bs_bs_banner

Environmental Microbiology (2015) doi:10.1111/1462-2920.12934

Chronic cigarette smoke exposure induces microbial

and inflammatory shifts and mucin changes in the
murine gut

Liesbeth Allais,1* Frederiek-Maarten Kerckhof,2 decreased Tgf-β in the proximal colon. Tight junction
Stephanie Verschuere,3 Ken R. Bracke,4 gene expression remained unchanged. We infer that
Rebecca De Smet,1 Debby Laukens,5 the modulating role of chronic smoke exposure as a
Pieter Van den Abbeele,2 Martine De Vos,5 latently present risk factor in the gut may be driven by
Nico Boon,2 Guy G. Brusselle,4 Claude A. Cuvelier1 the altered epithelial mucus profiles and changes in
and Tom Van de Wiele2 microbiome composition and immune factors.
1
Department of Medical and Forensic Pathology,
2
Laboratory of Microbial Ecology and Technology Introduction
(LabMET), Faculty of Bioscience Engineering, Ghent
Inflammatory bowel diseases (IBD), comprising Crohn’s
University, Ghent, Belgium.
3
disease (CD) and ulcerative colitis (UC), result from a
Department of Pathology, AZ Sint-Jan, Brugge,
complex interplay between environmental factors, genet-
Belgium.
4
ics and intestinal microbiota, which combine to initiate and
Laboratory for Translational Research in Obstructive
perpetuate chronic inflammation in the gastrointestinal
Pulmonary Diseases, Department of Respiratory
tract. CD is associated with a transmural and discontinu-
Medicine, Ghent University Hospital, Ghent, Belgium.
5
ous inflammation that most frequently involves the ileum
Department of Gastroenterology, Ghent University,
and colon, but can affect the entire gastrointestinal tract,
Ghent, Belgium.
while in UC, a superficial inflammation occurs which is
limited to the colon (Khan and Collins, 2006; Jin et al.,
Summary 2012). The prevalence of IBD ranges from 174 to 210 for
CD and 79 to 122 for UC per 100 000 inhabitants in
Inflammatory bowel diseases (IBD) are complex mul-
Western countries and is still increasing (Loftus, 2004;
tifactorial diseases characterized by an inappropriate
Lakatos, 2006; Hovde and Moum, 2012). Disrupted intes-
host response to an altered commensal microbiome
tinal homeostasis and abnormal immune responses to
and dysfunctional mucus barrier. Cigarette smoking is
host intestinal resident microbiota play a major role in the
the best known environmental risk factor in IBD. Here,
pathogenesis, although the exact mechanisms have not
we studied the influence of chronic smoke exposure
yet been elucidated (Strober et al., 2007; Xavier and
on the gut microbiome, mucus layer composition and
Podolsky, 2007).
immune factors in conventional mice. We compared
Disturbance of the microbial equilibrium, termed
smoke-exposed with air-exposed mice (n = 12) after a
dysbiosis, is characterized by quantitative and qualitative
smoke exposure of 24 weeks. Both Illumina sequenc-
changes in the microbiota. This is marked by an increase of
ing (n = 6) and denaturing gradient gel electrophoresis
common bacterial inhabitants of the gut that become
(n = 12) showed that bacterial activity and community
pathogenic under permissive conditions (Stecher et al.,
structure were significantly altered in the colon due
2013). Dysbiosis provokes dysregulation of adaptive
to smoke exposure. Interestingly, an increase of
immune responses in the gut and is increasingly recog-
Lachnospiraceae sp. activity in the colon was
nized as a contributing factor in the pathogenesis of IBD
observed. Also, the mRNA expression of Muc2 and
(Carbonnel et al., 2009; Round and Mazmanian, 2009).
Muc3 increased in the ileum, whereas Muc4 increased
Previous studies showed that bacterial diversity is
in the distal colon of smoke-exposed mice (n = 6).
decreased in stool samples of IBD patients (Manichanh
Furthermore, we observed increased Cxcl2 and
et al., 2006; Erickson et al., 2012). Alterations in the
decreased Ifn-γ in the ileum, and increased Il-6 and
abundance of species of all prominent intestinal
phyla Firmicutes, Bacteroidetes, Verrucomicrobia, Actino-
Received 9 February, 2015; accepted 28 May, 2015. *For corre-
spondence. E-mail Liesbeth.allais@ugent.be or liesbeth.allais@ bacteria and Proteobacteria are associated with the devel-
gmail.com; Tel. +32 9 332 49 53; Fax +32-93324965. opment of IBD (Frank et al., 2007; Png et al., 2010b).
© 2015 Society for Applied Microbiology and John Wiley & Sons Ltd
2 L. Allais et al.
Cigarette smoke (CS) is the most prominent environ-
mental risk factor for developing CD; however, it
exerts a protective role in UC (Persson et al., 1990;
Ananthakrishnan, 2013). In addition, smoke exposure
may have an important impact on the composition and
dynamics of the gut microbiome. For instance, the
Bifidobacterium population increased in the caecum of
rats after 4 weeks of CS exposure (Tomoda et al., 2011).
In mouse, side-stream smoking increased Clostridium
sp., but decreased the Firmicutes phylum (Lactococcus
and Ruminococcus sp.), the Enterobacteriaceae family
and the segmented filamentous bacteria in the caecum
(Wang et al., 2012). In human studies, smoking has
been associated with a higher rate of Clostridium difficile
infection, in which current smokers (actively smoking
during the study) have the highest risk compared with
former (quitted smoking before the start of the study)
and never smokers (never smoked in their whole life)
(Rogers et al., 2012). Moreover, CS is a known risk
determinant for both bacterial and viral infections
through alterations in cell- and humoral-mediated
immune responses in the respiratory tract (Arcavi and
Benowitz, 2004). We recently demonstrated that CS trig-
gers the gut immune system through the recruitment of
immune cells to the Peyer’s patches (PP), the main lym-
phoid organs in the gut, and through the induction
of autophagy and apoptosis in the follicle-associated
epithelium (FAE) overlying the PP (Verschuere et al.,
2011; 2012).
Many studies have investigated the impact of specific
intestinal bacteria on host gene and protein expression in
the intestine and their role in IBD development (Rolli et al.,
2010). Nevertheless, the role of smoking in the emergence
of dysbiosis, which might modulate the risk for the
development of IBD, still needs further investigation. CS
alters host–microorganism interaction dynamics in the
airways, causing respiratory tract infections and contribut-
ing to chronic obstructive pulmonary disease (COPD)
(Garmendia et al., 2012). This study addresses the effect
of chronic CS exposure on the gut mucosa and its micro-
bial environment. We examined the diversity of the bacte-
rial community in the ileum and colon of mice exposed to
CS or air for 24 weeks. Additionally, we explored which
species were sensitive to CS exposure and to what extent
the composition of the mucus layer and inflammatory gene
expression is affected.
Results
The gut bacterial community shifts in response to
cigarette smoke
To determine the response of the host microbiome to CS,
the taxonomical community structure of the microbiome in
ileal, caecal and distal colonic samples of 12 smoke-
© 2015 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology
exposed and 12 air-exposed mice was analysed by dena-
turing gradient gel electrophoresis (DGGE) as a profiling
technique. Dendrograms applying the abundance-based
Jaccard index (Fig. 1) and Yue and Clayton’s theta index
(Fig. S1) were used to visualize the clustering of the
samples. Considering the distinct intestinal regions, the
dendrograms showed clear clusters for air-exposed mice
(49 ± 11% and 58 ± 9% within-group similarity, respec-
tively), separated from smoke-exposed mice in caecum
and distal colon, suggesting a bacterial shift (P = 0.001 for
both using multivariate analysis of variance (MANOVA)).
This kind of separated clusters was not observed in the
dendrogram of the ileal samples, with the air-exposed
samples only showing 42 ± 11% within-group similarity.
The activity of specific bacterial species is influenced by
smoke exposure
A shift in the microbial composition may potentially
imply a shift in microbial activity. Using cDNA samples,
we evaluated the activity of the microbiome with Illumina
sequencing as a more high-resolution method. We ran-
domly selected 12 mice (six smoke- and six air-exposed
mice, originating from four distinct cages) of which
ileal, caecal and distal colonic samples were included in
the analysis. Changes in 16S rRNA levels were evalu-
ated by the sparse partial least square discriminant
analysis (sPLS-DA). This clearly showed a distinct ordi-
nation for proximal and distal colon between the smoke-
and air-exposed murine microbiome activity (Fig. 2),
but not for ileum, which parallels the shift in microbial
composition as shown by the DGGE-based clustering
(Fig. 1).
To further investigate the effect of smoke exposure on
bacterial activity in the murine gut, we used Illumina
sequencing to identify the operating taxonomic units
(OTUs) showing changes in activity in the different gut
regions of six smoke- and six air-exposed mice. We
applied the sPLS-DA method to identify the specific OTUs
in each separate intestinal region. All relevant OTUs were
clustered using the unweighted pair group method with
arithmetic mean (UPGMA) algorithm and displayed in a
heatmap (Fig. 3), which demonstrated that the expressed
16S rRNA level and therefore the activity of OTU010,
representing Lachnospiraceae sp., strongly increases in
proximal and distal colon (571.74% and 300.76% change,
respectively) in response to smoke exposure.
Cigarette smoke exposure affects the specific mucin
expression pattern, but not the main mucin classes in
ileum and distal colon
The detected bacterial changes prompted us to investigate
whether the mucin composition of the mucus layer is

