This can be done by using morphological characters;
however, this could lead to inconsistent data as they
are highly affected by the environment. Morphological
characterization is time-consuming and requires
expertise. Many of these morphological keys may also
be effective only for a particular life stage; for example,
many distinct characteristics can be observed only when
the coffee trees are already bearing flowers and fruits.
This necessitates a more effective and reliable tool in
germplasm characterization and identification.
The use of molecular markers is one efficient way to
genetically assess the collection. This method is more precise
and reliable. Many DNA-based markers were widely used
such as restriction fragment length polymorphism, random
amplified polymorphic DNA, amplified fragment length
polymorphism, SSR or microsatellites, etc. Molecular
markers are very useful especially in identification as they
directly represent the genotype and are not affected by the
environment. They are also diverse and highly distributed
in the genome. Numerous studies on coffee demonstrated
the success of the use of molecular markers for species
and varietal identification as well as analysis of genetic
diversity of collections in various countries (Anthony et
al. 2002; Aga et al. 2003; Ruas et al. 2003; Cubry et al.
2008; Teressa et al. 2010; Mishra et al. 2011; Geleta et al.
2012; Razafinarivo et al. 2013). SSR markers are the most
desired molecular markers for genetic diversity analysis
because of their high-information content, co-dominant
nature, sensitivity, and ease to analyze with minimal
quantities of test samples. It is also increasingly being used
for linkage analysis and molecular breeding (Baruah et al.
2003). Despite its widespread use in coffee, there is little
information on its use in evaluating the genetic diversity
of coffee varieties in the Philippines. Hence, the study was
conducted to assess the genetic diversity of C. arabica of the
country. This is vital in coffee improvement and selection,
screening of important traits such as reaction to pests and
diseases, tolerance/resistance to biotic and abiotic stresses,
high cup quality, and other traits. The information generated
in this study could lead to numerous possibilities in coffee
breeding and selection, in ensuring the authenticity of coffee
varieties, DNA fingerprinting, and many more.
MATERIALS AND METHODS
Plant Materials
A total of 68 accessions of coffee representing all
commercially cultivated species that were collected from
all over the Philippines were established in a field with
a land area of 1.3 ha located inside CvSU (14˚12.407’N,
Philippine Journal of Science Baltazar and Fabella: Genetic Diversity of
Vol. 149 No. 3-a, October 2020 Philippine Arabica Coffee

120˚52.803E; approximately 266 masl). Of these, the 27
accessions of C. arabica were used as samples (Table
1). Additionally, one representative accession of the
other Coffea was included in this study for reference and
comparison of SSR profiles.
DNA Extraction and Primer Selection
Fresh young leaves of a representative tree of each
accession were ground with liquid nitrogen in a small
mortar and pestle. Two DNA extraction protocols were
used and followed in the experiment: modified cetyl
trimethylammonium bromide method [modified from
Doyle and Doyle (1987)] was used in Granica, RDRF,
MVA, and FRT11; and Qiagen™ DNeasy Plant Mini Kit
for the rest of the accessions. The quality and quantity of
DNA samples were estimated using Lambda DNA (0.5 µg
µL–1, Vivantis) in 1% agarose gel (50 ml) with a 0.4 µL gel
stain (Biotin GelRedTM Nucleic Acid; 10,000x in water), 1x
Tris-acetate-EDTA (TAE) buffer. Only samples with intact
DNA and had sufficient quantities were used. Thirty-seven
(37) SSR primers were screened based on their reported
polymorphism across Coffea spp. Of these, 29 gave clear,
distinct, consistent, and scorable bands. Nineteen (19)
primers were found polymorphic across Coffea spp., 15 of
which were polymorphic in C. arabica (Table 2).
Polymerase Chain Reaction (PCR) Amplification
The primers were tested on the genomic DNA of the
coffee accessions. PCR was carried out in 10 µL volume
containing 1x PCR reaction buffer (10 mM Tris-HCl, pH
9.1; 0.01% TritonTM X-100; and 50 mM KCl), 1.5 mM
MgCl2, 0.2 mM dNTPs, 0.2 mM forward and reverse
primers, 1 U Taq DNA polymerase µL–1 (Vivantis), and 1
µL of 20–50 ng extracted DNA. PCR amplifications were

