European Journal of Medicinal Chemistry 183 (2019) 111695

Contents lists available at ScienceDirect

European Journal of Medicinal Chemistry

journal homepage: http://www.elsevier.com/locate/ejmech

Research paper

Design, synthesis and biological evaluation of cinnamic acid

derivatives with synergetic neuroprotection and angiogenesis effect
Wen-Xi Zhang, Hui Wang, He-Rong Cui, Wen-Bo Guo, Fei Zhou, De-Sheng Cai, Bing Xu,
Xiao-Hui Jia, Xue-Mei Huang, Yu-Qin Yang, Hong-Shan Chen, Jin-Chai Qi,
Peng-Long Wang**, Hai-Min Lei*
School of Chinese Pharmacy, Beijing University of Chinese Medicine, Beijing, 100102, China

a r t i c l e i n f o a b s t r a c t

Article history: As for complex brain diseases involved with multiple pathogenic factors, it is extremely difficult to
Received 1 August 2019 achieve curative effect by acting on a single target. Multi-approach drugs provide a promising prospect in
Received in revised form the treatment of complex brain diseases and have been attracting more and more interest. Enlightened
9 September 2019
by synergetic effect of combination in traditional herb medicines, forty-two novel cinnamic acid de-
Accepted 10 September 2019
Available online 13 September 2019
rivatives were designed and synthesized by introducing capsaicin and/or ligustrazine moieties to
enhance biological activities in both neurological function and neurovascular protection. Elevated levels
of cell viability on human brain microvascular endothelium cell line (HBMEC-2) and human neuro-
Keywords:
Cinnamic acids
blastoma cell line (SH-SY5Y) against free radical injury were observed in most of compounds. Among
Brain injury them, compound 14a exhibited the most potent activities with a significant EC50 value of 3.26 ± 0.16 mM
Neuroprotective (HBMEC-2) and 2.41 ± 0.10 mM (SH-SY5Y). Subsequently, the results of morphological staining and flow
Angiogenesis cytometry analysis experiments on both cell lines showed that 14a had the potential to block apoptosis,
Dual effects maintain cell morphological integrity and protect physiological function of mitochondria. Moreover, 14a
displayed specific angiogenesis effect in the chick chorioallantoic membrane (CAM) assay; and the results
of RT-PCR suggested that the mechanism for angiogenesis effect was associated with the enhancement of
the expressions of VEGFR2 mRNA in chick embryo. Preliminary structure-activity relationship was
analyzed. The above evidences suggested that conjunctures gained by combining active ingredients in
traditional herb medicines deserved further study and might provide references in discovering dual-
effective lead compounds for brain diseases.
© 2019 Elsevier Masson SAS. All rights reserved.

1. Introduction strategies such as antioxidants, anti-apoptotic agents, ROS scav-

The consequence of diverse brain injury is one of the leading
health issues globally characterized by high morbidity and
disability [1], and it may induce various lethal diseases. Among
these, ischemic stroke has become a major brain disease causing
substantial medical health burdens [2]. The pathogenesis of
ischemic stroke is complex, involving with multiple signaling
pathway damage and various pathological processes such as
oxidative stress, apoptosis, inflammation and excitotoxicity, all of
which interacting with multiple mechanisms, triggering each other,
and eventually leading to neuronal apoptosis [3e5]. Therapeutic
* Corresponding author.
** Corresponding author.
E-mail addresses: wpl581@126.com (P.-L. Wang), hm_lei@126.com (H.-M. Lei).
engers have been intriguing research areas [6e8]. Despite the
remarkable progress achieved in theory, the therapeutic drugs
clinically have not achieved satisfactory efficiency until now. As for
complex brain diseases involved with multiple pathogenic factors,
it is extremely difficult to achieve curative effect by acting on a
single target [9].
For several decades, most therapeutic concepts for stroke
treatment were focused on neuroprotection [10]. Nowadays, re-
searchers suggest that new vessel formation after ischemic stroke
not only increases oxygen and nutrient supply to the affected tis-
sue, but also promotes nerve recovery processes, including nerve
regeneration and synaptogenesis, which in turn lead to the
improvement of functional recovery [11e13]. After a stroke in the
peri-infarct cortex, the neurogenesis and migration of newly born
neurons are extensively associated with angiogenesis. Angiogenic

https://doi.org/10.1016/j.ejmech.2019.111695
0223-5234/© 2019 Elsevier Masson SAS. All rights reserved.
2 W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695

vessels provide neurotrophic support to newly generated neurons multifunctional drug for ischemic stroke therapy in China for many
[14]. It has been reported that higher microvessel density in the years [38,39]. More interestingly, classical Chinese herbal pre-
ischemic border indeed correlates with longer survival in stroke scriptions such as Buyang Huanwu Decoction (BHD), Danggui-
patients [15]. Promoting angiogenesis to establish a new vascular Shaoyao-San (DSS) have been proved to be capable to create
system rapidly after ischemic stroke is beneficial to salvage pharmacological superposition effects, actually their main active
potentially reversible ischemic tissue (ischemic penumbra) and to ingredients included ligustrazine, cinnamic acid and some of its
improve nerve function [16,17]. The coupling of angiogenesis and derivatives [40,41].
neuroprotection provides a new approach for the drug design. Inspired by biological characteristics of them, we introduced
Indeed, recent experimental therapies have attempted to capitalize ligustrazine and/or capsaicin moieties into cinnamic acids to
the combination of neuroprotective agents and pro-angiogenic enhance biological activities and obtain additive or synergistic ef-
drugs to promote recovery of brain diseases [18]. fects. The drug design was illuminated as shown in Fig. 1. All of the
As therapies modulating single target seem not to provide designed forty-two targeted derivatives were synthesized and
satisfied benefits clinically because of the complexity of brain dis- characterized by 1H NMR, 13C NMR and HR-MS analysis in this
eases, combination therapies using various agents to confer multi- study. Their neuroprotective effects and angiogenic activities were
effects have been attracting increasing attention [19,20]. Re- assessed in vitro/in vivo.
searches have shown that the combination of drugs that differ in
mode of action could provide pleiotropic effects and yield further
2. Results and discussion
improvement in the treatment of complex brain diseases [21,22].
Structure modification based on “combination principle” to find
2.1. Chemical synthesis
multi-approach and multi-functional drugs with synergic effects
from active ingredients of traditional medicines has been regarded
The synthetic routes for all the designed forty-two targeted
to be a promising strategy and will inevitably become a focus in
derivatives were depicted in Schemes 1e4. Firstly, the 3,5,6-
short future [23,24].
trimethylpyrazine-2-chloride (TMP-Cl) was synthesized according
For more than a decade, our lab have focused on phenolic acid,
to our previous study (Scheme 1) [42].
tyramine and pyrazine ingredients to discover lead compounds
As shown in Scheme 2-method a, Compounds 1a-16a were
with multi-categories from traditional medicines [25e29]. For
synthesized through the combination of different substituted cin-
example, cinnamic acid and some of its derivatives (e.g. ferulic acid)
namic acids and vanilla amide part of capsaicin under catalyzed by
are major active phenolic acid components exist widely in tradi-
1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride
tional herb medicines such as Radix Angelica, Radix scrophulariae,
(EDCI), N-hydroxybenzotrizole (HOBT) and N, N-diisopropyl eth-
Ligustrazine Chuangxiong Hort, which attained an extensive use in
ylamine (DIEPA) in anhydrous Dimethyl Formamide (DMF). To
clinical treatment of ischemic stroke [30]. Cinnamic acids present
protect the carboxyl groups of cinnamic acid, methyl-esterification
various pharmacological activities including antioxidant, neuro-
was firstly performed and then deprotection was performed under
protection, antithrombosis, angiogenesis and vascular protection
alkaline conditions to afford compounds 2b-6b (Scheme 3). Then
capacity [31e33]. Clinical drugs for treatment of cerebrovascular
according to whether cinnamic acid contains phenolic hydroxyl
diseases such as Ozagrel, cinepazide also contain the structure of
groups, we used different synthetic routes to combine TMP-Cl with
cinnamic acids (Fig. 1). Cinnamic acids have become a research
the above-mentioned 1a-16a compounds through different
focus in structural modification for its drug-like properties and
conjunct sites. Compounds 1c, 7c-16c were obtained by coupling
biological characteristics; introduction of active phytochemical
1a, 7a-16a with TMP-Cl under catalyzed by K2CO3 in anhydrous
moieties offers the potential to exert additive or synergistic effects
DMF directly (Scheme 2-method b). As compounds 2a-6a contain
to find multi-effective novel derivatives. Meanwhile, capsaicin, is
also a neuroprotective tyramine component derived from Capsicum
annuum [34]. As a TRPV1 receptor agonist, capsaicin exhibits sig-
nificant neuroprotectant effect and its vanilla amide part has been
demonstrated to be the critical structure to exert bioactivities
[35e37]. Ligustrazine (2,3,5,6-tetramethylpyrazine, TMP), one of
the major effective pyrazine component of traditional herb medi- Scheme 1. Synthesis of 3,5,6-trimethylpyrazine-2-chloride. Reagents and Conditions:
cine Ligustrazine Chuangxiong Hort, has been widely used as a (a) NCS, BPO, CCl4, high-light, 85
C, 3 h.

Fig. 1. Design of cinnamic acid-capsaicin-ligustrazine derivatives.

 W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695 3

Scheme 2. Synthesis of 1a-16a, 1c, 7c-16c, 2d-6d. Reagents and Conditions: (a) EDCI, DIEPA, Hobt, DMF, room temperature, 4 h; (b) 3,5,6-trimethylpyrazine-2-chloride, K2CO3, DMF,
80
C, 4 h; (c) 3,5,6-trimethylpyrazine-2-chloride, K2CO3, DMF, 85
C, 6 h.

Scheme 3. Synthesis of 2b-6b. Reagents and Conditions: (a) MeOH, SoCl2, room temperature, 1 h; (b) K2CO3, DMF, 80
C,3 h; (c) THF-MeOH-H2O (3:1:1), NaOH (10%), 60
C, 2 h; (d)
EDCI, DIEPA, Hobt, DMF, room temperature, 4 h.

Scheme 4. Synthesis of 2c-6c. Reagents and Conditions: (a) Boc2O, Et3N, MeOH, room temperature, 1 h; (b) 3,5,6-trimethylpyrazine-2-chloride, K2CO3, DMF, 80
C, 2 h; (c) TFA (20%),
CH2Cl2, room temperature, 1 h; (d) EDCI, DIEPA, Hobt, DMF, room temperature, 4 h.

phenolic hydroxyl groups, we firstly introduced (Boc)2O to protect
the amino group on the vanilla amide part of capsaicin, and then
deprotection was performed with trifluoroacetic acid (TFA) in dry
DCM to gain compounds 2c-6c (Scheme 4). The synthesis of com-
pounds 2d-6d was similar to that of 1c, 7c-16c, coupling two
molecules of TMP-Cl under catalyzed by K2CO3 in anhydrous DMF
(Scheme 2-method c). As shown in Table 1, the overall novel cin-
namic acid-capsaicin-ligustrazine derivatives were obtained and
their structures were all characterized by 1H NMR, 13C NMR and HR-
MS analysis.
2.2. Biological activities
2.2.1. The establishment of H2O2-induced injury model in HBMEC-
2/SH-SY5Y cells
Oxidative stress is one of the major pathogenesis that causes a
variety of brain diseases [43]. A growing body of evidence supports
that the occurrence of diverse brain diseases is closely related to the
increase of oxidation products and apoptosis [44]. There have been
quantities of reports on the relationship between oxidative stress
and nervous system using human brain microvascular endothelium
4 W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695

Table 1
The EC50 Values (mM) of cinnamic acid-capsaicin-ligustrazine derivatives on H2O2-induced HBMEC-2/SH-SY5Y cells (n ¼ 3) and their structures.

No. Structure No. Structure No. Structure No. Structure

EC50 (HBMEC-2/SH-SY5Y) EC50 (HBMEC-2/SH-SY5Y) EC50 (HBMEC-2/SH-SY5Y) EC50 (HBMEC-2/SH-SY5Y)

1a 1c

9.8 ± 0.66/3.66 ± 0.17 4.99 ± 0.33/7.31 ± 0.06

2a 2b 2c 2d

7.46 ± 1.03/9.76 ± 1.62 6.65 ± 0.57/11.98 ± 0.11 6.07 ± 0.71/5.30 ± 0.19 15.1 ± 1.14/6.28 ± 0.22
3a 3b 3c 3d

5.75 ± 0.23/8.62 ± 0.44 10.58 ± 1.07/8.09 ± 0.07 6.17 ± 0.40/3.68 ± 0.20 12.76 ± 1.39/8.7 ± 0.23
4a 4b 4c 4d

8.04 ± 1.11/6.00 ± 0.12 12.53 ± 0.96/5.37 ± 0.17 6.23 ± 0.36/3.74 ± 0.64 21.42 ± 1.30/7.77 ± 0.08
5a 5b 5c 5d

6.34 ± 0.40/9.30 ± 0.61 11.6 ± 0.18/10.23 ± 0.59 5.81 ± 0.37/13.43 ± 0.04 14.51 ± 1.08/11.06 ± 0.45
6a 6b 6c 6d

11.85 ± 0.77/7.85 ± 0.69 9.30 ± 0.40/9.25 ± 0.15 13.49 ± 0.67/8.56 ± 0.54 14.63 ± 0.11/11.58 ± 0.16
7a 7c

6.48 ± 0.61/5.98 ± 0.03 12.02 ± 0.47/7.15 ± 0.42

8a 8c

7.11 ± 0.48/5.24 ± 0.12 9.87 ± 0.35/4.32 ± 0.38

9a 9c

10.44 ± 0.35/11.41 ± 0.44 6.56 ± 0.17/5.05 ± 0.07

10a 10c

13.13 ± 1.92/5.49 ± 0.36 6.31 ± 0.36/7.15 ± 0.42

11a 11c

8.85 ± 0.09/11.00 ± 0.09 15.84 ± 1.34/4.47 ± 0.10

12a 12c

7.81 ± 0.32/4.86 ± 0.20 12.93 ± 0.95/8.66 ± 0.28

13a 13c
 W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695 5

Table 1 (continued )

No. Structure No. Structure No. Structure No. Structure

EC50 (HBMEC-2/SH-SY5Y) EC50 (HBMEC-2/SH-SY5Y) EC50 (HBMEC-2/SH-SY5Y) EC50 (HBMEC-2/SH-SY5Y)