Fig. 1. Agglomerative nesting clustering dendrograms using the
abundance-based Jaccard distance measure based on the DGGE
data with average linkage (UPGMA), normalized in BIONUMERICS
5.10 software. (A) Clustering dendrogram for ileum, (B) clustering
dendrogram for caecum and (C) clustering dendrogram for distal
colon. SM, smoking; NSM, non-smoking; DC, distal colon; IL,
ileum; CC, caecum.
© 2015 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology
Cigarette smoke induces shifts in the murine gut 3
altered upon CS exposure. Mucins in the gut can be
subdivided in two main classes: secretable mucins and cell
surface mucins (Hoebler et al., 2006). We examined the
amount of goblet cells, which secrete mucins into the gut
lumen, in Alcian Blue (AB)/periodic acid Schiff (PAS)-staine
ileum and distal colon sections of 10 smoke-exposed of 10
air-exposed mice. For each group, ileum and distal colon
sections were scored. No significant differences were
detected. Additionally, tissue sections of the same gut
samples were stained with high iron diamine (HID) and AB
to differentiate between sulfo- and sialomucins. Again, no
significant differences were detected.
Furthermore, we examined the mRNA expression
pattern of MUC1, MUC2, MUC3 and MUC4. MUC2 is
stored in goblet cells and typically secreted, whereas
MUC1, MUC3 and MUC4 are membrane-bound cell
surface mucins, which are anchored in the glycocalyx,
located at the apical surface of the enterocyte (Hoebler
et al., 2006). Expression analysis in both the smoke-
and air-exposed group (n = 6 in each group) showed a
shift in the mucin expression pattern in response to CS
in ileum and distal colon (Fig. 4A and B). In the ileum,
Muc2 and Muc3 expression was upregulated in
response to CS, while Muc1 and Muc4 expression was
not significantly altered. Muc2 and Muc3 expression
in air-exposed ileum was much lower than in air-
exposed distal colon, which is not surprising as bacterial
load and therefore bacteria-induced mucus in the ileum
is much lower (Johansson, 2014). Interestingly, being
induced by CS exposure, Muc2 and Muc3 expression in
the ileum resembles a more colon-like expression sig-
nature. In the distal colon, only Muc4 expression is
increased in smoke-exposed compared with air-exposed
animals.
Cigarette smoke exposure affects inflammatory gene
expression, but not the tight junction gene expression
The gut microbiota play an important role in the immuno-
logical response of the gut (Round et al., 2010). Interest-
ingly, we have previously shown that 24 weeks of CS
exposure affects the ileal immunological response by trig-
gering the attraction of immune cells to the PP, the
immune inductive sites of the gut (Verschuere et al.,
2011). Therefore, we investigated the effect of CS expo-
sure on inflammatory gene expression in the immune
effector regions of the gut (n = 6 in each group). We
observed a significant increase of Cxcl2, a decrease of
Ifn-γ and a nominal decrease of Il-6 in the ileum (Fig. 4C),
whereas Tnf-α, Il-10, Nfκb and Tgf-β remained unaltered
(Fig. S2A). In the proximal colon, Il-6 was increased and
Tgf-β was decreased (Fig. 4D), while Il-10, Nfκb, Ifn-γ,
Cxcl2 and Il-1β did not change (Fig. S2B). However, in the
distal colon, inflammatory gene expression remained
4 L. Allais et al.