Table 1. List of Philippine coffee accessions/varieties of Coffea arabica used in the study.
Accession no. Popular name Source Genetic group
CvS01 Typica Ampasit, La Trinidad, Benguet Typica
CvS02 Mokka BSU, Ampasit, La Trinidad, Benguet Bourbon
CvS03 Mundo Novo (Bektey) BSU, Bektey, La Trinidad, Benguet Typica + Bourbon
CvS04 Granica (Fine) BSU, Ampasit, La Trinidad, Benguet
CvS05 Granica (Broad) BSU, Ampasit, La Trinidad, Benguet
CvS06 MSAC BSU, Ampasit, La Trinidad, Benguet
CvS07 Kenya BSU, Ampasit, La Trinidad, Benguet
CvS08 Granica (Standard) BSU, Ampasit, La Trinidad, Benguet
CvS09 Yellow Catturra BSU, Ampasit, La Trinidad, Benguet Bourbon
CvS10 Improved San Ramon BSU, Ampasit, La Trinidad, Benguet Typica
CvS11 San Ramon BSU, Ampasit, La Trinidad, Benguet Typica
CvS12 Mundo Novo (Ampasit) BSU, Ampasit, La Trinidad, Benguet Typica + Bourbon
CvS13 Mundo Novo 01 BSU, Ampasit, La Trinidad, Benguet Typica + Bourbon
CvS14 Red Bourbon Atok, Benguet Bourbon
CvS33 Mysore Mt. Matutum, Polomolok, South Cotabato Typica
CvS34 Yellow Bourbon BPI, Baguio City Bourbon
CvS36 MCA unknown
CvS45 Catimor Calamansig, Sultan Kudarat Introgressed
CvS55 Mysore T'boli Sitio Motokling, Monkayo, T'boli, South Cotabato Typica
CvS57 Granica Tublay, Benguet
CvS58 Mundo Novo Sagada Banga-an, Sagada, Mt. Province Typica + Bourbon
CvS59 MVA Unknown
CvS62 RDRF Los Banos, Laguna
CvS65 Red Cattura BPI, Baguio City Bourbon
CvS66 BRRT BPI, Baguio City
CvS67 BRRB BPI, Baguio City
CvS68 IRRT BPI, Baguio City
*Genetic group described by WCR (2018) and Pruvot-Woehl et al. (2020)

995
Philippine Journal of Science Baltazar and Fabella: Genetic Diversity of
Vol. 149 No. 3-a, October 2020 Philippine Arabica Coffee

Table 2. SSR markers used with the locus name; forward and reverse primer sequences; and annealing temperature, Ta (°C), and duration (min).
Code Locus name Primer sequence Reference Ta (°C), duration (min)
A M306 5’CTCGTTTGTGCTCTTTTTG3’ Poncet et al. (2007) 57, 0.5
5’TTTGTTAGTTTCTCTCCACCA3’

B M310 5’CACAGGTTGAGTTGCTTGA3’ Poncet et al. (2007) 57, 0.5

5’CCTCTCTGATTGGATTTGG3’

C M324 5’GCCCTTCCTTTCTTCATTTC3’ Poncet et al. (2007) 57, 0.5

5’TGGGTGTTCCTCTTTCTCTG3’

D M326 5’GCTTTCTTGCCTTTCTTTTCC3’ Poncet et al. (2007) 57, 0.5

5’CATCCACTTACCTCTCCCAAA3’

E M329 5’ACTCAGACAAACCCTTCAAC3’ Poncet et al. (2007) 55, 0.5

5’GATGTTTTGCATCTATTTGG3’

I 471 5’TTACCTCCCGGCCAGAC3’ Cubry et al. (2008) 57, 0.5

5’CAGGAGACCAAGACCTTAGCA3’

J CaM03 5’CGCGCTTGCTCCCTCTGTCTCT3’ Hendre et al. (2008) 65, 1

5’TGGGGGAGGGGCGGTGTT3’

K CaM16 5’AAGGCAGCTGAAGCGGGACAAA3’ Hendre et al. (2008) 65, 1

5’TGGGGAGAGCTGCAGTTGGAGG3’

M CM5 5’GTAACCACCACCTCCTCTGC3’ Baruah et al. (2003) 54, 1

5’TGGAGGTAACGGAAGCTCTG3’

S DCM06 5’GTAGTCGGTGGGCTTGTGTT3’ Aggarwal et al. (2007) 57, 1

5’AACGCGGACTAATTGAGGAA3’

T R105 5’CACCAATTCCACTGACAATG3’ Teressa et al. (2010) 50, 1

5’TCCCTGCCAACACACTTC3’

U R126 5’GCACAATCACTCCCAAAG3’ Teressa et al. (2010) 50, 1

5’TGACGGCCTACTACTTACAG3’

X R268 5’GTATCCCACAATGAAATCAC3’ Teressa et al. (2010) 50, 0.5

5’AGTAGAATTTTCAACATATAAG3’

Y R278 5’TGTAGATTTGAAACCCAATC3’ Teressa et al. (2010) 50, 0.5

5’AAGTCTCGACAAGTTTTGAC3’

Z R325 5’CCTTGTTGTTGGGGAATGTC3’ Teressa et al. (2010) 47, 0.5

5’GGCTGTTCTGGGCTTTGTG3’

A1 R338 5’CGAAGGCTGTCAACAACTGG3’ Teressa et al. (2010) 50, 1

5’GGGATAAACAAGTTAAAGGA3’

B1 R339 5’ATTATGCTCGCTGGGCTGTT3’ Teressa et al. (2010) 50, 1

5’TGGGATCACTCCTGTGTCGC3’

D1 124161 5’TGCGAAACCATTGAGAACAG3’ Teressa et al. (2010) 50, 0.5

5’CCGGAGGATGAGATTGAAAA3’