10.47 ± 0.41/9.50 ± 0.13 11.80 ± 0.47/11.04 ± 0.26

14a 14c

3.26 ± 0.16/2.41 ± 0.10 12.5 ± 0.54/3.62 ± 0.05

15a 15c

2.59 ± 0.31/5.91 ± 0.16 3.55 ± 0.44/11.53 ± 0.11

16a 16c

4.82 ± 0.22/7.45 ± 0.56 18.12 ± 0.22/3.84 ± 0.44

Edaravone 4.61 ± 0.17/3.75 ± 0.14 TMP 15.18 ± 0.29/17.59 ± 0.24 Capsaicin 16.37 ± 0.44/14.02 ± 0.22

cells, human neuroblastoma cells as in vitro model. Vascular
endothelial cell injury is an important pathogenesis in ischemic
stroke, while SH-SY5Y cells are recognized as a commen model for
evaluating the function of nerve cells [45,46]. Therefore in this
study, injury models induced by H2O2 in HBMEC-2/SH-SY5Y cell
lines were established, laying a foundation for the evaluation of
cinnamic acids derivatives’ effects on brain injury models, and
furthermore for the mechanism research of protective effects
against free radical damage.
According to the results of MTT assay (Table 2), different con-
centrations of H2O2 solution exhibited different degrees of damage
to HBMEC-2/SH-SY5Y cells, and with the increase of concentration,
the survival rate of HBMEC-2/SH-SY5Y cells decreased gradually,
showing a dose-effect relationship. According to results in Table 2,
0.6 mM H2O2 was selected to treat HBMEC-2 cells and meanwhile
also 0.6 mM H2O2 for SH-SY5Y cells to investigate the possible
protective effects of target derivatives against the damage induced
by H2O2.
2.2.2. Protection of cinnamic acids derivatives against H2O2-
induced damage in HBMEC-2/SH-SY5Y cells
The 50% effective concentrations (EC50) of target compounds for
protecting damaged HBMEC-2/SH-SY5Y cells evaluated by MTT
assay were summarized in Table 1. Most of the compounds showed
higher cell viability against H2O2-induced cell death in HBMEC-
2 cells compared with capsaicin's vanilla amide part and TMP.
Among them, the compounds 14a and 15a exhibited the highest
capacity in neuroprotection with the EC50 value of 3.26 ± 0.16 mM
and 2.59 ± 0.31 mM, respectively.
Elevated levels of cell viability were also observed in most of the
compounds in SH-SY5Y cells. Most of the derivatives were more
active (with lower EC50 values) than capsaicin's vanilla amide part
Table 2
Effect of different concentrations of H2O2 on the survival rate of HBMEC-2/SH-SY5Y
cells.
H2O2 (mM) cell survival rate
HBMEC-2
0.3 0.70 ± 0.02
0.6 0.60 ± 0.03
0.9 0.56 ± 0.03
1.2 0.47 ± 0.03
1.5 0.40 ± 0.03
and TMP. Among them, the compounds 14a and 14c displayed the
most potent activity with a significant EC50 value of 2.41 ± 0.10 mM
and 3.62 ± 0.05 mM, respectively.
According to the experimental data above, 14a performed
optimal protective activity in both HBMEC-2 cells and SH-SY5Y
cells and were even better than Edarevone. Therefore, 14a was
selected as the dominant compound for subsequent mechanism
investigations.
Preliminary structure-activity relationships analysis indicated
that, the nature of the substituents played a vital role in the neu-
roprotective activity of derivatives. Compounds containing three
methoxyl groups represented the optimal proliferation rates,
implying methoxyl group was the most potential structure giving
rise to protective activities, which was in accordance with our
previous study [26]. Furthermore, most compounds containing
single-ligustrazine or none-ligustrazine substituents exhibited
better activities than that of bis-ligustrazine substituents, such as
EC50: 3b < 3d, 4b < 4d, 5b < 5d, 6b < 6d. In addition, as for the de-
rivatives containing single-ligustrazine, the position matters. Lig-
ustrazine introduced to the hydroxyl group of capsaicin exhibited
higher potency than that of cinnamic acids (EC50: 2c < 2b, 3c < 3b,
4c < 4b, 5c < 5b).
2.2.3. Protective effects of 14a on H2O2-induced cell apoptosis
2.2.3.1. Morphological analysis
2.2.3.1.1. Gimesa staining. Gimesa staining was performed to
characterize the morphological protective effects of 14a on H2O2-
induced cell apoptosis under inverted phase-contrast microscope.
As shown in Figs. 2 and 3, the cells in control group presented a
normal cellular morphology, whereas phenomenon of cell
shrinkage and cell disruption appeared in the model group. The
number of cells in drug-administered groups were significantly
higher than that in the model group. In summary, we found that
14a lead to an alleviated morphological lesion for H2O2-induced
cell apoptosis in both HBMEC-2 cells and SH-SY5Y cells.
2.2.3.1.2. DAPI staining. To further study the mechanism of
protective effects of 14a on H2O2-induced cells, the nuclear
morphological changes in HBMEC-2/SH-SY5Y cells were observed
SH-SY5Y using DAPI staining. As shown in Figs. 4 and 5, for both HBMEC-
0.73 ± 0.06 2 cells and SH-SY5Y cells, intact cell bodies with clear round nuclei
0.56 ± 0.05 were observed in the control groups, while the number of cells
0.47 ± 0.02 decreased significantly and nuclear fragmentation with irregular
0.35 ± 0.04 shape formed in the model group, suggesting the validity of model
0.29 ± 0.01
group. As a result, the number of cells in administration groups
6 W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695

Fig. 2. Morphological detection of apoptosis using Gimesa staining on H2O2-induced HBMEC-2 cells treated with different concentrations of 14a (200  ): (A) control group; (B)
model group; (C) 1.56 mM; (D) 3.13 mM; (E) 6.25 mM.

Fig. 3. Morphological detection of apoptosis using Gimesa staining on H2O2-induced SH-SY5Y cells treated with different concentrations of 14a (200  ): (A) control group; (B)
model group; (C) 1.56 mM; (D) 3.13 mM; (E) 6.25 mM.

Fig. 4. Morphological detection of apoptosis using DAPI staining on H2O2-induced HBMEC-2 cells treated with different concentrations of 14a (200  ): (A) control group; (B) model
group; (C) 1.56 mM; (D) 3.13 mM; (E) 6.25 mM.

Fig. 5. Morphological detection of apoptosis using DAPI staining on H2O2-induced SH-SY5Y cells treated with different concentrations of 14a (200  ): (A) control group; (B) model
group; (C) 1.56 mM; (D) 3.13 mM; (E) 6.25 mM.

distinctly increased compared to the model group. What's more,
nuclear fragmentation of the cells caused by apoptosis as well as
the number of irregular cells was significantly reduced. At different
doses of administration, the protective effects of the drugs
appeared in a dose-dependent manner. Therefore, the results
indicated that compound 14a could inhibit apoptosis in HBMEC-2/
SH-SY5Y cells.
2.2.3.2. Inhibition of apoptosis analysis using annexin V-FITC/PI
staining. Inhibition of apoptosis is an effective way to prevent
ischemic stroke [47]. The injury of cerebral ischemic penumbra is
reversible, and the function of the brain tissue can be restored by
inhibiting apoptosis and protecting the neurons in the penumbra
[48]. For further study the function mechanism of compound 14a,
annexin V-FITC/PI staining assay was performed. As shown in Fig. 6,
when treated with 14a at three concentrations, the percentages of
apoptotic cells (including early and late apoptosis ratios) decreased
to 28.4% (1.56 mM), 19.4% (3.13 mM), 18.5% (6.25 mM) from 37.5% in
the model group. The anti-apoptotic effect of 14a on SH-SY5Y cells
was similar to that of HBMEC-2 cells (Fig. 7), which took effect in a
concentration-dependent manner. The apoptosis rate decreased
from 31.9% in the model group to 28.2% (1.56 mM), 25.2% (3.13 mM),
16.6% (6.25 mM). The result demonstrated that 14a had the potential
to inhibit the apoptosis of HBMEC-2 and SH-SY5Y cells induced by
H2O2.
2.2.3.3. Mitochondrial membrane potential assay. Researches have
shown that depolarization of the mitochondrial inner membrane
was observed in stroke patients and animal brain tissue, leading to
impaired oxidized phosphate and energy metabolism [49]. We
performed mitochondrial membrane potential assay to estimate
the effect of compound 14a on H2O2-induced loss of mitochondrial
membrane potential in HBMEC-2/SH-SY5Y cells. Compared with
the control group, the fluorescence intensity of the model group
 W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695 7

Fig. 6. Apoptosis analysis using Annexin V-FITC/PI staining of 14a with different concentrations on H2O2-induced HBMEC-2 cells: (A) control group; (B) model group; (C) 1.56 mM;
(D) 3.13 mM; (E) 6.25 mM (Q1, normal cells that are mechanically damaged; Q2, late apoptotic cells; Q3, normal cells; Q4, early apoptotic cells).

Fig. 7. Apoptosis analysis using Annexin V-FITC/PI staining of 14a with different concentrations on H2O2-induced SH-SY5Y cells: (A) control group; (B) model group; (C) 1.56 mM; (D)
3.13 mM; (E) 6.25 mM (Q1, normal cells that are mechanically damaged; Q2, late apoptotic cells; Q3, normal cells; Q4, early apoptotic cells).

was decreased, which demonstrated the mitochondrial membrane
potential was decreased. Compared with the model group, the
enhancement of green fluorescence intensity in the drug groups
was observed (Figs. 8 and 9), indicating that 14a could suppress the
decrease in mitochondrial transmembrane potential caused by
hydrogen peroxide and inhibit neuronal apoptosis.
2.2.4. CAM assay in vivo
CAM assay was performed to evaluate the angiogenesis effect of
compound 14a. As shown in Fig. 10, the vascular density of chick
embryo chorioallantoic membrane increased significantly, and the
microvessels were more obvious compared to the control group,
indicating that the compound 14a had an effect of promoting
8 W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695

Fig. 8. Effects of compound 14a on H2O2-induced loss of mitochondrial membrane potential in HBMEC-2 cells: (A) control group; (B) model group; (C) 1.56 mM; (D) 3.13 mM; (E)
6.25 mM.

Fig. 9. Effects of compound 14a on H2O2-induced loss of mitochondrial membrane potential in SH-SY5Y cells: (A) control group; (B) model group; (C) 1.56 mM; (D) 3.13 mM; (E)
6.25 mM.

Fig. 10. Effects of compound 14a on the angiogenesis of CAM: (A) control group; (B) 0.5 mg/mL; (C) 1 mg/mL; (D) 2 mg/mL.