Fig. 2. Individuals plot, based on the Illumina sequencing data, showing a clearly distinct ordination between the proximal and distal colonic
samples of air- and smoke-exposed mice. No distinct ordination could be detected in the ileum. This confirms the DGGE data. SM, smoking;
NSM, non-smoking; DC, distal colon; IL, ileum; PC, proximal colon.

unchanged (Fig. S2C and D). In addition, we analysed the
effect of chronic CS exposure on tight junction gene
expression. It is known that loss of gut epithelial integrity
and barrier function are predisposing factors in IBD, for
which CS is a major risk factor, and local inflammation
impairs the barrier function of gut epithelium (Wang et al.,
2012). We did not observe any changes in the tight junc-
tion genes β-catenin, occludin, claudin-4 and E-cadherin
(Fig. S3).
Discussion
In this study, we demonstrate that chronic exposure to
cigarette smoke significantly affects the mucosa-
associated bacterial community, mucins and inflammatory
gene expression in the gut of conventional mice. We
revealed a shift of the community structure and an
increase in the activity of Lachnospiraceae sp. in the
colon. Furthermore, in the ileum, mRNA expression of
Muc2 and Muc3 significantly increased after cigarette
smoke exposure, whereas in the colon, an increased
expression of Muc4 was observed. In addition, inflamma-
tory gene expression is affected in the ileum and proximal
colon, with an increase of Cxcl2 and a decrease of Ifn-γ in
the ileum, and an increase in Il-6 and a decrease in Tgf-β
in the proximal colon. However, no changes in inflamma-
tory gene expression occurred in the distal colon. Also, no
changes in tight junction gene expression were detected
in response to CS exposure.
First, we studied the influence of CS exposure on the
bacterial community structure and activity in the mucosa
of different parts of the gut (ileum, caecum and distal
colon). Therefore, we applied two complementary
methods based on overlapping regions of the 16S rDNA

© 2015 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology
 Cigarette smoke induces shifts in the murine gut 5

Fig. 3. Heatmap with UPGMA clustering using the sparse patrimonial least squares discriminant analysis (sPLS-DA). The 40 most active
OTUs are displayed (ranked by sPLS-DA Xw score [X within], Liquet et al., 2012). The activity of OTU0010 (=Lachnospiraceae sp. according
to RDP9) is increased in the proximal and distal colon (571.74% and 300.76% change, respectively) of CS-exposed mice.

of bacteria: DGGE and Illumina sequencing. DGGE
analysis is a quick profiling technique and showed a shift
in the bacterial community structure in response to CS in
the caecum and distal colon, likewise paralleling a shift in
bacterial activity shown with Illumina sequencing. To date,
the effect of a subacute CS exposure of 4 weeks has been
investigated in a rat model showing a decrease of
Bifidobacterium sp. in the caecum in response to CS
(Tomoda et al., 2011). In a mouse model, 8 weeks of CS
exposure induced an increase in Clostridium sp. and a
decrease in the Firmicutes, Enterobacteriaceae sp. and
segmented filamentous bacteria (Wang et al., 2012).
There is a constant turnover of the microbiota in the gut,
rendering its composition vulnerable to short-term expo-
sure to environmental hazards. In our study, we assume
that 24 weeks of CS exposure induces a stable microbial
community, thereby modelling long-term cigarette smoke-
induced changes in the gut microbiota.
Second, we explored which bacterial species might be
susceptible to CS exposure. Analysis of our Illumina
sequencing data using the sPLS-DA allows detecting
changes in the activity of species groups through analysis

© 2015 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology
6 L. Allais et al.

Fig. 4. (A) mRNA expression of mucins in the ileum after air and smoke exposure, relative to the expression of two reference genes
[glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and hydroxymethylbilane synthase (HMBS)]. Expression of Muc2 and Muc3
significantly increases after smoke exposure (P = 0.039 and P = 0.0321 respectively). (B) Expression Muc4 significantly increased after smoke
exposure (P = 0.0274). mRNA expression of Muc4 increases in the distal colon after smoke exposure (P = 0.0274) relative to the expression
of two reference genes [glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and hydroxymethylbilane synthase (HMBS)]. (C) Expression of
CXCL2 significantly increases and IFN-γ significantly decreases after smoke exposure (P = 0.0186 and P = 0.0463, respectively), while IL-6
shows a nominal decrease (P = 0.068) and IL-1β is not significantly altered (P = 0.0983). (D) mRNA expression of inflammatory genes in the
proximal colon after air and smoke exposure. Expression of IL-6 significantly increases and TGF-β significantly decreases after smoke
exposure (P = 0.0209 and P = 0.0388 respectively). P-values lower than 0.05 were considered significant. Data are represented as
mean ± SEM. n = 6 in each group. *P < 0.05.

of cDNA. This analysis showed an increase in the activity
of Lachnospiraceae sp. in the proximal and distal colon of
smoke-exposed mice, but not in the ileum. It has been
shown previously that Lachnospiraceae sp. induces
monocyte/macrophage recruitment into the inflamed
colon, and thus triggers colitis upon disruption of the
colonic epithelial cell barrier function (Nakanishi et al.,
2014). This is in agreement with our findings that chronic
smoke exposure affects the gut immune system of
healthy mice by inducing the recruitment of immune cells
to the PPs and apoptosis and autophagy in the FAE
(Verschuere et al., 2011; 2012). In this way, CS exposure
may contribute to an increased risk for the creation of an
inflammatory environment, and combined with other
factors eventually may initiate IBD. Surprisingly, we could
not detect changes in tight junction gene expression,
although it has previously been reported that the
Clostridium XIVa cluster, which includes Lachnospiraceae
sp., strengthens the tight junctions and thereby the epi-
thelial barrier through the production of butyrate (Ma
et al., 2012). Another study reported an increase in tight
junction proteins claudin-3 and ZO-2 after 8 weeks of CS
exposure (Wang et al., 2012). According to our own
data, a long-term cigarette smoke exposure of 24
weeks no longer affects tight junction gene expression.
In the faeces of healthy human subjects, an increase
in Firmicutes and Actinobacteria and a decrease in
Bacteroidetes and Proteobacteria have been reported
after smoking cessation (Biedermann et al., 2013). A
study by Wang and colleagues has shown that 8 weeks
of CS exposure increased Clostridium sp., and decreased
the Firmicutes (Lactococcus sp. and Ruminococcus sp.),
Enterobacteriaceae sp. and segmented filamentous bac-
teria in the caecum (Wang et al., 2012). Although this