F1 123909 5’AGGCTTGCTGGAACTCTTGA3’ Teressa et al. (2010) 47, 0.5

5’GAAAGACTTGTCCTTTGCCG3’

carried out as follows: initial denaturation at 94 °C for 5 °C for 2 min.

min followed by 35 cycles of 94 °C for 2 min (optimized
annealing temperature and duration for each marker) The amplification was confirmed by running 4 µL of the
(Table 2), 72 °C for 1 min, and a final denaturation at 72 PCR products on 1% agarose gels stained with 0.4 µL

996
Philippine Journal of Science
Vol. 149 No. 3-a, October 2020
Biotin GelRedTM nucleic acid; 10,000x in water) using
Labnet ENDUROTM Gel XL Electrophoresis at 100 V for
45 min in 0.5x TAE buffer, then viewed in Bio-Print ST4
Vilber Lourmat Gel Documentation System.
Data Scoring and Analysis
The PCR products were further resolved in 6%
polyacrylamide gel electrophoresis at 80 V for 1 hr
and 30 min in 1x TAE buffer. After electrophoresis, the
gels were stained in SYBR® Safe DNA gel stain for
15–30 min. The size (bp) of amplified PCR products was
estimated using 0.5 µg µL–1 VC 100 bp plus DNA ladder
(Vivantis). Fragments amplified by primer pairs were
scored manually in terms of the position of the bands
relative to the ladder: “1” for the presence and “0” for the
absence of the band.
An allele matrix (1/0) was formed to generate a genetic
similarity matrix using Numerical Taxonomy and
Multivariate Analysis System (NTSYSpc) v. 2.0. The
similarity index was computed using the formula of the
Dice coefficient of association to measure the similarity
between genotypes.
(1)
where a corresponds to the number of bands present on
both genotypes, and b and c to the number of bands unique
to each genotype.
The relationships among accessions were analyzed using
the unweighted pair group method with arithmetic mean
(UPGMA) employing SAHN (sequential, agglomerative,
hierarchical, and nested clustering) algorithm.
Bootstrapping was applied to evaluate the degree of
association between the genetic similarity matrix and
dendrogram using the PAleontological STatistics software
version 4.03. The PIC that measures the variability at a
locus was calculated based on allele frequencies of all
coffee samples analyzed. PIC was calculated as follows:
Figure 1. Representative gel showing polymorphism in C. arabica accessions using primer CaM16. PCR product was run in 6% polyacrylamide
gel post-stained with SYBR® Safe DNA gel stain and viewed in Bio-Print ST4 Vilber Lourmat Gel Documentation System.
Baltazar and Fabella: Genetic Diversity of
Philippine Arabica Coffee
(2)
where pij is the frequency of the jth allele of the total
number of alleles at SSR locus and n is the total number
of alleles for locus.
RESULTS AND DISCUSSION
SSR Marker Diversity
SSR markers were employed to assess the genetic diversity
of C. arabica accessions collected from various areas in
the Philippines. The collection is currently conserved ex
situ in a field genebank. Out of the 19 SSR markers used,
15 (78.95%) were found to be polymorphic (Figure 1).
Non-informative markers that did not show polymorphism
across the 27 accessions were M306, M310, CaM03, and
R338. Out of the 56 alleles, 47 were polymorphic (rP =
83.9%). The number of alleles of the polymorphic markers
ranged from 2–6 with an average of 3.73 alleles per SSR
locus. CM05 generated the most number of alleles (Table
3). The number of alleles per locus we obtained was higher
than that reported by Moncada and McCouch (2004)
using 34 SSR markers, Maluf et al. (2005), Cubry et al.
(2008), and Geleta et al. (2012). Marker CM5 obtained
six alleles while R268 and 471 loci both obtained five
alleles. Of the 15 SSR markers used, only three of these
amplified two alleles (Table 3). These results are indicative
of the presence of non-recombining alleles of some loci
in C. arabica. These loci represent the homoeologous
regions from its two progenitors, C. canephora and C.
eugenoides. This corroborates the previous reports on
the amphidiploid (allotetraploid) nature of C. arabica
(Lashermes et al. 1999).
The degree of informativeness of the loci detected by their
997
Philippine Journal of Science Baltazar and Fabella: Genetic Diversity of
Vol. 149 No. 3-a, October 2020 Philippine Arabica Coffee