angiogenesis. Its pro-angiogenic activity was optimal at the con-
centration of 1 mg/mL.
2.2.5. VEGFR2 mRNA expression detected by RT-PCR
Vascular endothelial growth factor (VEGF) is a key factor in
angiogenesis [50]. After binding to its receptor, VEGF can promote
endothelial cell proliferation, adhesion and migration to initiate
angiogenesis, furthermore can stimulate the penumbra neo-
vascularization in the ischemic region and establish collateral cir-
culation [51,52]. Besides, VEGF is also a neuroprotective agent.
When ischemic cerebrovascular disease occurs, it can help to
reduce the apoptosis of neurons, and increase neurogenesis of the
subventricular zone [53,54].
To explore whether compound 14a could promote angiogenesis
 W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695
Fig. 11. Compound 14a0 s effect on VEGFR2 gene expression in chick embryo (n ¼ 3).
*P < 0.05 as compared to control group.
by up-regulating VEGFR2 gene, the expression of VEGFR2 mRNA on
chick embryo was detected by Real-Time PCR. As shown in Fig. 11,
the VEGFR2 mRNA in administrated chick embryo (1 mg/mL)
increased significantly compared with the control group, indicating
that the angiogenesis mechanism of 14a was involved with VEGFR2
signal pathway. The analyzed results were statistically significant.
3. Conclusions
Above all, forty-two novel cinnamic acids derivatives were
designed and synthesized, all of which were characterized by 1H
NMR, 13C NMR and HR-MS analysis. The results of activity test
demonstrated that most of the compounds displayed effective
protection capacity against H2O2-induced cell death in HBMEC-
2 cells and SH-SY5Y cells, especially the compound 14a. It exhibited
the most potent activities both on the nerve cells and the endo-
thelium cells with the significant EC50 value of 3.26 ± 0.16 mM and
2.41 ± 0.10 mM respectively, which was even better than edaravone.
Therefore, 14a was selected as the dominant compound for sub-
sequent mechanism investigations. Morphological analysis indi-
cated that compound 14a could improve cell survival rates,
maintain cell integrity and block apoptosis. The detection of
apoptosis and mitochondrial membrane potential demonstrated
that compound 14a inhibited HBMEC-2/SH-SY5Y cells apoptosis
and was correlated with stabilizing mitochondria membrane po-
tential. In CAM assay, the vascular density of the chorioallantoic
membrane increased significantly in administrated group
compared with the injury group, and the results of Real-Time PCR
demonstrated that 14a increased gene expression of VEGFR2 mRNA
on chick embryo, indicating that compound 14a had an effect of
promoting angiogenesis, and its mechanism might correlate with
up-regulating VEGFR2 signal pathway. Altogether, the results of the
series of cinnamic acids derivatives supported the potential value of
neuroprotection and angiogenesis, suggesting that the attempt to
apply structure combination to discover lead compounds with dual
effects gained by combining active ingredients in traditional herb
medicines was viable and deserved further study.
4. Experimental section
4.1. Chemistry
4.1.1. General synthesis of 3,5,6-trimethylpyrazine-2-chloride
3,5,6-trimethylpyrazine-2-chloride was prepared according to
9
our previous study. In brief, N-Chlorosuccinimide (1 equiv.) was
suspended in CCl4, then TMP (1.2 equiv.) was added. Upon
completion of the reaction, the mixture was stirred at room tem-
perature for 2 h, and then under highlight at 85
C for 2 h. As flotage
appeared in the upper layer of the solvent and the solution became
clear and yellow, monitor the mixture by TLC. After completion of
the reaction, the CCl4 was evaporated and the irritating yellow
liquid was purified by flash chromatography to produce a trans-
parent oily liquid (3,5,6-trimethylpyrazine-2-chloride).
4.1.2. General synthesis of compounds 1a-16a
4-Hydroxy-3-methoxybenzylamine hydrochloride (1.0 equiv.)
and the corresponding cinnamic acid (1.0 equiv.) were dissolved in
anhydrous DMF, then EDCI (0.75 equiv.)/HOBT (0.6 equiv.)/DIEPA
(0.75 equiv.) was added and the mixture was stirred at room
temperature for 4 h. After completion of the reaction as indicated
by TLC, the reagent was extracted with ethyl acetate 3 times. After
collecting the organic phase, anhydrous Na2SO4 and saturated NaCl
were used to dry it over. Evaporating the solvent under vacuum,
purification of the crude products was performed by flash
chromatography.
4.1.2.1. (E)-N-(4-hydroxy-3-methoxybenzyl)cinnamamide (com-
pound 1a). White powder, m.p.: 141.4e142.3
C, yield: 92.20%. 1H
NMR (400 MHz, DMSO‑d6) d (ppm): 8.84 (s, 1H, -OH), 8.47 (t,
J ¼ 5.7 Hz, 1H, -NH), 7.56 (d, J ¼ 7.3 Hz, 2H), 7.46 (d, J ¼ 15.8 Hz, 1H),
7.39 (dq, J ¼ 15.8, 7.3 Hz, 3H), 6.88 (s, 1H), 6.75e6.66 (m, 3H), 4.29
(d, J ¼ 5.7 Hz, 2H, -CH2), 3.75 (s, 3H, -OCH3); 13C NMR (100 MHz,
DMSO‑d6) d (ppm): 164.72, 147.45, 145.54, 138.74, 134.93, 130.02,
129.41, 128.92, 127.49, 122.23, 120.02, 115.25, 112.00, 55.59, 42.26.
HRMS (ESI) m/z: 284.1281 [MþH]þ, calcd. for C17H17NO3: 284.1281.
4.1.2.2. (E)-N-(4-hydroxy-3-methoxybenzyl)-3-(2-hydroxyphenyl)
acrylamide (compound 2a). White powder, m.p.: 200.8e202.0
C,
yield: 73.24%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 10.01 (s, 1H,
-OH), 8.83 (s, 1H, -OH), 8.43 (t, J ¼ 5.7 Hz, 1H, -NH), 7.67 (d,
J ¼ 15.7 Hz, 1H), 7.41 (d, J ¼ 7.5 Hz, 1H), 7.17 (t, J ¼ 7.5 Hz, 1H), 6.89 (d,
J ¼ 8.3 Hz, 1H), 6.87 (s, 1H), 6.82 (t, J ¼ 7.5 Hz, 1H), 6.70 (m, 3H), 4.27
(d, J ¼ 5.7 Hz, 2H, -CH2), 3.75 (s, 3H, -OCH3); 13C NMR (100 MHz,
DMSO‑d6) d (ppm): 165.37, 156.23, 147.42, 145.46, 134.62, 130.41,
130.25, 128.11, 121.69, 121.62, 119.96, 119.32, 116.06, 115.22, 111.95,
55.58, 42.20. HRMS (ESI) m/z: 300.1227 [MþH]þ, calcd. for
C17H17NO4: 300.1230.
4.1.2.3. (E)-N-(4-hydroxy-3-methoxybenzyl)-3-(3-hydroxyphenyl)
acrylamide (compound 3a). White powder, m.p.: 150.8e151.8
C,
yield: 81.14%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 9.57 (s, 1H,
-OH), 8.86 (s, 1H, -OH), 8.47 (t, J ¼ 5.7 Hz, 1H, -NH), 7.36 (d,
J ¼ 15.7 Hz, 1H), 7.20 (t, J ¼ 7.5 Hz, 1H), 6.97 (d, J ¼ 7.5 Hz, 1H), 6.93
(s, 1H), 6.87 (s, 1H), 6.77 (d, J ¼ 7.9 Hz, 1H), 6.72 (d, J ¼ 7.9 Hz, 1H),
6.69 (d, J ¼ 7.9 Hz, 1H), 6.60 (d, J ¼ 15.7 Hz, 1H), 4.28 (d, J ¼ 5.6 Hz,
2H, -CH2), 3.78 (s, 3H, -OCH3); 13C NMR (100 MHz, DMSO‑d6)
d (ppm): 164.75, 157.68, 147.45, 145.53, 138.94, 136.19, 130.03,
129.91, 121.96, 120.02, 118.71, 116.65, 115.25, 113.64, 111.99, 55.58,
42.24. HRMS (ESI) m/z: 300.1243 [MþH]þ, calcd. for C17H17NO4:
300.1230.
4.1.2.4. (E)-N-(4-hydroxy-3-methoxybenzyl)-3-(4-hydroxyphenyl)
acrylamide (compound 4a). White powder, m.p.: 196.3e197.0
C,
yield: 84.56%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 9.81 (s, 1H,
-OH), 8.82 (s, 1H, -OH), 8.33 (t, J ¼ 5.7 Hz, 1H, -NH), 7.38 (d,
J ¼ 8.4 Hz, 2H), 7.34 (s, 1H), 6.86 (s, 1H), 6.79 (d, J ¼ 8.4 Hz, 2H), 6.72
(d, J ¼ 8.0 Hz, 1H), 6.68 (d, J ¼ 8.0 Hz, 1H), 6.46 (d, J ¼ 15.7 Hz, 1H),
4.27 (d, J ¼ 5.7 Hz, 2H, -CH2), 3.74 (s, 3H, -OCH3); 13C NMR
(100 MHz, DMSO‑d6) d (ppm): 165.41, 159.02, 147.64, 145.69, 139.06,
10 W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695
130.44, 129.40, 126.13, 120.16, 118.86, 115.94, 115.44, 112.16, 55.79,
42.38. HRMS (ESI) m/z: 300.1228 [MþH]þ, calcd. for C17H17NO4:
300.1230.
4.1.2.5. (E)-N-(4-hydroxy-3-methoxybenzyl)-3-(4-hydroxy-3-
methoxyphenyl)acrylamide (compound 5a). White powder, m.p.:
181.2e182.4
C, yield: 78.98%. 1H NMR (400 MHz, DMSO‑d6)
d (ppm): 9.41 (s, 1H, -OH), 8.83 (s, 1H, -OH), 8.31 (t, J ¼ 5.7 Hz, 1H,
-NH), 7.35 (d, J ¼ 15.7 Hz, 1H), 7.12 (s, 1H), 6.99 (d, J ¼ 8.2 Hz, 1H),
6.86 (s, 1H), 6.79 (d, J ¼ 8.2, 1H), 6.72 (d, J ¼ 8.0 Hz, 1H), 6.68 (d,
J ¼ 8.0 Hz, 1H), 6.50 (d, J ¼ 15.7 Hz, 1H), 4.27 (d, J ¼ 5.7 Hz, 2H, -CH2),
3.80 (s, 3H, -OCH3), 3.74 (s, 3H, -OCH3); 13C NMR (100 MHz,
DMSO‑d6) d (ppm): 165.21, 148.26, 147.81, 147.45, 145.48, 139.14,
130.25, 126.43, 121.49, 119.96, 118.97, 115.67, 115.24, 111.95, 110.81,
55.59, 55.51, 42.21. HRMS (ESI) m/z: 330.1337 [MþH]þ, calcd. for
C18H19NO5: 330.1336.
4.1.2.6. (E)-N-(4-hydroxy-3-methoxybenzyl)-3-(3-hydroxy-4-
methoxyphenyl)acrylamide (compound 6a). White powder, m.p.:
155.4e156.5
C, yield: 89.12%. 1H NMR (400 MHz, DMSO‑d6)
d (ppm): 9.18 (s, 1H, -OH), 8.84 (s, 1H, -OH), 8.38 (t, J ¼ 5.7 Hz, 1H,
-NH), 7.31 (d, J ¼ 15.6 Hz, 1H), 6.98 (s, 1H), 6.94 (d, J ¼ 6.3 Hz, 2H),
6.86 (s, 1H), 6.70 (q, J ¼ 7.9 Hz, 2H), 6.45 (d, J ¼ 15.6 Hz, 1H), 4.27 (d,
J ¼ 4.9 Hz, 2H, -CH2), 3.79 (s, 3H, -OCH3), 3.74 (s, 3H, -OCH3); 13C
NMR (100 MHz, DMSO‑d6) d (ppm):165.05, 149.16, 147.44, 146.68,
145.50, 138.90, 130.18, 127.80, 120.25, 119.98, 119.51, 115.24, 113.31,
112.09, 111.98, 55.58, 42.19. HRMS (ESI) m/z: 330.1345 [MþH]þ,
calcd. for C18H19NO5: 330.1336.
4.1.2.7. (E)-N-(4-hydroxy-3-methoxybenzyl)-3-(2-methoxyphenyl)
acrylamide (compound 7a). White powder, m.p.: 150.5e151.3
C,
yield: 82.14%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.84 (s, 1H,
-OH), 8.44 (t, J ¼ 5.7 Hz, 1H, -NH), 7.69 (d, J ¼ 15.9 Hz, 1H), 7.50 (d,
J ¼ 7.5 Hz, 1H), 7.35 (t, J ¼ 7.8 Hz, 1H), 7.06 (d, J ¼ 8.3 Hz, 2H), 6.98 (t,
J ¼ 7.5 Hz, 1H), 6.77e6.65 (m, 3H), 4.28 (d, J ¼ 5.7 Hz, 2H, -CH2), 3.85
(s, 3H, -OCH3), 3.75 (s, 3H, -OCH3); 13C NMR (100 MHz, DMSO‑d6)
d (ppm): 165.11, 157.51, 147.44, 145.51, 133.78, 130.77, 130.12, 127.78,
123.31, 122.58, 120.67, 120.02, 115.24, 112.00, 111.67, 55.58, 55.52,
42.24. HRMS (ESI) m/z: 314.1393 [MþH]þ, calcd. for C18H19NO4:
314.1387.
4.1.2.8. (E)-N-(4-hydroxy-3-methoxybenzyl)-3-(3-methoxyphenyl)
acrylamide (compound 8a). White powder, m.p.: 142.6e143.5
C,
yield: 86.24%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.85 (s, 1H,
-OH), 8.45 (t, J ¼ 5.7 Hz, 1H, -NH), 7.43 (d, J ¼ 15.7 Hz, 1H), 7.32 (t,
J ¼ 7.9 Hz, 1H), 7.13 (d, J ¼ 7.9 Hz, 1H), 7.11 (s, 1H), 6.94 (dd, J ¼ 8.1 Hz,
1.9 Hz, 1H), 6.87 (s, 1H), 6.74e6.66 (m, 3H), 4.29 (d, J ¼ 5.6 Hz, 2H,
-CH2), 3.78 (s, 3H, -OCH3), 3.75 (s, 3H, -OCH3); 13C NMR (100 MHz,
DMSO‑d6) d (ppm): 164.70, 159.58, 147.46, 145.55, 138.66, 136.38,
130.01, 129.96, 122.58, 120.02, 119.84, 115.26, 115.22, 112.61, 112.01,
55.59, 55.09, 42.28. HRMS (ESI) m/z: 314.1389 [MþH]þ, calcd. for
C18H19NO4: 314.1387.
4.1.2.9. (E)-N-(4-hydroxy-3-methoxybenzyl)-3-(4-methoxyphenyl)