© 2015 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology

study suggests that Firmicutes, to which the
Lachnospiraceae sp. belongs, decreases due to smoking,
many other species groups determine changes in the
phylum besides the Lachnospiraceae sp. Also, we
exposed the mice to 24 weeks of CS, which is a long-term
exposure and sheds light on long-term changes in the
microbiota. In future experiments, it might be of interest to
monitor microbiota changes over time in response to CS
exposure.
A third important finding in this study was that smoking
is able to induce changes in mucin expression. Previous
studies have shown that smoking causes mucin
hypersecretion in the lung of patients suffering from
COPD (Di et al., 2012; Kim, 2012; Yu et al., 2012). The
major mucins in the intestine are MUC2, a secretable
mucin mainly produced and delivered to the lumen by
goblet cells, and MUC3, a cell surface mucin (Shirazi
et al., 2000; Hoebler et al., 2006; Linden et al., 2008).
MUC4 is a cell surface mucin that acts purely as an
anti-adhesive (Hattrup and Gendler, 2008). Here, we
showed that ileal expression of Muc2 and Muc3 increased
significantly upon CS exposure. In the distal colon, CS
caused an increase of Muc4 mRNA. Interestingly, quan-
titative changes in mucin secretion also occur in human
IBD (Boltin et al., 2013). The composition of the protective
mucin layer plays an important role in inhibiting direct
contact between the host and potentially offending bacte-
ria, and reducing the exposure time by increasing bacte-
rial transit. The changes in mucin expression that we
observed might either be a direct effect of the exposure to
the chemical components of CS or induced as a protec-
tion mechanism to counteract local physiological changes
in the gut. In addition, a shifting composition of mucolytic
organisms from A. muciniphila to other mucolytic species,
such as Ruminococcus gnavus, occurs in pathological
conditions, such as IBD, and may therefore be a suitable
biomarker for mucosal integrity (Png et al., 2010a; Berry
and Reinisch, 2013). However, to date, the mucin degra-
dation specificity of different Akkermansia species
remains unclear.
In addition, we found that inflammatory gene expres-
sion is altered in the ileum and proximal colon in response
to CS exposure, but not in the distal colon. We demon-
strated that ileal Cxcl2, a critical effector for neutrophil
trafficking, is increased by chronic CS exposure. In con-
trast, ileal Ifn-ɣ, involved in macrophage activation, is
decreased. Furthermore, we showed that proximal
colonic Il-6 was increased. Proximal colonic Tgf-β, being
involved in tempering the immune response, was
decreased. Surprisingly, expression of inflammatory
factors was not affected in the distal colon, although
smoke-induced changes in the microbiota occur in the
colon. The ileum contains important immune inductive
sites, such as the PPs, taking up antigens and generating
© 2015 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology
Cigarette smoke induces shifts in the murine gut 7
immune responses. This kind of immune inductive sites
are much less frequent in the colon, which makes it mainly
an effector site (lamina propria and surface epithelia) of
ileal-generated immune responses (Brandtzaeg and
Pabst, 2004). Wang et al. showed an inhibition of the
NFκB pathway, but no changes in the expression of
colonic Tnf-α and Il-6 after 8 weeks of CS exposure
(Wang et al., 2012). In our study, we did not observe any
changes in Nfκb expression; however, we showed that
colonic Il-6 was increased. Again, this might be due to the
long-term (24 weeks) effect of CS exposure in our own
experimental set-up.
Our data show that chronic CS exposure has a pro-
found effect on the gut microbiota, the associated mucin
composition and cytokine/chemokine production in mice,
which is likely to occur in human as well. Although the gut
microbial similarity between mice and humans at the
phylum level is remarkable, many differences exist at the
species level (Dethlefsen et al., 2007). Both in human and
C57BL6/J mice, the two most abundant phyla are the
Firmicutes and the Bacteroidetes; however, 85% of the
murine sequences represent species that have not been
detected in humans (Ley et al., 2005). Therefore, extrapo-
lation from mouse to man might be challenging due to the
heterogeneity of the human population. Nevertheless, the
use of a murine model offers the advantage of housing
in standardized conditions, minimizing environmental
influences.
Interestingly, our findings show that chronic CS expo-
sure affects the immune system in the ileum while it exerts
a more pronounced effect on the microbiota in the colon.
This may be partly explained by the much lower bacterial
load in the ileum compared with the colon. It is known that
smoking worsens CD, while UC is rather a disease of
ex-smokers (Ananthakrishnan, 2015). Inflammation in CD
mainly originates in the terminal ileum, whereas UC is
initiated in the colon. Taking all these facts together, it
might be that CS affects the ileum and colon via
distinct mechanisms, resulting in an even more distinct
outcome for inflammatory diseases as CD and UC. Given
our data, we speculate that cigarette smoke exposure
tends to affect the ileal immune system, which may give
rise to CD-related inflammation. In contrast, cigarette
smoke exposure targets the colonic microbiome rather
than its immune system. Moreover, the activity of
Lachnospiraceae sp., a butyrate producer, is increased in
response to CS exposure, which may contribute to the
smoke-induced protective effect on UC-related colonic
inflammation.
Today, the link between host (patho)physiology and
the gut microbiome is being increasingly recognized
(Arumugam et al., 2011; Elinav et al., 2011). In-depth
knowledge of the human bacterial ecosystem in relation to
disease might pave the way for the generation of
8 L. Allais et al.
customized therapeutics and probiotics. We hypothesize
that the induction of dysbiosis and the alteration of epi-
thelial mucus and cytokine/chemokine profiles by chronic
cigarette smoke exposure modulate the risk for the devel-
opment of inflammation-related disorders, such as IBD.
Further work in this field may contribute to the adaptation
of treatment strategies for IBD depending on smoking
behaviour. Future research exposing colitic mice to
chronic smoke exposure will be necessary to be able to
attribute a specific role of dysbiosis and mucus changes in
the development of disease.
Experimental procedures
Animals
Male C57BL/6 wild-type mice were purchased from Charles
River Laboratories and were co-housed in the same animal
facility before the start of the experiment to homogenize gut
microbiota between groups. All mice were 8–9 weeks old at
the start of the smoke exposure. Mice were housed in a
temperature-controlled room with a 12 h light and 12 h dark-
ness cycle and were given standardized food (Carfil,
Turnhout, Belgium) and water ad libitum. The mice were
divided in two cages per experimental group (n = 12) with six
mice per cage. The local ethics committee for animal experi-
mentation of the Faculty of Medicine and Health Sciences
(Ghent, Belgium) approved all experiments (ECD 27/07).
Cigarette smoke exposure
Mice were exposed to mainstream cigarette smoke, as
described previously (D’Hulst et al., 2005). Briefly, groups of
12 mice were exposed to the tobacco smoke of 20 cigarettes
(Reference Cigarette 3R4F without filter; University of Ken-
tucky, Lexington, KY, USA). The exposure to five cigarettes
was applied for 7 min, with 30 min smoke-free intervals,
which was repeated four times a day, 5 days per week for 24
weeks (chronic smoke exposure). An optimal smoke : air
ratio of 1:6 was obtained. The control groups were exposed to
air. Carboxyhaemoglobin in serum of smoke-exposed mice
reached a non-toxic level of 8.7 ± 0.31% (compared with
0.65 ± 0.25% in air-exposed mice), which is similar to
carboxyhaemoglobin blood concentrations of human
smokers (Macdonald et al., 2004).
Staining methods
Paraffin-embedded tissue sections of 4 μm taken from
ileum and distal colon were de-waxed and re-hydrated. The
sections were stained with either AB/PAS, in which AB
stains blue for secretable mucins and PAS stains purple-
pink for cell surface mucins, or with HID/AB, in which
sulfated mucins are stained dark brown by HID and
sialylated mucins are stained blue by AB. In case of the
AB/PAS staining method, slides were stained using the PAS
Staining Kit and AB for PAS Staining Kit on the automated
Ventana system (Roche Diagnostics, Vilvoorde, Belgium).
Slides were immersed in the AB solution for 5 min before
© 2015 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology
incubation in 1% aqueous periodic acid for 5 min. Slides
were then washed in distilled water and immersed in
Schiff’s reagent for 15 min. In case of the HID/AB
staining method, slides were treated with diamine solu-
tion (N,N-dimethyl-meta-phenylenediamine-dihydrochloride;
N,N-dimethyl-para-phenylene-diamine-dihydrochloride; ferric
chloride 60% solution and distilled water) for 24 h at room
temperature. After incubation, slides were washed and
counterstained in 1% AB solution for 5 min. Finally, sections
from both staining methods were dehydrated in absolute
alcohol, cleared in three changes of xylene and mounted.
Scoring of microscopic analysis
Histological and goblet cell assessment was performed using
light microscopy. For 10 AB/PAS-stained sections per group,
positively stained goblet cells were counted in two regions of
10 aligning longitudinal crypts. For 10 HID/AB-stained sec-
tions per group, sulfomucin-positive stained goblet cells were
counted in two regions of 10 aligning longitudinal crypts.
Histological assessments were carried out in a blinded
fashion.
Quantitative real-time polymerase chain reaction
(qRT-PCR)
RNA from ileum and distal colon (both were taken from 10
smoke- and 10 air-exposed mice) was extracted using the
Qiagen miRNeasy Mini Kit (Qiagen, Hilden, Germany). Sub-
sequently, cDNA was synthesized by reverse transcription
using the iScript™ cDNA synthesis kit (Bio-Rad Laboratories,
Nazareth, Belgium) following the manufacturer’s instructions.
Expression of target genes Muc1, Muc2, Muc3, Muc4, Cxcl2,
I1-1β, I1-6, Ifn-γ, Tnf-α, Il-10, Nfκb, Tgfb1, Ctnb1, Cldb-4,
Ocln and Cdh1, and reference genes glyceraldehyde-3-
phosphate dehydrogenase (GAPDH) and hydroxymethyl-
bilane synthase (HMBS) (Table 1), was analysed by
qRT-PCR using the SensiMix™ SYBR No-ROX Kit (Bioline,
London, UK). The qRT-PCR was performed on a
LightCycler480 detection system (Roche Diagnostics) with
the following cycling conditions: 10 min incubation at 95°C,
45 cycles of 95°C for 10 s and 60°C for 1 min. Melting curve
analysis confirmed primer specificity. The PCR efficiency of
each primer pair was calculated using a standard curve from
reference cDNA. The amplification efficiency was determined
using the formula 10−1/SLOPE − 1.
DGGE
The ileal and colonic samples of 12 smoke- and 12 air-
exposed mice were obtained snap-frozen and stored at
−80°C. The 16S rRNA genes for all bacteria were amplified by
PCR adding a GC-clamp of 40 bp. The DGGE was performed
using the INGENYPHORU System (Ingeny International BV,
The Netherlands), after which PCR fragments were loaded
onto 8% (w/v) polyacrylamide gels containing 40–60% dena-
turing gradients (Muyzer et al., 1993; Ovreas et al., 1997). To
process and compare the different gels, an in-house devel-
oped marker of different PCR fragments was loaded on each
gel (Boon et al., 2002).
 Cigarette smoke induces shifts in the murine gut 9
Table 1. Mouse primer sequences qRT-PCR.