Table 3. Number of alleles and PIC of 15 SSR markers in Coffea and Geleta et al. (2012). Such a narrow genetic base is
arabica in the Philippines. expected for an introduced crop such as coffee as rigorous
No. Marker Total Number of PIC
selection has taken place. Further, this is accounted for the
number of polymorphic values autogamous nature of C. arabica limiting the introduction
alleles alleles of new alleles through hybridization.
1 M324 4 2 0.532
It is already established that C. canephora (Robusta)
2 M326 4 2 0.140 is the progenitor of C. arabica; thus, it is expected that
3 M329 4 4 0.568 C. canephora is closer to C. arabica than C. liberica.
4 471 5 5 0.408 A 100% bootstrap support was observed for C. arabica
5 CaM16 4 2 0.532
and C. canephora, and C. liberica and moderately strong
bootstrap support (68%) for C. canephora and C. arabica.
6 CM5 6 6 0.441
Further, Liberica (C. liberica var. liberica) and Excelsa
7 DCM06 3 2 0.609 (C. liberica var. dewevrei) belong to the same species
8 R105 2 2 0.203 (Lashermes et al. 1999) but are distinct from each other.
9 R126 4 4 0.396 The separation of the two in the dendrogram is reliable as
supported by high bootstrap value (75%). These findings
10 R268 5 4 0.424
are upheld in the dendrogram generated (Figure 2).
11 R278 3 3 0.591
12 R325 4 4 0.203 Generally, three major clusters were formed by the C.
arabica accessions using both the Dice (coefficient =
13 R339 2 1 0.203
0.783) and Jaccard (coefficient = 0.757) indices: Cluster
14 124161 4 4 0.331 I comprised of 15 accessions where most of the BSU
15 123909 2 2 0.252 accessions belong (nine out of 12); Cluster II was a smaller
Total 56 47 group that consisted of 10 accessions (all accessions from
Average 3.716 3.209 0.389
BPI, Baguio City except Yellow Bourbon, the rest of
the BSU collection, Mundo Novo Sagada, and Mysore
Rate of polymorphism, 83.9
rP (%)
T’boli); and Cluster III consisted of Yellow Bourbon and
MCA only that markedly separated from the two large
groups (Figure 2). The clustering of the accessions was
largely based on the origin of germplasm. The separation
PIC values ranged from 0.140 (M326) to 0.609 (DCM06). of Cluster III from the other two clusters had 99%
Most markers used were moderately to highly informative bootstrap value, thereby indicating the reliability of the
(PIC > 0.5), indicating their effectiveness in assessing the separation of Yellow Bourbon and MCA from the rest
genetic diversity of the collection (Table 3). of the C. arabica accessions. The separation of the two
accessions had moderately high bootstrap support (77%).
Genetic Diversity and Cluster Analysis Cluster I and Cluster II had low bootstrap supports but
The Dice similarity coefficient was used to generate the values do not necessarily indicate the unreliability
the matrix of genetic similarities and construct a of the dendrogram generated. Although the separation
dendrogram (Table 4 and Figure 2, respectively) of Cluster I and Cluster II is generally based on the
showing the relationships among the 27 Philippine C. origin of germplasm, it should be noted that the two
arabica accessions. In order to ascertain the dendrogram institution sources (BPI, Baguio City, Benguet; BSU, La
generated, the similarity coefficient was also computed Trinidad, Benguet) are located in adjacent municipalities
using the Jaccard coefficient. of Benguet. As such, the exchange of germplasm and
planting materials between the two institutions and
The genetic similarity of the accessions ranged from 0.64 coffee farmers in Benguet occurred and resulted in gene
(MCA and Mundo Novo from Bektey, Kenya, Mundo Novo flow between populations that cause chimeric loci. Thus,
(Ampasit), Mundo Novo 01, and Red Bourbon; and MVA clustering based on the geographic source of germplasm
and MCA) to 1.0 (San Ramon and Improved San Ramon; in C. arabica accessions is not supported.
Mundo Novo (Ampasit) and Mundo Novo 01; Mysore
T’boli and BRRB, and BRRT; and Red Cattura and IRRT). Duplicate accessions were found despite their striking
The average genetic similarity of the collection was 0.83; morphological differences, for instance, San Ramon
overall, the genetic diversity of the Philippine C. arabica and Improved San Ramon; Mundo Novo (Ampasit) and
is considered low (Table 4). This result is in agreement Mundo Novo 1, and Granica (Fine) and Granica (Broad)
with the findings of Anthony et al. (2002), Baruah et al. (Table 4; Figure 2). The bootstrap values’ levels of
(2003), Moncada and McCouch (2004), Cubry et al. (2008), support were high (81–88%). Improved San Ramon had

998
 Table 4. Genetic similarity matrix based on the Dice coefficient from 15 SSR markers obtained for Philippine Coffea arabica.

Accession/variety Typica Mokka Mundo Granica Granica MSAC Kenya Granica Yellow Improved San Mundo Mundo Red Mysore Yellow MCA Granica MVA RDRF Catimor Mysore Mundo Red BRRT BRRB IRRT
Novo (Fine) (Broad) (Standard) Catturra San Ramon Ramon Novo Novo 01 Bourbon Bourbon T'boli Novo Cattura
(Bektey) (Ampasit) Sagada