acrylamide (compound 9a). White powder, m.p.: 171.9e173.2
C,
yield: 83.57%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.84 (s, 1H,
-OH), 8.37 (t, J ¼ 5.7 Hz, 1H, -NH), 7.50 (d, J ¼ 8.7 Hz, 2H), 7.41 (d,
J ¼ 15.7 Hz, 1H), 6.97 (d, J ¼ 8.7 Hz, 2H), 6.87 (s, 1H), 6.72 (d,
J ¼ 5.4 Hz, 1H), 6.69 (d, J ¼ 8.7 Hz, 1H), 6.54 (d, J ¼ 15.7 Hz, 1H), 4.28
(d, J ¼ 5.6 Hz, 2H, -CH2), 3.78 (s, 3H, -OCH3), 3.75 (s, 3H, -OCH3); 13C
NMR (100 MHz, DMSO‑d6) d (ppm): 165.05, 160.29, 147.45, 145.51,
138.45, 130.17, 129.06, 127.50, 119.99, 119.74, 115.24, 114.38, 111.97,
55.58, 55.24, 42.21. HR-MS (ESI) m/z: [MþH]þ calcd for C18H19NO4:
314.1348, found: 314.1392. HRMS (ESI) m/z: 314.1392 [MþH]þ,
calcd. for C18H19NO4: 314.1387.
4 .1. 2 .10 . ( E ) - N - ( 4 - h y d r o x y - 3 - m e t h o x y b e n z y l ) - 3 - ( 2 , 3 -
dimethoxyphenyl)acrylamide (compound 10a). White powder,
m.p.: 196.3e197.6
C, yield: 90.7%. 1H NMR (400 MHz, DMSO‑d6)
d (ppm): 8.85 (s, 1H, -OH), 8.50 (t, J ¼ 5.7 Hz, 1H, -NH), 7.66 (d,
J ¼ 15.8 Hz, 1H), 7.16e7.04 (m, 3H), 6.87 (s, 1H), 6.71 (dd, J ¼ 13.5 Hz,
8.9, 3H), 4.28 (d, J ¼ 5.7 Hz, 2H, -CH2), 3.82 (s, 3H, -OCH3), 3.75 (s,
3H, -OCH3), 3.74 (s, 3H,-OCH3); 13C NMR (100 MHz, DMSO‑d6)
d (ppm): 164.85, 152.85, 147.45, 147.37, 145.54, 133.17, 130.02,
128.52, 124.36, 123.42, 120.05, 118.49, 115.26, 113.75, 112.03, 60.63,
55.75, 55.58, 42.28. HRMS (ESI) m/z: 344.1493 [MþH]þ, calcd. for
C19H21NO5: 344.1492.
4 .1. 2 .11. ( E ) - N - ( 4 - h y d r o x y - 3 - m e t h o x y b e n z y l ) - 3 - ( 3 , 4 -
dimethoxyphenyl)acrylamide (compound 11a). White powder,
m.p.: 121.7e122.4
C, yield: 82.98%. 1H NMR (400 MHz, DMSO‑d6)
d (ppm): 8.84 (s, 1H, -OH), 8.35 (t, J ¼ 5.7 Hz, 1H, -NH), 7.38 (t,
J ¼ 15.8 Hz, 1H), 7.15 (s, 1H), 7.11 (d, J ¼ 8.4 Hz, 1H), 6.98 (d,
J ¼ 8.4 Hz, 1H), 6.87 (s, 1H), 6.70 (q, J ¼ 8.4 Hz, 2H), 6.57 (d,
J ¼ 15.8 Hz, 1H), 4.28 (d, J ¼ 5.7 Hz, 2H, -CH2), 3.79 (s, 3H, -OCH3),
3.78 (s, 3H, -OCH3), 3.75 (s, 3H, -OCH3); 13C NMR (100 MHz,
DMSO‑d6) d (ppm): 165.05, 150.07, 148.88, 147.45, 145.50, 138.79,
130.18, 127.73, 121.29, 119.97, 115.24, 111.97, 111.75, 110.02, 55.59,
55.54, 55.40, 42.23. HRMS (ESI) m/z: 344.1491 [MþH]þ, calcd. for
C19H21NO5: 344.1492.
4 .1. 2 .1 2 . ( E ) - N - ( 4 - h y d r o x y - 3 - m e t h o x y b e n z y l ) - 3 - ( 3 , 5 -
dimethoxyphenyl)acrylamide (compound 12a). White powder,
m.p.: 153.6e154.9
C, yield: 86.19%. 1H NMR (400 MHz, DMSO‑d6)
d (ppm): 8.85 (s, 1H, -OH),8.43 (t, J ¼ 5.6 Hz, 1H, -NH), 7.38 (d,
J ¼ 15.7 Hz, 1H), 6.87 (s, 1H), 6.73 (d, J ¼ 1.8 Hz, 2H), 6.71 (d,
J ¼ 5.2 Hz, 2H), 6.67 (d, J ¼ 6.9 Hz, 1H), 6.51 (s, 1H), 4.28 (d,
J ¼ 5.7 Hz, 2H, -CH2), 3.76 (s, 6H, 2* -OCH3), 3.75 (s, 3H, -OCH3); 13C
NMR (100 MHz, DMSO‑d6) d (ppm): 164.66, 160.70, 147.46, 145.55,
138.71, 136.94, 129.99, 122.84, 120.02, 115.26, 112.01, 105.40, 101.47,
55.59, 55.25, 42.29. HRMS (ESI) m/z: 344.1496 [MþH]þ, calcd. for
C19H21NO5: 344.1492.
4 .1. 2 .13 . ( E ) - N - ( 4 - h y d r o x y - 3 - m e t h o x y b e n z y l ) - 3 - ( 2 , 5 -
dimethoxyphenyl)acrylamide (compound 13a). White powder,
m.p.: 140.3e141.1
C, yield: 81.25%. 1H NMR (400 MHz, DMSO‑d6)
d (ppm): 8.85 (s, 1H, -OH), 8.43 (t, J ¼ 5.7 Hz, 1H, -NH), 7.66 (d,
J ¼ 15.9 Hz, 1H), 7.06 (d, J ¼ 2.7 Hz, 1H), 7.00 (d, J ¼ 9.0 Hz, 1H), 6.94
(dd, J ¼ 9.0, 2.7 Hz, 1H), 6.87 (s, 1H), 6.71 (dd, J ¼ 15.9, 7.9 Hz, 3H),
4.27 (d, J ¼ 5.6 Hz, 2H, -CH2), 3.80 (s, 3H, -OCH3), 3.75 (s, 3H, -OCH3),
3.73 (s, 3H, -OCH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.05,
153.12, 151.89, 147.45, 145.53, 133.57, 130.10, 123.97, 122.97, 120.04,
116.08, 115.25, 112.94, 112.41, 112.03, 56.00, 55.59, 55.41, 42.28.
HRMS (ESI) m/z: 344.1493 [MþH]þ, calcd. for C19H21NO5: 344.1492.
4 .1. 2 .14 . ( E ) - N - ( 4 - h y d r o x y - 3 - m e t h o x y b e n z yl ) - 3 - ( 2 , 4 , 5 -
trimethoxyphenyl)acrylamide (compound 14a). White powder,
m.p.: 205.9e206.8
C, yield: 85.38%. 1H NMR (400 MHz, DMSO‑d6)
d (ppm): 8.83 (s, 1H, -OH), 8.30 (s, 1H, -NH), 7.64 (d, J ¼ 15.9 Hz, 1H),
7.06 (s, 1H), 6.86 (s, 1H), 6.71 (s, 2H), 6.68 (d, J ¼ 8.0 Hz, 1H), 6.58 (d,
J ¼ 15.9 Hz, 1H), 4.26 (d, J ¼ 5.2 Hz, 2H, -CH2), 3.84 (s, 3H, -OCH3),
3.83 (s, 3H, -OCH3), 3.75 (s, 3H, -OCH3), 3.73 (s, 3H, -OCH3); 13C
NMR (100 MHz, DMSO‑d6) d (ppm): 165.47, 152.84, 151.21, 147.42,
145.47, 142.83, 133.44, 130.28, 119.97, 119.84, 115.22, 114.58, 111.99,
110.80, 97.95, 56.28, 56.02, 55.77, 55.59, 42.22. HRMS (ESI) m/z:
374.1615 [MþH]þ, calcd. for C20H23NO6: 374.1598.
4 .1. 2 .15 . ( E ) - N - ( 4 - h y d r o x y - 3 - m e t h o x y b e n z yl ) - 3 - ( 3 , 4 , 5 -
trimethoxyphenyl)acrylamide (compound 15a). White powder,
m.p.: 179.3e180.7
C, yield: 81.58%. 1H NMR (400 MHz, DMSO‑d6)
d (ppm): 8.85 (s, 1H, -OH), 8.40 (s, 1H, -NH), 7.41 (d, J ¼ 15.7 Hz, 1H),
 W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695
6.90 (s, 2H), 6.88 (s, 1H), 6.70 (q, J ¼ 8.5 Hz, 2H), 6.64 (q, J ¼ 15.7 Hz,
1H), 4.29 (d, J ¼ 4.5 Hz, 2H, -CH2), 3.82 (s, 6H, 2*-OCH3), 3.76 (s, 3H,
-OCH3), 3.69 (s, 3H, -OCH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm):
164.80, 153.06, 147.44, 145.51, 138.84, 138.62, 130.57, 130.07, 121.62,
119.98, 115.23, 111.99, 104.91, 60.08, 55.85, 55.59, 42.27. HRMS (ESI)
m/z: 374.1591 [MþH]þ, calcd. for C20H23NO6: 374.1598.
4 .1. 2 .16 . ( E ) - N - ( 4 - h y d r o x y - 3 - m e t h o x y b e n z y l ) - 3 - ( 2 , 3 , 4 -
trimethoxyphenyl)acrylamide (compound 16a). White powder,
m.p.: 175.6e176.4
C, yield: 90.17%. 1H NMR (400 MHz, DMSO‑d6)
d (ppm): 8.84 (s, 1H, -OH), 8.41 (s, 1H, -NH), 7.53 (t, J ¼ 15.9 Hz, 1H),
7.27 (d, J ¼ 8.6 Hz, 1H), 6.87 (s, 2H), 6.71 (s, 2H), 6.62 (d, J ¼ 15.9 Hz,
1H), 4.27 (d, J ¼ 4.2 Hz, 2H, -CH2), 3.82 (s, 3H, -OCH3), 3.80 (s, 3H,
-OCH3), 3.75 (s, 6H, 2*-OCH3); 13C NMR (100 MHz, DMSO‑d6)
d (ppm): 165.17, 154.50, 152.20, 147.44, 145.51, 141.91, 133.44, 130.16,
122.42, 121.34, 121.14, 120.03, 115.25, 112.01, 108.47, 61.17, 60.42,
55.93, 55.58, 42.24. HRMS (ESI) m/z: 374.1599 [MþH]þ, calcd. for
C20H23NO6: 374.1598.
4.1.3. General synthesis of compounds 2be6b
The corresponding cinnamic acid (1.0 equiv.) was dissolved in
MeOH, then SOCl2 (1.0 equiv.) was added. The mixture was stirred
at room temperature for 2 h. Reaction was monitored by TLC. After
completion of the reaction, evaporate the solution and purify the
crud product by flash chromatography. TMP (1.2 equiv.) were added
to the methyl esterfied cinnamic acid dissolved in DMF under
catalysis by K2CO3 (2.0 equiv.), the mixture was stirred at 80
C for
4 h. As indicated by TLC, the reagent was extracted with ethyl ac-
etate 3 times after completion of the reaction. And then anhydrous
Na2SO4 and saturated NaCl were used to dry the organic layer over.
Evaporating the solvent under vacuum. The product we obtained
was dissolved by the solvent THF-MeOH-H2O (3:1:1), then NaOH
(10%) was added. The mixture was stirred at 60
C for 2 h. The pH of
the product was adjusted to 7 with hydrochloric acid, and after
dried over anhydrous sodium sulfate, filtered and evaporated,
finally the EDCI (0.75 equiv.)/HOBT (0.6 equiv.)/HOBT (0.75 equiv.)
dissolved in DMF was added. The mixture was stirred at room
temperature for 4 h. The reaction solution was filtered and evapo-
rated with vacuum. The product was lyophilized after separation by
flash chromatography.
4.1.3.1. (E)-3-(2-((3,5,6-trimethylpyrazin-2-yl)methoxy)phenyl)-N-
(4-hydroxy-3-methoxybenzyl)acrylamide (compound 2b).
White powder, m.p.: 179.4e180.3
C, yield: 43.15%. 1H NMR
(400 MHz, DMSO‑d6) d (ppm): 8.85 (s, 1H, -OH), 8.44 (s, 1H, -NH),
7.70 (d, J ¼ 15.9 Hz, 1H), 7.55 (d, J ¼ 7.5 Hz, 1H), 7.37 (t, J ¼ 7.5 Hz,
1H), 7.24 (d, J ¼ 8.2 Hz, 1H), 7.02 (t, J ¼ 7.3 Hz, 1H), 6.85 (s, 1H), 6.68
(dt, J ¼ 23.8, 11.9 Hz, 3H), 5.25 (s, 2H, -CH2), 4.26 (d, J ¼ 4.9 Hz, 2H,
-CH2), 3.75 (s, 3H, -OCH3), 2.50 (s, 3H, -CH3), 2.47 (s, 6H, 2*-CH3);
13
C NMR (100 MHz, DMSO‑d6) d (ppm): 165.38, 156.82, 151.65,
149.84, 148.85, 147.91, 145.98, 145.65, 133.62, 131.27, 130.53, 127.53,
124.19, 122.86, 121.67, 120.45, 115.71, 113.64, 112.41, 70.32, 56.04,
42.68, 21.75, 21.48, 20.64. HRMS (ESI) m/z: 434.2055 [MþH]þ, calcd.
for C25H27N3O4: 434.2074.
4.1.3.2. (E)-3-(3-((3,5,6-trimethylpyrazin-2-yl)methoxy)phenyl)-N-
(4-hydroxy-3-methoxybenzyl)acrylamide (compound 3b).
White powder, m.p.: 82.7e83.3
C, yield: 48.36%. 1H NMR
(400 MHz, DMSO‑d6) d (ppm): 8.85 (s, 1H, -OH), 8.46 (s, 1H, -NH),
7.43 (d, J ¼ 15.7 Hz, 1H), 7.33 (t, J ¼ 7.7 Hz, 1H), 7.25 (s, 1H), 7.16 (d,
J ¼ 7.4 Hz, 1H), 7.05 (d, J ¼ 7.4 Hz, 1H), 6.88 (s, 1H), 6.77e6.64 (m,
3H), 5.19 (s, 2H, -CH2), 4.29 (d, J ¼ 5.0 Hz, 2H, -CH2), 3.75 (s, 3H,
-OCH3), 2.50 (s, 3H, -CH3), 2.45 (s, 6H, 2*-CH3); 13C NMR (100 MHz,
DMSO‑d6) d (ppm): 165.15, 159.18, 151.50, 149.83, 148.76, 147.94,
146.02, 145.74, 139.03, 136.92, 130.49, 123.19, 120.72, 120.48, 116.39,
11
115.73, 114.16, 112.47, 69.84, 56.07, 42.74, 21.73, 21.44, 20.64. HRMS
(ESI) m/z: 434.2056 [MþH]þ, calcd. for C25H27N3O4: 434.2074.
4.1.3.3. (E)-3-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)phenyl)-N-
(4-hydroxy-3-methoxybenzyl)acrylamide (compound 4b).
White powder, m.p.: 92.6e93.7
C, yield: 46.37%. 1H NMR
(400 MHz, DMSO‑d6) d (ppm): 8.86 (s, 1H, -OH), 8.40 (s, 1H, -NH),
7.52 (d, J ¼ 7.9 Hz, 2H), 7.43 (d, J ¼ 15.7 Hz, 1H), 7.08 (d, J ¼ 7.9 Hz,
2H), 6.88 (s, 1H), 6.72 (q, J ¼ 7.9 Hz, 2H), 6.56 (d, J ¼ 15.7 Hz, 1H),
5.20 (s, 2H, -CH2), 4.30 (d, J ¼ 4.5 Hz, 2H, -CH2), 3.76 (s, 3H, -OCH3),
2.50 (s, 3H, -CH3), 2.46 (s, 6H, 2*-CH3); 13C NMR (100 MHz,
DMSO‑d6) d (ppm): 165.02, 159.37, 151.06, 149.33, 148.32, 147.45,
145.51, 145.17, 138.36, 130.15, 129.06, 127.93, 119.99, 115.25, 115.17,
111.98, 69.39, 55.58, 42.23, 21.26, 20.97, 20.16. HRMS (ESI) m/z:
434.2063 [MþH]þ, calcd. for C25H27N3O4: 434.2074.
4.1.3.4. (E)-3-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-
methoxyphenyl)-N-(4-hydroxy-3-methoxybenzyl)acrylamide (com-
pound 5b). White powder, m.p.: 112.0e112.8
C, yield: 48.10%. 1H
NMR (400 MHz, DMSO‑d6) d (ppm): 8.89 (s, 1H, -OH), 8.41 (s, 1H,
-NH), 7.44 (d, J ¼ 15.8 Hz, 1H), 7.22 (s, 1H), 7.17 (q, J ¼ 8.4 Hz, 2H),
6.92 (s, 1H), 6.75 (q, J ¼ 8.4 Hz, 2H), 6.63 (d, J ¼ 15.8 Hz, 1H), 5.20 (s,
2H, -CH2), 4.32 (d, J ¼ 5.0 Hz, 2H, -CH2), 3.82 (s, 3H, -OCH3), 3.80 (s,