Gene symbol Accession number Forward primer (5′-3′) Reverse primer (3′-5′) Effic R2

Hmbs NM_001110251 AAGGGCTTTTCTGAGGCACC AGTTGCCCATCTTTCATCACTG 99 0.99

Gapdh NM_008084 CATGGCCTTCCGTGTTCCTA GCGGCACGTCAGATCCA 106 0.9986
Muc1* NM_013605 GCAGTCCTCAGTGGCACCTC CACCGTGGGCTACTGGAGAG 105 0.99
Muc2 NM_023566 CAAGGGCTCGGAACTCCAG CCAGGGAATCGGTAGACATCG 97 0.92
Muc3* XM_355711 CGTGGTCAACTGCGAGAATGG CGGCTCTATCTCTACGCTCTCC 104 0.94
Muc4* AF520422 CAGCAGCCAGTGGGGACAG CTCAGACACAGCCAGGGAACTC 110 0.96
Cxcl2 NM_009140 GCGCCCAGACAGAAGTCATAG AGCCTTGCCTTTGTTCAGTATC 89,2 0.99
Il-1β NM_000576 CACGATGCACCTGTACGATCA GTTGCTCCATATCCTGTCCCT 97 0.9987
Tnf-α NM_013693 ATGAGCACTGAAAGCATGATCC GAGGGCTGATTAGAGAGAGGTC 92 0.9761
Il-10 NM_010548 GGTGTCCTTTCAATTGCTCTCAT TCACAACTCTCTTAGGAGCTCTGAACT 90 0.9974
Nfκb NM_023526 GAAGGGCGTGTTTGACAAGGA GCATCCCGAACAAGAGACAGAAT 93 0.9957
Tgfb1 NM_011577 CTCCCGTGGCTTCTAGTGC GCCTTAGTTTGGACAGGATCTG 87 0.9828
Ctnb1 NM_001165902.1 TCACATTTGAGAAGCGATCCTAC TCCAGCTCGGATTCCATGAAC 89 0.9971
Cldn-4 NM_009903.2 AGCCTTCCAGGTCCTCAACT AGCAGCGAGTAGAAG 195 0.9975
Ocln NM_008756.2 ACAGACTACACAACTGGCGG TCATCAGCAGCAGCCATGTA 101 0.9991
Cdh1 NM_009864.2 TTACTGCCCCCAGAGGATGA TGCAACGTCGTTACGAGTCA 195 0,9957
Ifng NM_008337 GCCAAGCGGCTGACTGA TCAGTGAAGTAAAGGTACAAGCTACAATCT 197 0,9635

*Primer sequences were adapted from Hoebler and colleagues (2006).