Typica 1.00
Philippine Journal of Science
Vol. 149 No. 3-a, October 2020

Mokka 0.92 1.00

Mundo Novo (Bektey) 0.90 0.97 1.00

Granica (Fine) 0.83 0.87 0.88 1.00

Granica (Broad) 0.84 0.86 0.89 0.99 1.00

MSAC 0.78 0.81 0.85 0.90 0.91 1.00

Kenya 0.80 0.82 0.86 0.93 0.94 0.89 1.00

Granica (Standard) 0.69 0.70 0.71 0.76 0.77 0.86 0.79 1.00

Yellow Catturra 0.67 0.72 0.75 0.80 0.80 0.89 0.81 0.93 1.00

Improved San Ramon 0.84 0.86 0.89 0.96 0.98 0.91 0.94 0.79 0.82 1.00

San Ramon 0.84 0.86 0.89 0.96 0.98 0.91 0.94 0.78 0.82 1.00 1.00

Mundo Novo (Ampasit) 0.81 0.88 0.92 0.94 0.95 0.88 0.92 0.75 0.79 0.98 0.98 1.00

Mundo Novo 01 0.81 0.88 0.92 0.94 0.95 0.88 0.92 0.75 0.79 0.98 0.98 1.00 1.00

Red Bourbon 0.86 0.83 0.87 0.89 0.90 0.88 0.86 0.77 0.78 0.93 0.93 0.90 0.90 1.00

Mysore 0.92 0.89 0.87 0.90 0.91 0.86 0.84 0.73 0.71 0.91 0.91 0.88 0.88 0.91 1.00

Yellow Bourbon 0.70 0.68 0.66 0.69 0.70 0.76 0.68 0.87 0.84 0.70 0.70 0.67 0.67 0.67 0.77 1.00

MCA 0.72 0.68 0.64 0.70 0.70 0.73 0.64 0.86 0.77 0.65 0.68 0.64 0.64 0.64 0.78 0.90 1.00

Granica 0.88 0.82 0.79 0.90 0.89 0.84 0.83 0.73 0.72 0.85 0.87 0.84 0.84 0.84 0.89 0.74 0.74 1.00

MVA 0.87 0.91 0.87 0.92 0.91 0.81 0.87 0.67 0.72 0.88 0.91 0.93 0.93 0.88 0.91 0.68 0.64 0.89 1.00

RDRF 0.91 0.88 0.84 0.94 0.93 0.83 0.89 0.71 0.76 0.89 0.93 0.90 0.90 0.88 0.91 0.71 0.68 0.93 0.95 1.00

Catimor 0.73 0.78 0.81 0.79 0.79 0.88 0.81 0.88 0.89 0.81 0.81 0.85 0.85 0.81 0.74 0.78 0.70 0.79 0.81 0.78 1.00

Mysore T'boli 0.75 0.73 0.77 0.88 0.88 0.97 0.82 0.91 0.89 0.87 0.86 0.82 0.82 0.86 0.82 0.83 0.71 0.84 0.72 0.77 0.92 1.00

Mundo Novo Sagada 0.71 0.67 0.71 0.77 0.77 0.85 0.76 0.83 0.86 0.80 0.80 0.76 0.76 0.79 0.70 0.74 0.69 0.76 0.71 0.76 0.89 0.91 1.00

Red Cattura 0.76 0.73 0.76 0.81 0.81 0.92 0.83 0.92 0.93 0.84 0.84 0.80 0.80 0.83 0.76 0.81 0.75 0.81 0.76 0.80 0.96 0.97 0.95 1.00

BRRT 0.76 0.72 0.76 0.86 0.86 0.93 0.80 0.91 0.90 0.84 0.84 0.80 0.80 0.83 0.80 0.82 0.77 0.85 0.76 0.80 0.93 1.00 0.92 0.98 1.00

BRRB 0.68 0.68 0.74 0.81 0.81 0.91 0.74 0.87 0.86 0.79 0.79 0.79 0.79 0.78 0.79 0.81 0.74 0.80 0.74 0.74 0.97 1.00 0.96 0.97 1.00 1.00

IRRT 0.72 0.67 0.72 0.79 0.79 0.94 0.86 0.93 0.90 0.82 0.82 0.77 0.77 0.86 0.71 0.71 0.67 0.78 0.72 0.77 0.94 0.96 0.92 1.00 0.97 0.94 1.00
Philippine Arabica Coffee
Baltazar and Fabella: Genetic Diversity of