3H, -OCH3),2.54 (s, 3H, -CH3), 2.50 (s, 6H, 2*-CH3); 13C NMR
(100 MHz, DMSO‑d6) d (ppm): 164.98, 151.05, 149.53, 149.28, 148.97,
148.25, 147.43, 145.49, 145.24, 138.64, 130.14, 128.42, 121.09, 120.29,
119.96, 115.23, 113.70, 111.97, 110.38, 70.09, 55.58, 55.48, 42.22,
21.24, 20.94, 20.12. HRMS (ESI) m/z: 464.2165 [MþH]þ, calcd. for
C26H29N3O5: 464.2180.
4.1.3.5. (E)-3-(3-((3,5,6-trimethylpyrazin-2-yl)methoxy)-4-
methoxyphenyl)-N-(4-hydroxy-3-methoxybenzyl)acrylamide (com-
pound 6b). White powder, m.p.: 124.5e125.2
C, yield: 48.35%. 1H
NMR (400 MHz, DMSO‑d6) d (ppm): 8.85 (s, 1H, -OH), 8.39 (s, 1H,
-NH), 7.39 (d, J ¼ 15.7 Hz, 2H), 7.16 (d, J ¼ 8.3 Hz, 1H), 7.01 (t,
J ¼ 8.3 Hz, 1H), 6.88 (s, 1H), 6.72 (q, J ¼ 8.3 Hz, 2H), 6.58 (t,
J ¼ 15.7 Hz, 1H), 5.17 (s, 2H, -CH2), 4.29 (d, J ¼ 4.9 Hz, 2H, -CH2), 3.78
(s, 3H, -OCH3), 3.76 (s, 3H, -OCH3), 2.51 (s, 3H, -CH3), 2.46 (s, 6H, 2*-
CH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.03, 151.07, 150.50,
149.60, 148.24, 147.79, 147.44, 145.49, 145.29, 138.66, 130.19, 127.70,
121.90, 120.10, 119.94, 115.23, 112.51, 112.15, 111.95, 70.15, 55.63,
55.58, 21.25, 20.93, 20.13. HRMS (ESI) m/z: 464.2188 [MþH]þ, calcd.
for C26H29N3O5: 464.2180.
4.1.4. General synthesis of compounds 1c, 7c-16c
To a mixture of 1a, 7a-16a (1.0 equiv.) and anhydrous K2CO3 (2.0
equiv.) in anhydrous DMF, the TMP (1.2 equiv.) was added. The
mixture was stirred at 80
C for 4 h. As indicated by TLC, the reagent
was extracted with ethyl acetate 3 times after completion of the
reaction. And then anhydrous Na2SO4 and saturated NaCl were
used to dry the organic layer over. Evaporating the solvent under
vacuum, purification of the crude products was performed by flash
chromatography.
4.1.4.1. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-
methoxybenzyl)cinnamamide (compound 1c). White powder, m.p.:
121.6e122.2
C, yield: 65.54%. 1H NMR (400 MHz, DMSO‑d6)
d (ppm): 8.54 (s, 1H, -NH), 7.57 (d, J ¼ 6.8 Hz, 2H), 7.48 (d,
J ¼ 15.8 Hz, 1H), 7.44e7.33 (m, 3H), 7.06 (t, J ¼ 8.0 Hz, 1H), 6.96 (s,
1H), 6.82 (d, J ¼ 8.0 Hz, 1H), 6.70 (d, J ¼ 15.8 Hz, 1H), 5.10 (s, 2H,
-CH2), 4.34 (s, 2H, -CH2), 3.74 (s, 3H, -OCH3), 2.50 (s, 3H, -CH3), 2.45
(s, 6H, 2* -CH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.02,
151.11, 149.76, 149.42, 148.35, 146.94, 145.77, 139.06, 135.11, 132.82,
129.64, 129.13, 127.72, 122.33, 119.75, 114.26, 112.09, 70.59, 55.75,
42.38, 21.44, 21.14, 20.33. HRMS (ESI) m/z: 418.2116 [MþH]þ, calcd.
12 W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695
for C25H27N3O3: 418.2125.
4.1.4.2. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-
methoxybenzyl)-3-(2-methoxyphenyl)acrylamide (compound 7c).
White powder, m.p.: 148.9e149.8
C, yield: 70.32%. 1H NMR
(400 MHz, DMSO‑d6) d (ppm): 8.51 (s, 1H, -NH), 7.70 (d, J ¼ 15.9 Hz,
1H), 7.52 (d, J ¼ 7.5 Hz, 1H), 7.37 (t, J ¼ 7.5 Hz, 1H), 7.06 (t, J ¼ 9.2 Hz,
2H), 6.99 (t, J ¼ 9.2 Hz, 1H), 6.95 (s, 1H), 6.81 (d, J ¼ 8.1 Hz, 1H), 6.71
(d, J ¼ 15.9 Hz, 1H), 5.10 (s, 2H, -CH2), 4.33 (d, J ¼ 5.0 Hz, 2H, -CH2),
3.86 (s, 3H, -OCH3), 3.74 (s, 3H, -OCH3), 2.50 (s, 3H, -CH3), 2.45 (s,
6H, 2* -CH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.18, 157.51,
150.89, 149.54, 149.19, 148.13, 146.69, 145.56, 133.88, 132.71, 130.80,
127.80, 123.27, 122.48, 120.67, 119.53, 114.06, 111.90, 111.67, 70.37,
55.53, 42.14, 21.22, 20.93, 20.11. HRMS (ESI) m/z: 448.2225 [MþH]þ,
calcd. for C26H29N3O4: 448.2231.
4.1.4.3. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-
methoxybenzyl)-3-(3-methoxyphenyl)acrylamide (compound 8c).
White powder, m.p.: 161.3e162.4
C, yield: 69.94%. 1H NMR
(400 MHz, DMSO‑d6) d (ppm): 8.52 (s, 1H, -NH), 7.44 (d, J ¼ 15.8 Hz,
1H), 7.33 (d, J ¼ 7.8 Hz, 1H), 7.15 (d, J ¼ 7.8 Hz, 1H), 7.13 (s, 1H), 7.05
(d, J ¼ 8.1 Hz, 1H), 6.95 (s, 2H), 6.82 (d, J ¼ 8.1, 1H), 6.70 (d,
J ¼ 15.8 Hz, 1H), 5.10 (s, 2H, -CH2), 4.34 (d, J ¼ 5.2 Hz, 2H, -CH2), 3.79
(s, 3H, -OCH3), 3.74 (s, 3H, -OCH3), 2.50 (s, 3H, -CH3), 2.45 (s, 6H, 2*
-CH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.25, 160.06,
151.38, 150.03, 149.69, 148.62, 147.21, 146.04, 139.23, 136.83, 133.08,
130.44, 122.96, 120.34, 120.02, 115.72, 114.55, 113.10, 112.38, 70.86,
56.04, 55.58, 42.65, 21.71, 21.42, 20.60. HRMS (ESI) m/z: 448.2233
[MþH]þ, calcd. for C26H29N3O5: 448.2231.
4.1.4.4. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-
methoxybenzyl)-3-(4-methoxyphenyl)acrylamide (compound 9c).
White powder, m.p.: 136.4e137.2
C, yield: 73.13%. 1H NMR
(400 MHz, DMSO‑d6) d (ppm): 8.44 (s, 1H, -NH), 7.52 (d, J ¼ 8.2 Hz,
2H), 7.42 (d, J ¼ 15.8 Hz, 1H), 7.05 (d, J ¼ 8.2 Hz, 1H), 6.98 (d,
J ¼ 8.2 Hz, 2H), 6.95 (s, 1H), 6.91 (d, J ¼ 7.7, 1H), 6.55 (d, J ¼ 15.8 Hz,
1H), 5.10 (s, 2H, -CH2), 4.33 (d, J ¼ 4.6 Hz, 2H, -CH2), 3.79 (s, 3H,
-OCH3), 3.74 (s, 3H, -OCH3), 2.50 (s, 3H, -CH3), 2.45 (s, 6H, 2* -CH3);
13
C NMR (100 MHz, DMSO‑d6) d (ppm): 165.11, 160.29, 150.88,
149.54, 149.20, 148.13, 146.69, 145.55, 138.53, 132.76, 129.06, 127.45,
119.62, 119.49, 114.36, 114.06, 111.86, 70.38, 55.54, 55.23, 42.11,
21.22, 20.92, 20.10. HRMS (ESI) m/z: 448.2225 [MþH]þ, calcd. for
C26H29N3O5: 448.2231.
4.1.4.5. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-
methoxybenzyl)-3-(2,3-dimethoxyphenyl)acrylamide (compound
10c). White powder, m.p.: 146.7e147.6
C, yield: 68.49%. 1H NMR
(400 MHz, DMSO‑d6) d (ppm): 8.56 (s, 1H, -NH), 7.67 (d, J ¼ 15.9 Hz,
1H), 7.13 (t, J ¼ 9.4 Hz, 2H), 7.08 (d, J ¼ 8.5 Hz, 2H), 6.96 (s, 1H), 6.82
(d, J ¼ 8.5 Hz, 1H), 6.71 (d, J ¼ 15.9 Hz, 1H), 5.10 (s, 2H, -CH2), 4.34 (d,
J ¼ 4.4 Hz, 2H, -CH2), 3.83 (s, 3H, -OCH3), 3.75 (s, 6H, 2* -OCH3), 2.50
(s, 3H, -CH3), 2.45 (s, 6H, 2* -CH3); 13C NMR (100 MHz, DMSO‑d6)
d (ppm): 164.94, 152.85, 150.91, 149.56, 149.20, 148.15, 147.38,
146.73, 145.56, 133.28, 132.62, 128.49, 124.36, 123.32, 119.58, 118.51,
114.06, 113.78, 111.92, 70.37, 60.63, 55.76, 55.55, 42.19, 21.24, 20.94,
20.12. HRMS (ESI) m/z: 478.2325 [MþH]þ, calcd. for C27H31N3O5:
478.2336.
4.1.4.6. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-
methoxybenzyl)-3-(3,4-dimethoxyphenyl)acrylamide (compound
11c). White powder, m.p.: 136.6e137.9
C, yield: 65.36%. 1H NMR
(400 MHz, DMSO‑d6) d (ppm): 8.46 (s, 1H, -NH), 7.45 (d, J ¼ 15.8 Hz,
1H), 7.42 (d, J ¼ 15.8 Hz, 1H), 7.21 (s, 1H), 7.16 (d, J ¼ 8.2 Hz, 1H), 7.09
(d, J ¼ 8.2 Hz, 1H), 7.03 (d, J ¼ 8.2 Hz, 1H), 6.99 (s, 1H), 6.85 (d,
J ¼ 8.0 Hz, 1H), 5.14 (s, 2H, -CH2), 4.37 (d, J ¼ 4.8 Hz, 2H, -CH2), 3.83
(s, 6H, 2* -OCH3), 3.78 (s, 3H, -OCH3), 2.54 (s, 3H, -CH3), 2.49 (s, 6H,
2* -CH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 171.55, 165.13,
150.91, 150.09, 149.55, 149.20, 148.88, 148.15, 146.69, 145.57, 138.89,
132.77, 127.69, 121.33, 119.85, 119.48, 114.04, 111.85, 111.73, 110.01,
70.38, 55.55, 55.39, 42.14, 21.23, 20.94, 20.12. HRMS (ESI) m/z:
478.2332 [MþH]þ, calcd. for C27H31N3O5: 478.2336.
4.1.4.7. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-
methoxybenzyl)-3-(3,5-dimethoxyphenyl)acrylamide (compound
12c). White powder, m.p.: 135.8e136.9
C, yield: 61.47%. 1H NMR
(400 MHz, DMSO‑d6) d (ppm): 8.53 (s, 1H, -NH), 7.71 (d, J ¼ 15.9 Hz,
1H), 7.14e7.08 (m, 2H), 7.05 (d, J ¼ 8.1 Hz, 1H), 6.99 (s, 2H), 6.86 (d,
J ¼ 8.1 Hz, 1H), 6.77 (d, J ¼ 15.9 Hz, 1H), 5.14 (s, 2H, -CH2), 4.37 (d,
J ¼ 4.9 Hz, 2H, -CH2), 3.85 (s, 3H, -OCH3), 3.78 (s, 6H, 2* -OCH3), 2.54
(s, 3H, -CH3), 2.49 (s, 6H, 2* -CH3); 13C NMR (100 MHz, DMSO‑d6)
d (ppm): 165.12, 153.11, 151.89, 150.91, 149.55, 149.19, 148.15, 146.71,
145.56, 133.67, 132.68, 123.92, 122.86, 119.55, 116.11, 114.05, 112.94,
112.42, 111.91, 70.37, 56.01, 55.55, 55.41, 42.18, 21.23, 20.94, 20.12.
HRMS (ESI) m/z: 478.2333 [MþH]þ, calcd. for C27H31N3O5:
478.2336.
4.1.4.8. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-
methoxybenzyl)-3-(2,5-dimethoxyphenyl)acrylamide (compound
13c). White powder, m.p.: 151.5e152.7
C, yield: 66.82%. 1H NMR
(400 MHz, DMSO‑d6) d (ppm): 8.53 (t, J ¼ 5.3 Hz, 1H, -NH), 7.71 (d,
J ¼ 15.9 Hz, 1H), 7.10 (dd, J ¼ 9.0, 8.1 Hz, 2H), 7.05 (d, J ¼ 9.0 Hz, 1H),
6.99 (s, 2H), 6.85 (d, J ¼ 8.1 Hz, 1H), 6.76 (d, J ¼ 15.9Hz, 1H), 5.14 (s,
2H, -CH2), 4.37 (d, J ¼ 5.5 Hz, 2H, -CH2), 3.85 (s, 3H, -OCH3), 3.78 (s,
6H, 2* -OCH3), 2.54 (s, 3H, -CH3), 2.49 (s, 6H, 2* -CH3); 13C NMR
(100 MHz, DMSO‑d6) d (ppm): 165.12, 153.11, 151.89, 150.90, 149.55,
149.19, 148.14, 146.71, 145.56, 133.66, 132.68, 123.92, 122.86, 119.55,
116.10, 114.04, 112.93, 112.41, 111.91, 70.37, 56.00, 55.55, 55.41, 42.18,
21.23, 20.93, 20.12. HRMS (ESI) m/z: 478.2331 [MþH]þ, calcd. for
C27H31N3O5: 478.2336.
4.1.4.9. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-
methoxybenzyl)-3-(2,4,5-trimethoxyphenyl)acrylamide (compound
14c). White powder, m.p.: 156.3e157.3
C, yield: 70.01%. 1H NMR
(400 MHz, DMSO‑d6) d (ppm): 8.37 (d, J ¼ 5.4 Hz, 1H, -NH), 7.65 (d,
J ¼ 15.9 Hz, 1H), 7.08 (s, 1H), 7.04 (d, J ¼ 8.2 Hz, 1H), 6.94 (s, 1H), 6.80
(d, J ¼ 8.2 Hz, 1H), 6.72 (s, 1H), 6.59 (d, J ¼ 15.9 Hz, 1H), 5.10 (s, 2H,
-CH2), 4.32 (d, J ¼ 5.4 Hz, 2H, -CH2), 3.86 (s, 3H, -OCH3), 3.84 (s, 3H,
-OCH3), 3.74 (s, 6H, 2* -OCH3), 2.50 (s, 3H, -CH3), 2.45 (s, 6H, 2*
-CH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.56, 152.87,
151.24, 150.91, 149.55, 149.19, 148.15, 146.66, 145.57, 142.83, 133.56,
132.88, 119.71, 119.49, 114.53, 114.04, 111.87, 110.80, 97.93, 70.38,
56.29, 56.02, 55.77, 55.55, 42.13, 21.23, 20.94, 20.12. HRMS (ESI) m/
z: 508.2429 [MþH]þ, calcd. for C28H33N3O6: 508.2442.
4.1.4.10. (E)-N-(4-((3,4,5-trimethylpyrazin-2-yl)methoxy)-3-
methoxybenzyl)-3-(2,4,5-trimethoxyphenyl)acrylamide (compound
15c). White powder, m.p.: 180.6e181.9
C, yield: 72.84%. 1H NMR
(400 MHz, DMSO‑d6) d (ppm): 8.45 (s, 1H, -NH), 7.41 (d, J ¼ 15.9 Hz,
1H), 7.03 (d, J ¼ 8.1 Hz, 1H), 6.95 (s, 1H), 6.91 (s, 2H), 6.81 (d,
J ¼ 8.1 Hz, 1H), 6.65 (d, J ¼ 15.9 Hz, 1H), 5.10 (s, 2H, -CH2), 4.33 (d,
J ¼ 5.4 Hz, 2H, -CH2), 3.82 (s, 6H, 2* -OCH3), 3.74 (s, 3H, -OCH3), 3.69
(s, 3H, -OCH3), 2.50 (s, 3H, -CH3), 2.45 (s, 6H, 2* -CH3); 13C NMR
(100 MHz, DMSO‑d6) d (ppm): 164.68, 152.86, 150.71, 149.35,
148.99, 147.95, 146.49, 145.36, 138.75, 138.43, 132.46, 130.33, 121.30,
119.29, 113.83, 111.66, 104.72, 70.16, 59.88, 55.65, 55.35, 41.96, 21.03,
20.73, 19.91. HRMS (ESI) m/z: 508.2434 [MþH]þ, calcd. for
C28H33N3O6: 508.2442.
4.1.4.11. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-