The normalization and analysis of DGGE gel patterns were
done with the BIONUMERICS software 5.10 (Applied Maths,
Sint-Martens-Latem, Belgium). During this processing, the
different lanes were defined, background was subtracted,
differences in the intensity of the lanes were compensated
during normalization, and bands and band classes were
detected.
Illumina sequencing
Illumina sequencing was performed on amplicons from cDNA
extracted from snap-frozen gut tissue samples of six smoke-
and six air-exposed mice. Sequencing was performed on
cDNA, which was synthesized from extracted RNA. Using
random primers for the cDNA synthesis, 16S rRNA was also
translated into cDNA, which made the samples suitable for
16S sequencing. The MicroRneasy Mini Kit (Qiagen) was
used for RNA extraction, for which the manufacturer ensures
high-purity RNA. When measuring samples using a
NanoDrop after RNA extraction, high concentrations (500–
1000 ng μl−1) were obtained and 260/280 nm ratios were all
close to 2, which indicates good RNA quality. Quality and
concentrations were similar for samples of different gut parts.
The sequencing was performed by LGC Genomics (Berlin,
Germany). The raw flowgrams were processed and analysed
in an in-house MOTHUR (Schloss et al., 2009) (http://
www.mothur.org, version 1.26.0) and R (http://www.r
-project.org/ version 2.15.1)/Sweave pipeline. Sequencing
error was reduced using the MOTHUR implementation of the
SeqNoise algorithm (Quince et al., 2011). Alignment with the
SILVA 16S reference (Pruesse et al., 2007) was performed
and sequences were trimmed to overlap in the same align-
ment space. Chimeric sequences were removed using
Uchime (Edgar et al., 2011). A Bayesian classifier was used
with the ribosomal database project (RDP) training set (Cole
et al., 2009) of RDP release 9 (http://rdp.cme.msu.edu/) to
classify the sequences. Unique sequences were then clus-
tered into 904 OTUs with a 97% sequence identity threshold,
with subsequent classification using the RDP release 9 into
904 classified OTUs at the 85% bootstrap cut-off.
Statistical analysis
Reported gene expression values are expressed as
mean ± standard error of the mean (SEM) and error bars
depict the SEM. Statistical analysis was performed by SPSS
21 Software (SPSS 21, Chicago, IL, USA) using Student’s
t-test for normally distributed populations, and Mann–
Whitney U-test for populations where normal distribution was
not accomplished. A P-value of less than 0.05 was consid-
ered significant.
Clustering of DGGE data was done based on the
abundance-based Jaccard index (with fuzzy logic) or the Yue
and Claytons theta index, and the UPGMA. Similarities and
abundances were extracted from the software, and statistical
analysis was performed using R version 2.15.1. P-values
were calculated using permutation-based MANOVA
(vegan::Adonis).
For β-diversity statistics on the Illumina sequencing data,
we applied the sPLS-DA method with two-factor design and
ad hoc optimization from the MixOmics package, considering
ileum, caecum and distal colon originating from the same
mouse as paired samples. The sPLS-DA is a combined mul-
tilevel and multivariate method and distinguishes between
within-sample and between-sample variation, after which the
discriminant analysis is executed on the between-sample
variation. We applied this method to identify the abundance of
specific OTUs in each separate intestinal region. An ad hoc
estimation procedure is used to include only the statistically
relevant OTUs. Applying tuning parameter two, the relevant
OTUs were selected in order to model the data into three
sPLS-DA components (Liquet et al., 2012).
Acknowledgements
We thank the FLAMES statistical centre for advice in our
statistical analyses. We are grateful to Dorothea van