999
Philippine Journal of Science
Vol. 149 No. 3-a, October 2020
Figure 2. Consensus dendrogram based on the Dice coefficient (SAHN clustering using UPGMA) illustrating the genetic relationship
between Coffea arabica accessions from the NCRDEC field genebank. Bootstrap supports (in percentage) of 1000 replicates
are shown.
a pyramidal appearance whereas San Ramon was bushy.
On the other hand, Mundo Novo (Ampasit) had greenish
young leaves whereas Mundo Novo 1 had reddish-brown
young leaves, while Granica (Fine) had narrow leaves and
Granica (Broad) had broad leaves (data not shown). These
observations demonstrated that the use of SSR markers
is powerful in identifying similar or unique individuals.
Although high genetic similarity was observed between
Mysore T’boli, BRRB, and BRRT; and Red Cattura and
IRRT (Table 4; Figure 2), the bootstrap values were below
50%. Additional loci could be explored to determine the
genetic relationships of the mentioned accessions. BRRB,
BRRT, Red Cattura, and IRRT –all from BPI – were
identified by the institution as different accessions/strains.
Nonetheless, these results are crucial for BPI in managing
their coffee germplasm, selection, and improvement of
coffee through identification and selection of breeding
stocks, and in the registration of varieties at NSIC.
Interestingly, RDRF, a productive C. arabica in lowland
conditions (collected from Laguna province; 22 masl)
was included in Cluster I (Figure 2) and had low genetic
similarity (0.31) with the C. canephora / Robusta
representative sample (FRT 11). These results nullified our
initial hypothesis that RDRF is a variety of C. canephora
or just one variety of a lesser cup quality C. arabica
that thrives in the lowland such as Catimor. RDRF then
can open the possibility of producing Arabica coffee in
lowland areas of the Philippines.
1000
Baltazar and Fabella: Genetic Diversity of
Philippine Arabica Coffee
Some varieties that have the same names were collected
from different locations. For instance, there were four
Mundo Novo accessions collected: three in the area of
BSU, La Trinidad, Benguet; and one in Sagada, Mountain
Province. Two Mysore samples were collected in T’boli and
Polomolok, South Cotabato. Four Granica samples were
acquired: three in BSU, La Trinidad, Benguet; and one in
Tublay, Benguet. Synonymous accessions were expected
to have a high genetic similarity or at least share the same
cluster. In our study – except for the two Mundo Novo
from BSU, Ampasit, Benguet – the otherwise has been
observed. The similarity indices were less than 0.90 in most
accessions, and they did not band together in one cluster
(Table 4; Figure 2). Given the autogamous nature of the
crop, it could be possible that these accessions were at first
the same or came from the same mother trees; however, it is
unexpected for such differentiation of varieties to happen.
The most plausible explanation for such differentiation is
due to the presence of some degree of outcrossing in C.
arabica, which may happen at a rate of 10–15% (Anthony
et al. 2001) and even as high as 50%, as that reported by
Berecha et al. (2014) in Ethiopian forests. Coffee pollens
can be transported as far as 6.5 km through insect pollinators
such as bees (Schmitt 2006). Thus, it is very likely that
genetic drift happened for an originally pure variety
because C. arabica nursery owners and propagators in the
Philippines do not practice procedures such as isolation
of mother trees, bagging of flowers, etc. to prevent cross-
pollination. Genetic drift can be heightened by hybrid vigor
Philippine Journal of Science
Vol. 149 No. 3-a, October 2020
(Leroy et al. 1993; Bertrand et al. 2011). For instance, Red
Bourbon trees can be pollinated by another variety planted
nearby. Some of the seeds are, therefore, F1 hybrids of Red
Bourbon and that variety. When these F1 hybrid seeds are
planted, they will perform better than Red Bourbon and the
other parent. This will prompt the grower/farmer to select
fruits from these F1 hybrids trees. In the F2 generation, the
traits will segregate and the true genetic identity of Red
Bourbon has been lost.
The information from the cluster analysis further offers
knowledge in choosing appropriate parents in developing
F1 hybrids that are produced through the hybridization
of two genetically distant parents. The F1 progenies are
utilized as they have a higher level of adaptability and
performance than either parent due to “hybrid vigor”
or heterosis. Thus, Arabica F1 hybrids are termed as
new generation Arabica coffee varieties (Pruvot-Woehl
et al. 2020). Several Arabica coffee F1 hybrids were
recently developed by the World Coffee Research such
as Centroamericano, Mundo Maya, Starmaya, Ruiru 11,
etc. and were noted of the exceptional cup quality and
resistance to pests and diseases (Pruvot-Woehl et al. 2020).
Distinct genetic groups were described in C. arabica:
the Typica, Bourbon, Typica and Bourbon, Introgressed
(Catimor or Villa Sarchi groups), and the F1 hybrid groups
(WCR 2018; Pruvot-Woehl et al. 2020). The cluster
analysis revealed that the clustering of the varieties/
accessions was not in line with their varietal classification
based on their genetic groups. For instance, the Bourbon
Group (Yellow Caturra, Yellow Bourbon, Red Caturra,
and Red Bourbon) did not assemble in the same cluster.
These results may be attributed to the complicated
naming of C. arabica in the Philippines. This may also
be due to mislabelling and mixing up of plant materials
in the germplasm collection or by the farmers and plant
propagators. Some varieties/accessions have synonymous
labels where the same genotype carries different names
(for example, IRRT and Red Caturra); a homonymous
label where different genotypes carry the same name (such
as Granica, Mundo Novo, and Mysore); and new name
based on an erroneous belief about the name of the variety
(as in the case of Mysore and Catimor). Mysore is not a
variety but a place in India where Typica was initially
introduced in the 17th century. Correspondingly, Catimor
is not a variety but a group of distinct varieties of C.
arabica (WCR 2018). A similar observation was reported
by Geleta et al. (2012) in their study on Nicaraguan C.
arabica. Pruvot-Woehl et al. (2020) also reported that
this is a widespread situation in almost all parts of the
coffee-producing areas of the world.
Baltazar and Fabella: Genetic Diversity of
Philippine Arabica Coffee
CONCLUSION
The genetic diversity of Philippine C. arabica coffee
collections was assessed using 19 SSR markers. To the
best of our knowledge, this is the first report on the genetic