methoxybenzyl)-3-(2,3,4-trimethoxyphenyl)acrylamide (compound
 W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695
16c). White powder, m.p.: 174.6e175.3
C, yield: 71.24%. 1H NMR
(400 MHz, DMSO‑d6) d (ppm): 8.48 (t, J ¼ 5.7 Hz, 1H, -NH), 7.57 (d,
J ¼ 15.9 Hz, 1H), 7.29 (d, J ¼ 8.9 Hz, 1H), 7.05 (d, J ¼ 8.2 Hz, 1H), 6.95
(d, J ¼ 1.8 Hz, 1H), 6.88 (d, J ¼ 8.9 Hz, 1H), 6.81(dd, J ¼ 8.2, 1.8 Hz,
1H), 6.67e6.60 (m, 1H), 5.10 (s, 2H, -CH2), 4.33 (d, J ¼ 5.8 Hz, 2H,
-CH2), 3.83 (s, 3H, -OCH3), 3.81 (s, 3H, -OCH3), 3.77 (s, 3H, -OCH3),
3.74 (s, 3H, -OCH3), 2.50 (s, 3H, -CH3), 2.45 (d, J ¼ 3.3 Hz, 6H, 2*
-CH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.26, 154.52,
152.21, 150.91, 149.55, 149.19, 148.15, 146.70, 145.56, 141.91, 133.55,
132.75, 122.45, 121.31, 121.02, 119.55, 114.05, 111.89, 108.45, 70.38,
61.16, 60.42, 55.93, 55.54, 42.15, 21.23, 20.94, 20.12. HRMS (ESI) m/z:
508.2449 [MþH]þ, calcd. for C28H33N3O6: 508.2442.
4.1.5. General synthesis of compounds 2c-6c
To a solution of 4-Hydroxy-3-methoxybenzylamine hydrochlo-
ride (1.0 equiv.) and MeOH, Et3N (1.0 equiv.) and Boc2O (1.2 equiv.)
were added. Dissolve the protected capsaicin with Boc group (1.0
equiv.) into DMF, then K2CO3 (2.0 equiv.) were added and the
mixture were stirred at 80
C for 4 h. As the reaction indicated by
TLC finished, the bocprotected compound was extracted with ethyl
acetate 3 times and the organic layer was dried over with anhy-
drous Na2SO4 and saturated NaCl. After evaporating the solvent
under vacuum, purification of the crude products was performed
by flash chromatography. Then TFA (1.5 mL) was added slowly to
the bocprotected compound in CH2Cl2 (10 mL) and the mixture was
stirred in an ice bath for 2 h. The corresponding cinnamic acid (1.0
equiv.) were then added to the TMP-Capsaicin dissolved in anhy-
drous DMF. Under catalysis by EDCI (0.75 equiv.)/HOBT (0.6 equiv.)/
DIEPA (0.75 equiv.), the mixture was stirred at room temperature
for 4 h. The reaction solution was filtered and evaporated with
vacuum. The product was lyophilized after separated by flash
chromatography.
4.1.5.1. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-
methoxybenzyl)-3-(2-hydroxyphenyl)acrylamide (compound 2c).
Yellow powder, m.p.: 167.3e168.1
C, yield: 60.39%. 1H NMR
(400 MHz, DMSO‑d6) d (ppm): 10.07 (s, 1H, -OH), 8.53 (s, 1H), 7.74
(d, J ¼ 16.0 Hz, 1H), 7.48 (d, J ¼ 7.5 Hz, 1H), 7.23 (t, J ¼ 7.5 Hz, 1H), 7.10
(d, J ¼ 8.0 Hz, 1H), 7.00 (s, 1H), 6.95 (d, J ¼ 8.0 Hz, 1H), 6.88 (t,
J ¼ 8.1 Hz, 2H), 6.77 (d, J ¼ 16.0 Hz, 1H), 5.15 (s, 2H, -CH2), 4.38 (d,
J ¼ 4.8 Hz, 2H, -CH2), 3.74 (s, 3H, -OCH3), 2.55 (s, 3H, -CH3), 2.45 (s,
6H, 2* -CH3). 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.47, 156.23,
150.85, 149.52, 149.21, 148.11, 146.68, 145.56, 134.74, 132.86, 130.39,
128.13, 121.67, 121.53, 119.49, 119.30, 116.06, 114.12, 111.89, 70.40,
55.58, 42.10, 21.22, 20.92, 20.07. HRMS (ESI) m/z: 434.2074
[MþH]þ, calcd for C25H27N3O4: 434.2074.
4.1.5.2. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-
methoxybenzyl)-3-(3-hydroxyphenyl)acrylamide (compound 3c).
Yellow powder, m.p.: 190.6e191.2
C, yield: 67.24%. 1H NMR
(400 MHz, DMSO‑d6) d (ppm): 9.63 (s, 1H, -OH), 8.57 (s, 1H, -NH),
7.42 (d, J ¼ 15.7 Hz, 1H), 7.26 (t, J ¼ 7.6 Hz, 1H), 7.10 (d, J ¼ 8.1 Hz, 1H),
7.03 (d, J ¼ 7.6 Hz, 1H), 6.89e6.81 (m, 2H), 6.65 (d, J ¼ 15.7 Hz, 1H),
5.15 (s, 2H, -CH2), 4.38 (d, J ¼ 5.0 Hz, 2H, -CH2), 3.79 (s, 3H, -OCH3),
2.55 (s, 3H, -CH3), 2.50 (s, 6H, 2* -CH3). 13C NMR (100 MHz,
DMSO‑d6) d (ppm): 164.84, 157.69, 150.92, 149.56, 149.21, 148.16,
146.73, 145.57, 139.06, 136.16, 132.62, 129.93, 121.86, 119.55, 118.73,
116.68, 114.07, 113.68, 111.89, 70.38, 55.56, 42.16, 21.24, 20.95, 20.12.
HRMS (ESI) m/z: 434.2066 [MþH]þ, calcd for C25H27N3O4:
434.2074.
4.1.5.3. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-
methoxybenzyl)-3-(4-hydroxyphenyl)acrylamide (compound 4c).
White powder, m.p.: 138.6e139.6
C, yield: 59.62%. 1H NMR
(400 MHz, DMSO‑d6) d (ppm): 9.88 (s, 1H, -OH), 8.45 (s, 1H, -NH),
13
7.43 (t, J ¼ 10.9 Hz, 3H), 7.09 (d, J ¼ 8.1 Hz, 1H), 6.99 (s, 1H), 6.85 (d,
J ¼ 8.1 Hz, 3H), 6.52 (d, J ¼ 15.7 Hz, 1H), 5.14 (s, 2H, -CH2), 4.37 (d,
J ¼ 5.0 Hz, 2H, -CH2), 3.78 (s, 3H, -OCH3), 2.54 (s, 3H, -CH3), 2.50 (s,
6H, 2* -CH3). 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.27, 158.83,
150.89, 149.54, 149.19, 148.13, 146.67, 145.56, 138.94, 132.83, 129.20,
125.88, 119.47, 118.53, 115.72, 114.06, 111.84, 70.38, 55.54, 42.08,
21.22, 20.93, 20.11. HRMS (ESI) m/z: 434.2060 [MþH]þ, calcd for
C25H27N3O4: 434.2074.
4.1.5.4. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-
methoxybenzyl)-3-(4-hydroxy-3-methoxyphenyl)acrylamide (com-
pound 5c). Yellow powder, m.p.: 96.5e97.6
C, yield: 71.66%.1H
NMR (400 MHz, DMSO‑d6) d (ppm): 9.43 (s, 1H, -OH), 8.38 (s, 1H,
-NH), 7.38 (d, J ¼ 15.7 Hz, 1H), 7.13 (s, 1H), 7.03 (dd, J ¼ 16.7, 8.0 Hz,
2H), 6.94 (s, 1H), 6.81 (d, J ¼ 8.0 Hz, 2H), 6.52 (d, J ¼ 15.7 Hz, 1H),
5.10 (s, 2H, -CH2), 4.33 (d, J ¼ 4.3 Hz, 2H,-CH2), 3.81 (s, 3H, -OCH3),
3.74 (s, 3H, -OCH3), 2.50 (s, 3H, -CH3), 2.45 (s, 6H, 2* -CH3). 13C NMR
(100 MHz, DMSO‑d6) d (ppm): 165.28, 150.89, 149.54, 149.21,
148.28, 148.13, 147.80, 146.68, 145.56, 139.23, 132.84, 126.39, 121.50,
119.47, 118.85, 115.65, 114.07, 111.86, 110.82, 70.39, 55.57, 55.53,
42.11, 21.24, 20.94, 20.12. HRMS (ESI) m/z: 464.2190 [MþH]þ, calcd
for C26H29N3O5: 464.2180.
4.1.5.5. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-
methoxybenzyl)-3-(3-hydroxy-4-methoxyphenyl)acrylamide (com-
pound 6c). White powder, m.p.: 158.3e159.1
C, yield: 68.43%.1H
NMR (400 MHz, DMSO‑d6) d (ppm): 9.19 (s, 1H, -OH), 8.44 (s, 1H,
-NH), 7.33 (d, J ¼ 15.7 Hz, 1H), 7.05 (d, J ¼ 8.0 Hz, 1H), 7.02e6.89 (m,
4H), 6.81 (d, J ¼ 8.0 Hz, 1H), 6.46 (d, J ¼ 15.7 Hz, 1H), 5.10 (s, 2H,
-CH2), 4.33 (d, J ¼ 4.8 Hz, 2H, -CH2), 3.80 (s, 3H, -OCH3), 3.74 (s, 3H,
-OCH3), 2.50 (s, 3H, -CH3), 2.45 (s, 6H, 2* -CH3). 13C NMR (100 MHz,
DMSO‑d6) d (ppm): 165.13, 150.89, 149.54, 149.20, 149.18, 148.14,
146.68, 145.56, 139.00, 132.77, 127.76, 120.27, 119.50, 119.39, 114.07,
113.31, 112.07, 111.86, 70.38, 55.58, 55.55, 42.10, 21.23, 20.93, 20.11.
HRMS (ESI) m/z: 464.2187 [MþH]þ, calcd for C26H29N3O5:
464.2180.
4.1.6. General synthesis of compounds 2d-6d
The synthesis of compounds 2d-6d was similar to that of 1c, 7c-
16c. To a mixture of 2a-6a (1.0 equiv.) and anhydrous K2CO3 (2.0
equiv.) in anhydrous DMF, the TMP (2.5 equiv.) was added. The
mixture was stirred at 85
C for 6 h. As indicated by TLC, the reagent
was extracted with ethyl acetate 3 times after completion of the
reaction. And then anhydrous Na2SO4 and saturated NaCl were
used to dry the organic layer over. After evaporating the solvent
under vacuum, purification of the crude products was performed
by flash chromatography.
4.1.6.1. (E)-3-(2-((3,5,6-trimethylpyrazin-2-yl)methoxy)phenyl)-N-
(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-methoxybenzyl)acryl-
amide (compound 2d). White powder, m.p.: 163.8e164.4
C, yield:
50.19%. 1H NMR (400 MHz,DMSO‑d6) d (ppm): 8.51 (s, 1H, -NH),
7.80e7.65 (m, 1H), 7.55 (d, J ¼ 6.3 Hz, 1H), 7.44e7.29 (m, 1H), 7.24 (d,
J ¼ 8.4 Hz, 1H), 7.03 (t, J ¼ 7.1 Hz, 2H), 6.93 (s, 1H), 6.80 (d, J ¼ 8.4 Hz,
1H), 6.73e6.62 (m, 1H), 5.43e5.23 (m, 2H, -CH2), 5.22e5.06 (m, 2H,
-CH2), 4.31 (s, 2H, -CH2), 3.73 (s, 3H, -OCH3), 2.76e2.26 (m, 18H, 6*
-CH3). 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.02, 156.35,
151.13, 150.86, 149.52, 149.33, 149.19, 148.34, 148.12, 146.68, 145.55,
145.15, 133.25, 132.66, 130.78, 127.07, 123.69, 122.29, 121.17, 119.49,
114.06, 113.15, 111.84, 70.37, 69.83, 55.53, 42.11, 20.93, 20.49, 20.11.
HRMS (ESI) m/z: 568.2912 [MþH]þ, calcd for C33H37N5O4:
568.2918.
4.1.6.2. (E)-3-(3-((3,5,6-trimethylpyrazin-2-yl)methoxy)phenyl)-N-
(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-methoxybenzyl)
14 W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695
acrylamide (compound 3d). White powder, m.p.: 163.3e164.4
C,
yield: 51.22%.1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.53 (s, 1H,
-NH), 7.44 (d, J ¼ 15.7 Hz, 1H), 7.34 (t, J ¼ 7.6 Hz, 1H), 7.26 (s, 1H), 7.17
(d, J ¼ 7.3 Hz, 1H), 7.05 (d, J ¼ 8.0 Hz, 2H), 6.95 (s, 1H), 6.82 (d,
J ¼ 8.0 Hz, 1H), 6.70 (d, J ¼ 15.7 Hz, 1H), 5.19 (s, 2H, -CH2), 5.10 (s, 2H,
-CH2), 4.34 (d, J ¼ 3.8 Hz, 2H, -CH2), 3.74 (s, 3H, -OCH3), 2.50 (s, 6H,
2* -CH3), 2.46 (s, 12H, 4* -CH3). 13C NMR (100 MHz, DMSO‑d6)
d (ppm): 165.24, 159.17, 151.51, 151.39, 150.03, 149.83, 149.68, 148.76,
148.62, 147.20, 146.04, 145.74, 139.14, 136.89, 133.08, 130.50, 123.07,
120.74, 119.99, 116.42, 114.53, 114.16, 112.35, 70.85, 69.83, 56.03,
42.65, 21.73, 21.44, 21.42, 20.65, 20.60. HRMS (ESI) m/z: 568.2925
[MþH]þ, calcd for C33H37N5O4: 568.2918.
4.1.6.3. (E)-3-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)phenyl)-N-
(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-methoxybenzyl)acryl-
amide (compound 4d). Yellow powder, m.p.: 156.4e157.3
C, yield:
50.43%.1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.46 (s, 1H, -NH),
7.52 (d, J ¼ 8.0 Hz, 2H), 7.43 (d, J ¼ 15.7 Hz, 1H), 7.19e7.01 (m, 3H),
6.95 (s, 1H), 6.82 (d, J ¼ 8.0 Hz, 1H), 6.56 (d, J ¼ 15.7 Hz, 1H), 5.20 (s,
2H, -CH2), 5.10 (s, 2H, -CH2), 4.34 (d, J ¼ 4.5 Hz, 2H, -CH2), 3.74 (s,
3H, -OCH3), 2.50 (s, 6H, 2* -CH3), 2.46 (s, 12H, 4* -CH3). 13C NMR
(100 MHz, DMSO‑d6) d (ppm): 165.10, 159.39, 151.06, 150.90, 149.55,
149.32, 149.21, 148.31, 148.15, 146.70, 145.57, 145.16, 138.46, 132.75,
129.08, 127.90, 119.87, 119.51, 115.17, 114.07, 111.87, 70.38, 69.39,
55.55, 42.13, 21.25, 20.96, 20.93, 20.15, 20.12. HRMS (ESI) m/z:
568.2907 [MþH]þ, calcd for C33H37N5O4: 568.2918.
4.1.6.4. (E)-3-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-
methoxyphenyl)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-
methoxybenzyl)acrylamide (compound 5d). Yellow powder, m.p.:
150.5e151.6
C, yield: 53.71%.1H NMR (400 MHz, DMSO‑d6)
d (ppm): 8.41 (s, 1H, -NH), 7.40 (d, J ¼ 15.7 Hz, 1H), 7.18 (s, 1H),
7.16e7.09 (m, 2H), 7.05 (d, J ¼ 7.6 Hz, 1H), 6.94 (s, 1H), 6.81 (d,
J ¼ 8.1 Hz, 1H), 6.58 (d, J ¼ 15.7 Hz, 1H), 5.16 (s, 2H, -CH2), 5.10 (s, 2H,
-CH2), 4.33 (d, J ¼ 4.5 Hz, 2H, -CH2), 3.78 (s, 3H, -OCH3), 3.74 (s, 3H,