© 2015 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology
10 L. Allais et al.
Limbergen, Ran Rumes and Lynn Supply for the support with
the animal experiments and the processing of the samples,
and Eliane Castrique, Christelle Snauwaert, Marie-Rose
Mouton, Katleen de Saedeleer, Anouk Goethals, Ann
Neesen, Indra de Borle, Evelyn Spruyt and Greet Barbier for
the excellent technical support with the animal experiments.
We thank Tim Lacoere, Siska Maertens and Lois Maignien
from LabMET for the support with the DGGE and Illumina
sequencing. This work was supported by the Special
Research Fund of Ghent University (01D41012), the Con-
certed Research Actions of Ghent University (BOF09/GOA/
005, BOF10/GOA/021 and BOF12/GOA/008) and the
Interuniversity Attraction Poles Program (IUAP, P7/30).
Liesbeth Allais is supported by a doctoral grant from the
Special Research Fund of Ghent University (01D41012).
Frederiek-Maarten Kerckhof is supported by a doctoral grant
from the Concerted Research Actions of Ghent University
(BOF09/GOA/005). Ken R. Bracke is a postdoctoral
researcher of the Fund for Scientific Research Flanders
(FWO Vlaanderen). No author has an ethical or financial
conflict of interest.
References
Ananthakrishnan, A.N. (2013) Environmental risk factors for
inflammatory bowel disease. Gastroenterol Hepatol (N Y)
9: 367–374.
Ananthakrishnan, A.N. (2015) Environmental risk factors for
inflammatory bowel diseases: a review. Dig Dis Sci 60:
290–298.
Arcavi, L., and Benowitz, N.L. (2004) Cigarette smoking and
infection. Arch Intern Med 164: 2206–2216.
Arumugam, M., Raes, J., Pelletier, E., Le Paslier, D.,
Yamada, T., Mende, D.R., et al. (2011) Enterotypes of the
human gut microbiome. Nature 473: 174–180.
Berry, D., and Reinisch, W. (2013) Intestinal microbiota: a
source of novel biomarkers in inflammatory bowel dis-
eases? Best Pract Res Clin Gastroenterol 27: 47–58.
Biedermann, L., Zeitz, J., Mwinyi, J., Sutter-Minder, E.,
Rehman, A., Ott, S.J., et al. (2013) Smoking cessation
induces profound changes in the composition of the intes-
tinal microbiota in humans. PLoS ONE 8: e59260.
Boltin, D., Perets, T.T., Vilkin, A., and Niv, Y. (2013) Mucin
function in inflammatory bowel disease: an update. J Clin
Gastroenterol 47: 106–111.
Boon, N., De Windt, W., Verstraete, W., and Top, E.M. (2002)
Evaluation of nested PCR-DGGE (denaturing gradient gel
electrophoresis) with group-specific 16S rRNA primers for
the analysis of bacterial communities from different waste-
water treatment plants. FEMS Microbiol Ecol 39: 101–112.
Brandtzaeg, P., and Pabst, R. (2004) Let’s go mucosal: com-
munication on slippery ground. Trends Immunol 25: 570–
577.
Carbonnel, F., Jantchou, P., Monnet, E., and Cosnes, J.
(2009) Environmental risk factors in Crohn’s disease and
ulcerative colitis: an update. Gastroenterol Clin Biol 33
(Suppl. 3): S145–S157.
Cole, J.R., Wang, Q., Cardenas, E., Fish, J., Chai, B., Farris,
R.J., et al. (2009) The Ribosomal Database Project:
improved alignments and new tools for rRNA analysis.
Nucleic Acids Res 37: D141–D145.
© 2015 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology
Dethlefsen, L., McFall-Ngai, M., and Relman, D.A. (2007) An
ecological and evolutionary perspective on human-microbe
mutualism and disease. Nature 449: 811–818.
D’Hulst, A.I., Vermaelen, K.Y., Brusselle, G.G., Joos, G.F.,
and Pauwels, R.A. (2005) Time course of cigarette smoke-
induced pulmonary inflammation in mice. Eur Respir J 26:
204–213.
Di, Y.P., Zhao, J., and Harper, R. (2012) Cigarette smoke
induces MUC5AC protein expression through the activa-
tion of Sp1. J Biol Chem 287: 27948–27958.
Edgar, R.C., Haas, B.J., Clemente, J.C., Quince, C., and
Knight, R. (2011) UCHIME improves sensitivity and speed
of chimera detection. Bioinformatics 27: 2194–2200.
Elinav, E., Strowig, T., Kau, A.L., Henao-Mejia, J., Thaiss,
C.A., Booth, C.J., et al. (2011) NLRP6 inflammasome regu-
lates colonic microbial ecology and risk for colitis. Cell 145:
745–757.
Erickson, A.R., Cantarel, B.L., Lamendella, R., Darzi, Y.,
Mongodin, E.F., Pan, C., et al. (2012) Integrated
metagenomics/metaproteomics reveals human host-
microbiota signatures of Crohn’s disease. PLoS ONE 7:
e49138.
Frank, D.N., St Amand, A.L., Feldman, R.A., Boedeker, E.C.,
Harpaz, N., and Pace, N.R. (2007) Molecular-phylogenetic
characterization of microbial community imbalances in
human inflammatory bowel diseases. Proc Natl Acad Sci
USA 104: 13780–13785.
Garmendia, J., Morey, P., and Bengoechea, J.A. (2012)
Impact of cigarette smoke exposure on host-bacterial
pathogen interactions. Eur Respir J 39: 467–477.
Hattrup, C.L., and Gendler, S.J. (2008) Structure and function
of the cell surface (tethered) mucins. Annu Rev Physiol 70:
431–457.
Hoebler, C., Gaudier, E., De Coppet, P., Rival, M., and
Cherbut, C. (2006) MUC genes are differently expressed
during onset and maintenance of inflammation in dextran
sodium sulfate-treated mice. Dig Dis Sci 51: 381–389.
Hovde, O., and Moum, B.A. (2012) Epidemiology and clinical
course of Crohn’s disease: results from observational
studies. World J Gastroenterol 18: 1723–1731.
Jin, Y., Lin, Y., Lin, L., and Zheng, C. (2012) IL-17/IFN-gamma
interactions regulate intestinal inflammation in TNBS-
induced acute colitis. J Interferon Cytokine Res 32: 548–
556.
Johansson, M.E. (2014) Mucus layers in inflammatory bowel
disease. Inflamm Bowel Dis 20: 2124–2131.
Khan, W.I., and Collins, S.M. (2006) Gut motor function:
immunological control in enteric infection and inflamma-
tion. Clin Exp Immunol 143: 389–397.
Kim, K.C. (2012) Role of epithelial mucins during airway
infection. Pulm Pharmacol Ther 25: 415–419.
Lakatos, P.L. (2006) Recent trends in the epidemiology of
inflammatory bowel diseases: up or down? World J
Gastroenterol 12: 6102–6108.
Ley, R.E., Backhed, F., Turnbaugh, P., Lozupone, C.A.,
Knight, R.D., and Gordon, J.I. (2005) Obesity alters gut
microbial ecology. Proc Natl Acad Sci USA 102: 11070–
11075.
Linden, S.K., Florin, T.H., and McGuckin, M.A. (2008) Mucin
dynamics in intestinal bacterial infection. PLoS ONE 3:
e3952.