characterization of coffee in the Philippines that involves
a relatively large number of genotypes using molecular
markers.
The SSR markers used were informative that resulted
in determining the genetic diversity of the collection,
identification of duplicates, and unique accessions.
Overall, the genetic diversity of the collection was low,
a similar observation in other C. arabica collections of
other countries. Low genetic variation compromises a
population to extinction. Genetic variation is the raw
materials for evolution, and low variability prevents
the species to evolve in response to the adverse effects
of changing the environment. Thus, the information
generated in this study are indispensable in increasing
the genetic variability of Philippine C. arabica through
proper management of the genetic resources; identification
of core collection; varietal registration and approval;
and development of breeding and selection strategies
for resistance to coffee leaf rust, coffee berry borer,
nematodes, tolerance to high temperature, high cup
quality, and other economically important traits.
ACKNOWLEDGMENTS
This study was funded by CvSU and the Department
of Science and Technology – Philippine Council for
Agriculture, Aquatic and Natural Resources Research
and Development. The authors are grateful to BSU, BPI
Baguio City, and all donors of Arabica coffee. The efforts
of the PCP Project 2 and the National Coffee Research,
Development and Extension Center staff in maintaining
the collection are highly recognized.
REFERENCES
AGA E, BRYNGELSSON T, BEKELE E, SOLOMON B.
2003. Genetic diversity of forest Arabica coffee (Coffea
arabica L.) in Ethiopia as revealed by random ampli-
fied polymorphic DNA (RAPD) analysis. Hereditas
138(1): 36–46.
AGGARWAL RK, HENDRE PS, VARSHNEY RK,
BHAT PR, KRISHNAKUMAR V, SINGH L. 2007.
Identification, characterization and utilization of
EST-derived genic microsatellite markers for genome
analyses of coffee and related species. Theor Appl
Genet 114: 359–372.
1001
Philippine Journal of Science
Vol. 149 No. 3-a, October 2020
ANTHONY F, BERTRAND B, QUIROS O, WILCHES
A, LASHERMES AP, BERTHAUD J, CHARRIER A.
2001. Genetic diversity of wild coffee (Coffea arabica
L.) using molecular markers. Euphytica 118: 53–65.
ANTHONY F, COMBES M, ASTORGA C, BERTRAND
B, GRAZIOSI G, LASHERMES P. 2002. The origin
of cultivated Coffea arabica L. varieties revealed
by AFLP and SSR markers. Theor and Appl Genet
104: 894–900.
BARUAH A, NAIK V, HENDRE PS, RAJKUMAR R,
RAJENDRAKUMAR P, AGGARWAL RK. 2003.
Isolation and characterization of nine microsatellite
markers from Coffea arabica L., showing wide cross-
species amplifications. Molecular Ecology Notes 3:
647–650.
BERECHA GA, AERTS R, VANDEPITTE K, VAN GLA-
BEKE S, MUYS B, ROLDÁN-RUIZ I, HONNAY
O. 2014. Effects of Forest Management on Mating
Patterns, Pollen Flow and Intergenerational Transfer
of Genetic Diversity in Wild Arabica Coffee (Coffea
arabica L.) from Afromontane Rainforests. Biological
Journal of the Linnean Society 112(1): 76–88.
BERTRAND B, ALPIZAR E, LLARA L, SANTACREO
R, HIDALGO M, QUIJANO JM, CHARMETANT
P, MONTAGNON C, GEORGET F, ETIENNE H.
2011. Performance of Coffea arabica F1 hybrids in
agroforestry and full-sun cropping systems in com-
parison with American pure line varieties. Euphytica
181(2): 147–158.
BROWNING D. 2018. How many coffee farms are there
in the world? ASIC Conference Portland, 16–20 Sep-
tember 2018. Retrieved on 20 Mar 2020 from https://
www.youtube.com/watch?v¼vKaeDkpqPSg
CASTRO BS. 2003. Demythologising the histo-
ry of coffee in Lipa, Batangas in the 19 th cen-
tury [MS thesis]. University of Adelaide, Ad-
elaide, South Australia. 55p. Retrieved from https://
digital.library.adelaide.edu.au/dspace/handle/
2440/56622
CUBRY O, MUSOLI P, LEGNATE H, POT D, DE
BELLIS F, PONCET V, ANTHONY F, DUGOUR M,
LEROY T. 2008. Diversity in coffee assessed with SSR
markers: structure of the genus Coffea and perspective
in breeding. Genome 51: 50–63.
DAVIS AP, TOSH J, RUCH N, FAY MF. 2011. Growing
coffee: Psilanthus (Rubiaceae) subsumed on the basis
of molecular and morphological data; implications for
the size, morphology, distribution and evolutionary
history of Coffea. Botanical Journal of the Linnean
Society  167: 357–377.
1002
Baltazar and Fabella: Genetic Diversity of
Philippine Arabica Coffee
DOYLE JJ, DOYLE JL. 1987. A rapid DNA isolation
procedure for small quantities of fresh leaf tissue.
Phytochemical Bulletin 19: 11–15.
GELETA M, HERRERA I, MONZÓN A, BRYNGELS-
SON T. 2012. Genetic Diversity of Arabica Coffee
(Coffea arabica L.) in Nicaragua as Estimated by
Simple Sequence Repeat Markers. The Scientific
World Journal 2012: 1–11.
HENDRE PS, PHANINDRANATH R, ANNAPURNA
C, LALREMRUATA A, AGGARWAL RK. 2008.
Development of new genomic microsatellite markers
from robusta coffee (Coffea canephora Pierre ex A.
Froehner) showing broad cross-species transferability
and utility in genetic studies. BMC Plant Biology 8: 51.
[ICO] International Coffee Organization. 2017. Historical
Data on the Global Coffee Trade. Retrieved on 27 Mar
2020 from http://www.ico.org
[IPNI] The International Plant Names Index. 2020. The
Royal Botanic Gardens, Kew, Harvard University Her-
baria, The Australian National Herbarium. Retrieved
on 18 Aug 2018 from http://www.ipni.org
JUAN P, FRANCISCO M. 2007. An introduction to Cof-
fee. Manila: Anvil Publishing 216p.
LASHERMES P, COMES MC, ROBERT J, TROUSLOT
P, D’HONT A, ANTHONY F, CHARRIER A. 1999.
Molecular characterization and origin of the Coffea
arabica L. genome. Molecular and General Genetics
261: 259–266.
LEROY T, MONTAGNON C, CHARRIER A, ESKES
AB. 1993. Reciprocal recurrent selection applied
to  Coffea canephora Pierre. I. Characterization and
evaluation of breeding populations and value of inter-
group hybrids. Euphytica 67: 113–125.
MALUF MP, SILVESTRINI M, RUGGIERO LMDC,
FILHO OG, COLOMBO CA. 2005. Genetic diversity
of cultivated Coffea arabica inbred lines assessed by
RAPD, AFLP and SSR marker system. Science Agri-
culture 62(4): 366–373.
MISHRA MK, NISHANI S, JAYARAMA. 2011. Mo-
lecular Identification and genetic relationship among
coffee species (Coffea L.) inferred from ISSR and
SRAP marker analyses. Archives of Biologial Sciences
63(3): 667–679.
MONCADA P, MCCOUCH S. 2004. Simple sequence
repeats diversity in diploid and tetraploid Coffea spe-
cies. Genome 47: 501–509.
[PSA] Philippine Statistics Authority. n/d. Other Crops:
Volume of Production, by Region and by Province,
1990–2018; Other Crops: Area Planted/Harvested, by
Philippine Journal of Science Baltazar and Fabella: Genetic Diversity of
Vol. 149 No. 3-a, October 2020 Philippine Arabica Coffee