-OCH3), 2.50 (s, 6H, 2* -CH3), 2.45 (s, 12H, 4* -CH3).13C NMR
(100 MHz, DMSO‑d6) d (ppm): 165.05, 151.00, 150.84, 149.48,
149.29, 149.21, 148.98, 148.22, 148.11, 146.68, 145.56, 145.24, 138.72,
132.75, 128.40, 121.10, 120.20, 119.48, 114.11, 113.74, 111.89, 110.43,
70.39, 70.09, 55.58, 55.52, 55.46, 42.11, 21.17, 20.87, 20.10. HRMS
(ESI) m/z: 598.3033 [MþH]þ, calcd for C34H39N5O5: 598.3024.
4.1.6.5. (E)-3-(3-((3,5,6-trimethylpyrazin-2-yl)methoxy)-4-
methoxyphenyl)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-
methoxybenzyl)acrylamide (compound 6d). White powder, m.p.:
162.7e163.1
C, yield: 54.22%.1H NMR (400 MHz, DMSO‑d6)
d (ppm): 8.43 (s, 1H, -NH), 7.38 (d, J ¼ 16.9 Hz, 1H), 7.14 (d, J ¼ 8.2 Hz,
1H), 7.02 (dd, J ¼ 15.5, 8.2 Hz, 1H), 6.94 (s, 1H), 6.80 (d, J ¼ 7.8 Hz,
1H), 6.57 (d, J ¼ 15.5 Hz, 1H), 5.16 (s, 2H, -CH2), 5.09 (s, 2H, -CH2),
4.32 (s, 2H, -CH2), 3.76 (s, 3H, -OCH3), 3.73 (s, 3H, -OCH3), 2.50 (s,
6H, 2* -CH3), 2.44 (s, 12H, 4* -CH3). 13C NMR (100 MHz, DMSO‑d6)
d (ppm): 165.61, 151.54, 151.37, 151.02, 150.09, 150.03, 149.70, 148.71,
148.62, 148.29, 147.18, 146.05, 145.78, 139.25, 133.29, 128.17, 122.43,
120.49, 119.96, 114.57, 113.02, 112.64, 112.36, 70.89, 70.65, 56.15,
56.07, 42.62, 21.74, 21.43, 21.39, 20.62. HRMS (ESI) m/z: 598.3031
[MþH]þ, calcd for C34H39N5O5: 598.3024.
4.2. Bio-evaluation methods
4.2.1. Cell culture
SH-SY5Y (Human neuroblastoma cells), HBMEC-2 (Human brain
microvascular endothelial cells) were obtained from the Chinese
Academy of Medical Sciences & Peking Union Medical College.
Cultures were maintained in DMEM/ECM supplemented with 1%
(v/v) penicillin/streptomycin and 10% (v/v) fetal bovine serum (FBS;
Thermo Technologies, New York, NY, USA) under a humidified at-
mosphere containing 5% CO2 at 37
C.
4.2.2. The establishment of H2O2-induced injury model of HBMEC-
2/SH-SY5Y cells
The cells were plated onto 96-well plates 100 mL per well at a
density of 3.5*104 cells/mL, which were incubated at 37
C, 5% CO2.
After 24 h, 100 mL cell culture medium was added to each well.
Then 40 mL H2O2 dissolved in DMEM medium were added at
various concentrations (1.8 mM, 3.6 mM, 5.4 mM, 7.2 m M,
9.0 mM) to injury group at a final concentration of 0.3 mM, 0.6 mM,
0.9 mM, 1.2 mM, 1.5 mM. At the mean time 40 mL cell culture me-
dium was added to the control group. After 4 h of incubation,
removing the liquid and washing with PBS twice. 200 mL phos-
phate buffered saline (PBS) and 20 mL MTT (5 mg/mL) were then
added per well. After 4 h of incubation, MTT solution was discard
and 150 mL DMSO was added to dissolve the MTT formazan. The
optical density (OD) was measured at a wavelength of 550 nm. The
cell viability (%) at different concentrations were calculated in the
following Equation (1).
%Survival rate¼(Injury group OD/Control group OD)*100% (1)
4.2.3. Neuroprotection assay against H2O2-induced cell death in
HBMEC-2/SH-SY5Y cells
The cells were seeded in 96-well plates 100 mL/well at a density
of 3.5*104 cells/mL, which were incubated at 37
C, 5%CO2 for 24 h.
Then the tested drugs at various concentrations (0.78 mM, 1.56 mM,
3.13 mM, 6.25 mM, 12.5 mM) were added. Each plate contained blank
group, control group, model group and drug group. After 24 h,
40 mL H2O2 solution (4.8 mM) were added to the model group and
drug group. MTT assay were then performed as described in 4.2.2.
The cell proliferation rate (%) at different concentrations were
calculated in the following Equation (2). The EC50 values were
defined as the concentration of compounds that produced a 50%
proliferation of surviving cells and calculated using the following
equation (3).
% Proliferation rate¼(Drug group OD - Injury group OD)/(Control
group - Injury group OD)*100% (2)
P
-pEC50 ¼ log Cmax - log 2  ( P - 0.75 þ 0.25Pmax þ 0.25Pmin),
P
Where Cmax ¼ maximum concentration, P ¼ sum of proliferation
rates, Pmax ¼ maximum value of proliferation rate and Pmin ¼ min-
imum value of proliferation rate (3)
4.2.4. Morphological analysis using DAPI staining and Gimesa
staining
The SH-SY5Y and HBMEC-2 cells were plated onto 24-well
plates 100 mL per well at a density of 3.5*104 cells/mL, which
were incubated at 37
C, 5%CO2. Then the compound 14a at various
concentrations (1.56 mM, 3.13 mM, 6.25 mM) were added and incu-
bated for further 24 h.40 mL H2O2 solution (4.8 mM) were then
added to the model group and drug group. After 4 h, the cell culture
medium was discarded and the cells were washed with PBS twice.
Fixing with 4% paraformaldehyde/70% cold ethanol for 10 min
respectively, Gimesa (6%)/DAPI (1 mg/mL) staining was then per-
formed for 5 min away from light. The excess dye was washed away
with PBS, and the cell morphological changes were observed under
fluorescence microscope (200  ) and was randomly selected and
photographed.
 W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695
4.2.5. Inhibition of apoptosis analysis using annexin V-FITC/PI
staining
The SH-SY5Y and HBMEC-2 cells were plated onto 6-well plates
100 mL per well at a density of 3.5*104 cells/mL, which were incu-
bated at 37
C, 5%CO2. Then the compound 14a at various concen-
trations (1.56 mM, 3.13 mM, 6.25 mM) were added and incubated for
further 24 h. 40 mL H2O2 solution (4.8 mM) were then added to the
model group and drug group. After 4 h, the cells were collected
respectively, washed with cold PBS, resuspended in 200 ml annexin-
binding buffer and stained with 5 ml annexin V-FITC for 10 min and
then 5 ml PI for 5 min per sample in dark. After that, the samples
were analyzed by flow cytometry.
4.2.6. Measurement of mitochondrial membrane potential (MMP)
The cells were seeded in 96-well plates 100 mL/well at a density
of 3.5*104 cells/mL, which were incubated at 37
C, 5%CO2 for 24 h.
Then the compound 14a at various concentrations (1.56 mM,
3.13 mM, 6.25 mM) were added and incubated. After 24 h, 40 mL H2O2
solution (4.8 mM) were added to the model group and drug group
for further 4 h. The cell culture medium was then discarded, and
Rh123 at a final concentration of 10 mg/mL was added for 30 min at
37
C. After washed twice with cold PBS, cells were immediately
observed by inverted light microscope.
4.2.7. CAM assay in vivo
The eggs were placed in the incubator for 7 days with the
temperature of 37
C and the humidity of 60%. Then the compound
14a at various concentrations (0.5 mg/mL, 1 mg/mL, 2 mg/mL) was
prepared. A small hole was opened at one end of the chamber, then
a drop of sterile saline was added to the membrane, so that the
distribution of blood vessels on the allantoic membrane was clearly
seen. Then the drug solution was applied onto the small window of
allantoic membrane. PBS was applied in control group. After 48 h of
incubation, the membrane was separated from the eggshell, then
was observed and photographed with a dissecting microscope.
4.2.8. Effects of 14a on the expression of VEGF mRNA
Total RNA of chick embryo (1 mg/mL administration group) was
extracted using Trizol Max Kit, the M-MLV kit was used for reverse
transcription, and then 20 mL loading system was configured for
Real-Time PCR detection, which containing 5 mL cDNA, 7 mL dd H2O,
10 mL SYBRmix, 0.5 mL upstream primer, 0.5 mL downstream. The
primers were synthesized by Shanghai Sangon Biotech. The
sequence was as follows.
VEGFR2: 134 bp
Forward primer 50 - AGCATAGACAGCCCTTTGGT -30
Reverse primer 50 - CACAATCTCTGCTGGTGCAA -30
Actin: 123 bp
Forward primer 50 - CTGGCACCTAGCACAATGAA -30
Reverse primer 50 - CTGCTTGCTGATCCACATCT -30
The PCR program was set as follows: 94
C 2 min; (94
C 15 s,
60
C 35 s)  40; 72
C 10 min. The results were analyzed by a
relative quantitative 2DDCT method, and then the expression of
mRNA in each group was calculated and compared.
Author contributions
Ideas and experiment design: Wen-Xi Zhang, Peng-Long Wang
and Hai-Min Lei; Chemistry and Biology: Wen-Xi Zhang, Hui Wang,
He-Rong Cui, Fei Zhou, De-Sheng Cai; Analysis and interpretation of
data: Wen-Bo Guo, Xiao-Hui Jia, Xue-Mei Huang, Yu-Qin Yang,
Hong-Shan Chen, Jin-Chai Qi, Bing-Xu; Writing and review of the
manuscript: All the authors; Study supervision: Hai-Min Lei, Peng-
15
Long Wang.
Conflicts of interest
The authors declare no conflict of interest.
Acknowledgments
This study was funded by the National Natural Science Foun-
dation of China (No.81603256), project of China Association of
Chinese Medicine (CACM-2018-QNRC2-B08), the Fundamental
Research Funds for the Central Universities (BUCM-2019-JCRC002,
2019-JYB-TD005, and BUCM-2018-2020), Beijing “high-grade, pre-
cision and advanced” project, Beijing Key Laboratory for Basic and
Development Research on Chinese Medicine (Beijing, 100102).
References
[1] C.J. Sommer, Ischemic stroke: experimental models and reality, Acta Neuro-
pathol. 133 (2017) 245e261.
[2] V.L. Feigin, C.M.M. Lawes, D.A. Bennett, C.S. Anderson, Stroke epidemiology: a
review of population-based studies of incidence, prevalence, and case-fatality
in the late 20th century, Lancet Neurol. 2 (2003) 43e53.
[3] S.E. Khoshnam, W. Winlow, M. Farzaneh, Y. Farbood, H.F. Moghaddam1,
Pathogenic mechanisms following ischemic stroke, Neurol. Sci. 38 (2017)
1167e1186.
[4] R. Rodrigo, R. Ferna ndez-Gajardo, R. Gutie rrez, J.M. Matamala, R. Carrasco,
A. Miranda-Merchak, W. Feuerhake, Oxidative stress and pathophysiology of
ischemic stroke: novel therapeutic opportunities, CNS Neurol. Disord. - Drug
Targets 12 (2013) 698e714.
[5] J. Pei, Inflammation in the pathogenesis of ischemic stroke, Front. Biosci. 20
(2015) 772e783.
[6] Y. Sun, H. Gui, Q. Li, Z.M. Luo, M.J. Zheng, J.L. Duan, X. Liu, MicroRNA-124
protects neurons against apoptosis in cerebral ischemic stroke, CNS Neurosci.
Ther. 19 (2013) 813e819.
[7] X. Geng, P. Sweena, X.M. Li, C.Y. Peng, X.M. Ji, T. Chakraborty, A.L. William,
H. Du, X. Tan, F. Ling, G. Murali, A.R. Jose, Y. Ding, Reduced apoptosis by
combining normobaric oxygenation with ethanol in transient ischemic stroke,
Brain Res. 1531 (2013) 17e24.
[8] E.T. Chouchani, V.R. Pell, E. Gaude, D. Aksentijevi, S.Y. Sundier, E.L. Robb,
A. Logan, S.M. Nadtochiy, E.N.J. Ord, A.C. Smith, F. Eyassu, R. Shirley, C.H. Hu,
A.J. Dare, A.M. James, S. Rogatti, R.C. Hartley, S. Eaton, A.S.H. Costa,