Liquet, B., Le Cao, K.A., Hocini, H., and Thiebaut, R. (2012)
A novel approach for biomarker selection and the integra-
tion of repeated measures experiments from two assays.
BMC Bioinformatics 13: 325.
Loftus, E.V. (2004) Clinical epidemiology of inflammatory
bowel disease: incidence, prevalence, and environmental
influences. Gastroenterology 126: 1504–1517.
Ma, X., Fan, P.X., Li, L.S., Qiao, S.Y., Zhang, G.L., and Li,
D.F. (2012) Butyrate promotes the recovering of intestinal
wound healing through its positive effect on the tight junc-
tions. J Anim Sci 90 (Suppl. 4): 266–268.
Macdonald, G., Kondor, N., Yousefi, V., Green, A., Wong, F.,
and Aquino-Parsons, C. (2004) Reduction of
carboxyhaemoglobin levels in the venous blood of ciga-
rette smokers following the administration of carbogen.
Radiother Oncol 73: 367–371.
Manichanh, C., Rigottier-Gois, L., Bonnaud, E., Gloux, K.,
Pelletier, E., Frangeul, L., et al. (2006) Reduced diversity of
faecal microbiota in Crohn’s disease revealed by a
metagenomic approach. Gut 55: 205–211.
Muyzer, G., Dewaal, E.C., and Uitterlinden, A.G. (1993) Pro-
filing of complex microbial-populations by denaturing gra-
dient gel-electrophoresis analysis of polymerase chain
reaction-amplified genes-coding for 16S ribosomal-RNA.
Appl Environ Microbiol 59: 695–700.
Nakanishi, Y., Sato, T., and Ohteki, T. (2014) Commensal
Gram-positive bacteria initiates colitis by inducing
monocyte/macrophage mobilization. Mucosal Immunol 8:
152–160.
Ovreas, L., Forney, L., Daae, F.L., and Torsvik, V. (1997)
Distribution of bacterioplankton in meromictic Lake
Saelenvannet, as determined by denaturing gradient gel
electrophoresis of PCR-amplified gene fragments coding
for 16S rRNA. Appl Environ Microbiol 63: 3367–3373.
Persson, P.G., Ahlbom, A., and Hellers, G. (1990) Inflamma-
tory bowel disease and tobacco smoke–a case-control
study. Gut 31: 1377–1381.
Png, C.W., Linden, S.K., Gilshenan, K.S., Zoetendal, E.G.,
McSweeney, C.S., Sly, L.I., et al. (2010a) Mucolytic bacte-
ria with increased prevalence in IBD mucosa augment in
vitro utilization of mucin by other bacteria. Am J
Gastroenterol 105: 2420–2428.
Png, C.W., Linden, S.K., Gilshenan, K.S., Zoetendal, E.G.,
McSweeney, C.S., Sly, L.I., et al. (2010b) Mucolytic bacte-
ria with increased prevalence in IBD mucosa augment in
vitro utilization of mucin by other bacteria. Am J
Gastroenterol 105: 2420–2428.
Pruesse, E., Quast, C., Knittel, K., Fuchs, B.M., Ludwig,
W.G., Peplies, J., and Glockner, F.O. (2007) SILVA: a com-
prehensive online resource for quality checked and aligned
ribosomal RNA sequence data compatible with ARB.
Nucleic Acids Res 35: 7188–7196.
Quince, C., Lanzen, A., Davenport, R.J., and Turnbaugh, P.J.
(2011) Removing noise from pyrosequenced amplicons.
BMC Bioinformatics 12: 38.
Rogers, M.A., Greene, M.T., Saint, S., Chenoweth, C.E.,
Malani, P.N., Trivedi, I., and Aronoff, D.M. (2012) Higher
rates of Clostridium difficile infection among smokers.
PLoS ONE 7: e42091.
Rolli, J., Loukili, N., Levrand, S., Rosenblatt-Velin, N.,
Rignault-Clerc, S., Waeber, B., et al. (2010) Bacterial
© 2015 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology
Cigarette smoke induces shifts in the murine gut 11
flagellin elicits widespread innate immune defense mecha-
nisms, apoptotic signaling, and a sepsis-like systemic
inflammatory response in mice. Crit Care 14: R160.
Round, J.L., and Mazmanian, S.K. (2009) The gut microbiota
shapes intestinal immune responses during health and
disease. Nat Rev Immunol 9: 313–323.
Round, J.L., O’Connell, R.M., and Mazmanian, S.K. (2010)
Coordination of tolerogenic immune responses by the com-
mensal microbiota. J Autoimmun 34: J220–J225.
Schloss, P.D., Westcott, S.L., Ryabin, T., Hall, J.R.,
Hartmann, M., Hollister, E.B., et al. (2009) Introducing
Mothur: open-source, platform-independent, community-
supported software for describing and comparing microbial
communities. Appl Environ Microbiol 75: 7537–7541.
Shirazi, T., Longman, R.J., Corfield, A.P., and Probert, C.S.
(2000) Mucins and inflammatory bowel disease. Postgrad
Med J 76: 473–478.
Stecher, B., Maier, L., and Hardt, W.D. (2013) ‘Blooming’ in
the gut: how dysbiosis might contribute to pathogen evo-
lution. Nat Rev Microbiol 11: 277–284.
Strober, W., Fuss, I., and Mannon, P. (2007) The fundamental
basis of inflammatory bowel disease. J Clin Invest 117:
514–521.
Tomoda, K., Kubo, K., Asahara, T., Andoh, A., Nomoto, K.,
Nishii, Y., et al. (2011) Cigarette smoke decreases organic
acids levels and population of bifidobacterium in the
caecum of rats. J Toxicol Sci 36: 261–266.
Verschuere, S., Bracke, K.R., Demoor, T., Plantinga, M.,
Verbrugghe, P., Ferdinande, L., et al. (2011) Cigarette
smoking alters epithelial apoptosis and immune composi-
tion in murine GALT. Lab Invest 91: 1056–1067.
Verschuere, S., Allais, L., Bracke, K.R., Lippens, S.,
De Smet, R., Vandenabeele, P., et al. (2012) Cigarette
smoke and the terminal ileum: increased autophagy in
murine follicle-associated epithelium and Peyer’s patches.
Histochem Cell Biol 137: 293–301.
Wang, H., Zhao, J.X., Hu, N., Ren, J., Du, M., and Zhu, M.J.
(2012) Side-stream smoking reduces intestinal inflamma-
tion and increases expression of tight junction proteins.
World J Gastroenterol 18: 2180–2187.
Xavier, R.J., and Podolsky, D.K. (2007) Unravelling the
pathogenesis of inflammatory bowel disease. Nature 448:
427–434.
Yu, H., Li, Q., Kolosov, V.P., Perelman, J.M., and Zhou, X.
(2012) Regulation of cigarette smoke-mediated mucin
expression by hypoxia-inducible factor-1alpha via epider-
mal growth factor receptor-mediated signaling pathways.
J Appl Toxicol 32: 282–292.
Supporting information
Additional Supporting Information may be found in the online
version of this article at the publisher’s web-site:
Fig. S1. Agglomerative nesting clustering dendrograms
using the abundance-based Yue and Clayton’s θ based on
the DGGE data with average linkage (UPGMA), normalized
in BIONUMERICS 5.10 software. (A) clustering dendrogram for
ileum, (B) clustering dendrogram for caecum and (C) cluster-
ing dendrograms for distal colon. SM, smoking; NSM, non-
smoking; DC, distal colon; IL, ileum; CC, caecum.
12 L. Allais et al.
Fig. S2. (A) mRNA expression of TNF-α, IL-10, NFκB and
TGF-β in the ileum after air and smoke exposure, relative to
the expression of two reference genes [glyceraldehyde-3-
phosphate dehydrogenase (GAPDH) and hydroxymethyl-
bilane synthase (HMBS)]. (B) mRNA expression of IL-10,
NFκB, IFN-γ, CXCL2, IL-1β and TNF-α in the proximal colon
after air and smoke exposure. (C) mRNA expression of
CXCL2, IL-1β, IL-6 and IFN-γ in the distal colon after air and
smoke exposure. (D) mRNA expression of TNF-α, IL-10,
NFκB and IFN-γ in the distal colon after air and smoke
© 2015 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology
exposure. Data are represented as mean ± SEM; n = 6 in
each group.
Fig. S3. mRNA expression of tight junction genes in the
ileum, proximal and distal colon after air and smoke expo-
sure, relative to the expression of two reference genes
[glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and
hydroxymethylbilane synthase (HMBS)]. Data are repre-
sented as mean ± SEM; n = 6 in each group.
Appendix. Raw Illumina sequencing data, containing OTU
table and LefSe data.