Region and by Province, 1990–2018. Retrieved on 28 RUAS PM, RUAS CF, RAMPIM L, CARVALHO VP,
Mar 2020 from http://openstat.psa.gov.ph/ RUAS EA, SERA T. 2003. Genetic relationship in
Coffea species and parentage determination of inter-
PONCET V, HAMON P, MINIER J, CARASCO C, HAM-
specific hybrids using ISSR (Inter-Simple Sequence
ON S, NOIROT M. 2004. SSR cross-amplification and
Repeats) markers. Genetics and Molecular Biology
variation within coffee trees (Coffea spp.). Genome
26(3): 319–327.
47: 1071–1081.
SCHMITT CB. 2006. Montane rainforest with wild Cof-
PONCET V, DUFOUR M, HAMON P, HAMON S, DE
fea arabica in the Bonga Region (SW Ethiopia): plant
KOCHKO A, LEROY T. 2007. Development of ge-
diversity, wild coffee management and implications
nomic microsatellite markers in Coffea canephora and
for conservation [Ph.D. Thesis]. Ecology and Devel-
their transferability to other coffee species. Genome
opment Series No. 48. Cuvillier Verlag: Göttingen,
50(12): 1156–1161.
Germany. 172p.
PRUVOT-WOEHL S, KRISHNAN S, SOLANO W,
TERESSA A, CROUZILAT D, PETIARD V, BROUHAN
SCHILLING T, TONIUTTI L, BERTRAND B,
P. 2010. Genetic Diversity of Arabica coffee (Coffea
MONTAGNON C. 2020. Authentication of Coffea
arabica L.) collections. Ethiopian Journal of Applied
arabica varieties through DNA fingerprinting and its
Sciences and Technology 1(1): 63–79.
significance for the coffee sector. Journal of AOAC
International 103(2): 325–334. [WCR] World Coffee Research. 2018. Arabica Coffee
Varieties. Portland, Oregon: 54p. Retrieved on 17
RAZAFINARIVO NJ, GUYOT R, DAVIS AP, COU-
Aug 2018 from https://varieties.worldcoffeeresearch.
TURON E, HAMON S, CROUZILLAT D, RIGORE-
org/varieties
AU M, DUBREUIL-TRANCHANT C, PONCET V,
DE KOCHKO A, RAKOTOMALALA JJ, HAMON P.
2013. Genetic structure and diversity of coffee (Coffea)
across Africa and the Indian Ocean islands revealed
using microsatellites. Annals of Botany 111: 229–248.

1003