P.S. Brookes, S.M. Davidson, M.R. Duchen, K. Saeb-Parsy, M.J. Shattock,
A.J. Robinson, L.M. Work, C. Frezza, T. Krieg, M.P. Murphy, Ischaemic accu-
mulation of succinate controls reperfusion injury through mitochondrial ROS,
Nature 515 (2014) 431.
[9] Y. Sun, R. Zhu, H. Ye, K. Tang, J. Zhao, Y. Chen, Q. Liu, Z. Cao, Towards a bio-
informatics analysis of anti-Alzheimer's herbal medicines from a target
network perspective, Briefings Bioinf. 14 (2013) 327e343.
[10] Y. Fan, G.Y. Yang, Therapeutic angiogenesis for brain ischemia: a brief review,
J. Neuroimmune Pharmacol. 2 (2007) 284e289, https://doi.org/10.1007/
s11481-007-9073-3.
[11] C.F. Xia, H. Yin, Y.Y. Yao, C.V. Borlongan, L. Chao, J. Chao, Kallikrein protects
against ischemic stroke by inhibiting apoptosis and inflammation and pro-
moting angiogenesis and neurogenesis, Hum. Gene Ther. 17 (2006) 206e219.
valos, The role of angiogenesis in
[12] J.F. Arenillas, T. Sobrino, J. Castillo, A. Da
damage and recovery from ischemic stroke, Curr. Treat. Options Cardiovasc.
Med. 9 (2007) 205e212.
[13] Y. Li, Z. Lu, C.L. Keogh, S.P. Yu, L. Wei, Erythropoietin-induced neurovascular
protection, angiogenesis, and cerebral blood flow restoration after focal
ischemia in mice, J. Cereb. Blood Flow Metab. 27 (2016) 116e119.
[14] K.H. Heike Beck, Angiogenesis after cerebral ischemia, Acta Neuropathol. 117
(2009) 481e496.
[15] J. John, F. Sheila, B. Armin, S. Thomas Carmichae, A neurovascular niche for
neurogenesis after stroke, Neuroscience 26 (2006) 13007e13016.
[16] J. Chen, M. Chopp, Neurorestorative treatment of stroke: cell and pharmaco-
logical approaches, NeuroRx 3 (2006) 466e473.
[17] S. Daniel, D. Jamin, N. Kai, C. Englund, I. Mahmud, R. Hevner, Z. Molna r,
Neurovascular congruence during cerebral cortical development, Cerebr.
Cortex 19 (2009) 32e41.
[18] B. Lee, D. Clarke, A. Ahmad, M. Kahle, C. Parham, L. Auckland, C. Shaw,
M. Fidanboylu, A.W. Orr, O. Ogunshola, A. Fertala, S.A. Thomas, G.J. Bix, Per-
lecan domain V is neuroprotective and proangiogenic following ischemic
stroke in rodents, J. Clin. Investig. 121 (2011) 3005.
[19] C. Carsten, J. Vera, K. Wolfram, T. Serge, P. Nikolaus, K. Josef, Combination
therapy in ischemic stroke: synergistic neuroprotective effects of memantine
and clenbuterol, Stroke 35 (2004) 1197e1202.
[20] J.V. Ly, J.A. Zavala, G.A. Donnan, Neuroprotection and thrombolysis: combi-
nation therapy in acute ischaemic stroke, Expert Opin. Pharmacother. 7
16 W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695
(2006) 1571e1581.
[21] P.A. Lapchak, Emerging therapies: pleiotropic multi-target drugs to treat
stroke victims, Transl. Stroke Res. 2 (2011) 129e135.
[22] Y. Takabatake, E. Uno, K. Wakamatsu, N. Yamazaki, N. Hashimoto, Y. Tsuchiya,
The clinical effect of combination therapy with edaravone and sodium ozagrel
for acute cerebral infarction, Brain Nerve 55 (2003) 589e593.
[23] J.B. Wang, L.L. Huang, C. Cheng, G. Li, J.W. Xie, M.Y. Shen, Q. Chen, W.L. Li,
W.F. He, P.H. Qiu, J.Z. Wu, Design, synthesis and biological evaluation of
chalcone analogues with novel dual antioxidant mechanisms as potential
anti-ischemic stroke agents, Acta Pharm. Sin. B 9 (2019) 145e160.
[24] X. Zhang, J. Wang, C. Hong, W. Luo, C.J. Wang, Design, synthesis and evalua-
tion of genistein-polyamine conjugates as multi-functional anti-Alzheimer
agents, Acta Pharm. Sin. B 5 (2015) 67e73.
[25] P.L. Wang, R. Zhao, W. Yan, X. Zhang, H. Zhang, B. Xu, F. Chu, Y. Han, G. Li,
W. Liu, Y. Zhang, H.M. Lei, Neuroprotection by new ligustrazine-cinnamon
acid derivatives on CoCl2-induced apoptosis in differentiated PC12 cells,
Bioorg. Chem. 77 (2018) 360e369.
[26] C. Zhang, W. Yan, R. Zhao, B. Xu, X. Fang, M. Yan, Design, synthesis and
evaluation of new ligustrazine derivatives as potential plasma-stable neuro-
protective agents, MedChemComm 8 (2017) 652e656.
[27] G. Li, Y. Tian, Y. Zhang, Y. Hong, Y. Hao, C. Chen, A novel ligustrazine derivative
T-VA prevents neurotoxicity in differentiated PC12 cells and protects the
brain against ischemia injury in MCAO rats, Int. J. Mol. Sci. 16 (2015)
21759e21774.
[28] X. Zhang, R. Zhao, M. Chen, T. Ma, G. Wu, N. Xue, G. Li, H. Wang, K. Fang,
W. Zhang, P.L. Wang, H.M. Lei, Novel neuroprotective lead compound lig-
ustrazine derivative mass spectrometry fragmentation rule and metabolites in
rats by LC/LTQ-Orbitrap MS, Molecules 23 (2018) 1154.
[29] F. Zhou, G. Wu, D. Cai, B. Xu, M. Yan, T. Ma, W. Guo, W. Zhang, X. Huang, X. Jia,
Yu Yang, F. Gao, P.L. Wang, H.M. Lei, Synthesis and biological activity of gly-
cyrrhetinic acid derivatives as antitumor agents, Eur. J. Med. Chem. 6 (2019)
178.
[30] Y. Gu, J. Chen, J. Shen, Herbal medicines for ischemic stroke: combating
inflammation as therapeutic targets, J. Neuroimmune Pharmacol. 9 (2014)
313e339.
[31] A. Gaspar A, E.M. Garrido, E. M ario, Q. Elias, M. Nuno, G. Jorge, B. Fernanda,
New insights into the antioxidant activity of hydroxycinnamic acids: syn-
thesis and physicochemical characterization of novel halogenated derivatives,
Eur. J. Med. Chem. 44 (2009) 2092e2099.
[32] X. Zhang, X. He, Q. Chen, J. Lu, S. Rapposelli, R. Pi, A review on the hybrids of
hydroxycinnamic acid as multi-target-directed ligands against Alzheimer's
disease, Bioorg. Med. Chem. 26 (2017) 543e550.
[33] D.Y. Choi, Y.H. Baek, J.E. Huh, J.M. Ko, H.S. Woo, J.D. Lee, D.S. Park, Stimulatory
effect of Cinnamomum cassia and cinnamic acid on angiogenesis through up-
regulation of VEGF and Flk-1/KDR expression, Int. Immunopharmacol. 9
(2009) 967.
[34] S.H. Buck, T.F. Burks, The neuropharmacology of capsaicin: review of some
recent observations, Pharmacol. Rev. 38 (1986) 179.
[35] S. Pegorini, D. Braida, C. Verzoni, C. Guerini-Rocco, G.G. Consalez, L. Croci,
M. Sala, Capsaicin exhibits neuroprotective effects in a model of transient
global cerebral ischemia in Mongolian gerbils, Br. J. Pharmacol. 144 (2005)
727e735.
[36] M. Huang, G. Cheng, H. Tan, R. Qin, Y. Zou, Y. Wang, Y. Zhang, Capsaicin
protects cortical neurons against ischemia/reperfusion injury via down-
regulating NMDA receptors, Exp. Neurol. 295 (2017) 66e76.
[37] C.S.J. Walpole, S. Bevan, G. Bloomfield, R. Breckenridge, I.F. James, T. Ritchie,
A. Szallasi, J. Winter, R. Wrigglesworth, Similarities and differences in the
structure-activity relationships of capsaicin and resiniferatoxin analogues[J],
J. Med. Chem. 39 (1996) 2939e2952.
[38] J. Zou, P. Gao, X. Hao, et al., Recent progress in the structural modification and
pharmacological activities of ligustrazine derivatives, Eur. J. Med. Chem. 147
(2018) 150e162.
[39] N. Shao, F. Xin, Medium- and long-term efficacy of ligustrazine plus con-
ventional medication on ischemic stroke: a systematic review and meta-
analy-sis, Chin. J. Med. 33 (2013) 715e720.
[40] G. Cai, B. Liu, W. Liu, X.H. Tan, J.H. Rong, X.M. Chen, L. Tong, J.G. Shen, Buyang
Huanwu Decoction can improve recovery of neurological function, reduce
infarction volume, stimulate neural proliferation and modulate VEGF and Flk1
expressions in transient focal cerebral ischaemic rat brains,
J. Ethnopharmacol. 113 (2007) 0e299.
[41] R.L. Wei, H.J. Teng, B. Yin, Y. Xu, Y. Du, F.P. He, K.T. Chu, B.Y. Luo, G.Q. Zheng,
A systematic review and meta-analysis of Buyang Huanwu decoction in ani-
mal model of focal cerebral ischemia, Evid. Based Complement Altern. Med.
2013 (2013) 1e13.
[42] R. Zhao, X.Y. Zhang, G. Wu, B. Xu, Y. Han, M. Chen, P.L. Wang, H.M. Lei, Syn-
thesis optimization of 2-chloromethyl-3, 5, 6-trimethylpyrazine derivative as
the intermediate of ligustrazine, Northwest Pharm. J. 33 (2018) 380e384.
[43] S.H. Koh, S.H. Kim, Role of Oxidative Stress in Neurodegenerative Diseases and
Ischemic Stroke, and Prospects of Antioxidant Therapies as a New Therapeutic
Strategy, vol. 26, 2006, pp. 33e43.
[44] E. Radi, P. Formichi, C. Battisti, A. Federico, Apoptosis and oxidative stress in
neurodegenerative diseases, J. Alzheimers Dis. 42 (2014) S125eS152.
[45] G. Sun, J. Wang, X. Guo, M. Lei, Y. Zhang, X. Wang, X. Shen, L. Hu, Design,
synthesis and biological evaluation of LX2343 derivatives as neuroprotective
agents for the treatment of Alzheimer's disease, Eur. J. Med. Chem. 145 (2018)
622e633.
[46] Z. Jiang, W. Wang, C. Guo, Tetrahydroxy stilbene glucoside ameliorates H2O2-
induced human brain microvascular endothelial cell dysfunction in vitro by
inhibiting oxidative stress and inflammatory responses, Mol. Med. Rep. 16
(2017) 5219e5224.
[47] J. Xiang, Y.P. Tang, P. Wu, J.P. Gao, D.F. Cai, Chinese medicine Nao-Shuan-Tong
attenuates cerebral ischemic injury by inhibiting apoptosis in a rat model of
stroke, J. Ethnopharmacol. 131 (2010) 0e181.
[48] G.Q. Hu, X. Du, Y.J. Li, X.Q. Gao, B.Q. Chen, L. Yu, Inhibition of cerebral
ischemia/reperfusion injuryinduced apoptosis: nicotiflorin and JAK2/STAT3
pathway, Neural Regen. 01 (2017) 98e104.
[49] T.H. Sanderson, C.A. Reynolds, R. Kumar, K. Przyklenk, Molecular mechanisms
of ischemiaereperfusion injury in brain: pivotal role of the mitochondrial
membrane potential in reactive oxygen species generation[J], Mol. Neurobiol.
47 (2013) 9e23.
[50] N. Magdalena, K. Marciniak, J.Z. Nowak, VEGF as an angiogenic, neurotrophic,
and neuroprotective factor, Poste˛ py Higieny Medycyny Doswiadczalnej 59
(2015) 573.
[51] Y. Sun, K. Jin, L. Xie, J. Childs, X. Mao, A. Logvinova, D.A. Greenberg, VEGF-
induced neuroprotection, neurogenesis, and angiogenesis after focal cerebral
ischemia, J. Clin. Investig. 111 (2013) 1843e1851.
[52] G. Cai, B. Liu, W. Liu, X. Tan, J. Rong, X. Chen, L. Tong, J. Shen, Buyang Huanwu
Decoction can improve recovery of neurological function, reduce infarction
volume, stimulate neural proliferation and modulate VEGF and Flk1 expres-
sions in transient focal cerebral ischaemic rat brains, J. Ethnopharmacol. 113
(2007) 0e299.
[53] C. Lange, E. Storkebaum, C.R. Almodo var, M. Dewerchin, P. Carmeliet, Vascular
endothelial growth factor: a neurovascular target in neurological diseases,
Nat. Rev. Neurol. 12 (2016) 439.
[54] M. Oshikawa, K. Okada, N. Kaneko, K. Sawamoto, I. Ajioka, Affinity-immobi-
lization of VEGF on laminin porous sponge enhances angiogenesis in the
ischemic brain, Adv. Healthc. Mater. 6 (2017) (n/a).