Food & Nutrition Research

ISSN: 1654-6628 (Print) 1654-661X (Online) Journal homepage: https://www.tandfonline.com/loi/zfnr20

Glucomannan- and glucomannan plus spirulina-

enriched pork affect liver fatty acid profile, LDL
receptor expression and antioxidant status in
Zucker fa/fa rats fed atherogenic diets

Laura González-Torres, Cátia Matos, Miguel Vázquez-Velasco, Jorge A.

Santos-López, Iria Sánchez-Martínez, Camino García–Fernández, Sara
Bastida, Juana Benedí & Francisco J. Sánchez-Muniz

To cite this article: Laura González-Torres, Cátia Matos, Miguel Vázquez-Velasco, Jorge
A. Santos-López, Iria Sánchez-Martínez, Camino García–Fernández, Sara Bastida, Juana
Benedí & Francisco J. Sánchez-Muniz (2017) Glucomannan- and glucomannan plus spirulina-
enriched pork affect liver fatty acid profile, LDL receptor expression and antioxidant status
in Zucker fa/fa rats fed atherogenic diets, Food & Nutrition Research, 61:1, 1264710, DOI:
10.1080/16546628.2017.1264710

To link to this article: https://doi.org/10.1080/16546628.2017.1264710

© 2016 The Author(s). Published by Informa View supplementary material

UK Limited, trading as Taylor & Francis
Group.

Published online: 20 Dec 2016. Submit your article to this journal

Article views: 1431 View related articles

View Crossmark data

Full Terms & Conditions of access and use can be found at

https://www.tandfonline.com/action/journalInformation?journalCode=zfnr20
FOOD & NUTRITION RESEARCH, 2017
VOL. 61, NO. 1, 1264710
http://dx.doi.org/10.1080/16546628.2017.1264710

Glucomannan- and glucomannan plus spirulina-enriched pork affect liver fatty

acid profile, LDL receptor expression and antioxidant status in Zucker fa/fa rats
fed atherogenic diets
Laura González-Torresa, Cátia Matosa, Miguel Vázquez-Velascoa, Jorge A. Santos-López b, Iria Sánchez-
Martíneza, Camino García–Fernándezc, Sara Bastida a, Juana Benedí b and Francisco J. Sánchez-Muniz a

a
Departamento de Nutrición y Bromatología I (Nutrición), Facultad de Farmacia, Universidad Complutense de Madrid, Madrid, Spain;
b
Departmento de Farmacología, Facultad de Farmacia, Universidad Complutense de Madrid, Madrid, Spain; cDepartmento de Nutrición,
Facultad de Veterinaria, Universidad de León, León, Spain

ABSTRACT ARTICLE HISTORY

We evaluated the effects of glucomannan or glucomannan plus spirulina-restructured pork (RP) Received 23 February 2016
on liver fatty acid profile, desaturase/elongase enzyme activities and oxidative status of Zucker fa/ Revised 17 November 2016
fa rats for seven weeks. Control (C), glucomannan (G) and glucomannan/spirulina (GS)-RP; HC Accepted 17 November
2016
(cholesterol-enriched control), HG and HGS (cholesterol-enriched glucomannan and glucoman-
nan/spirulina-RP) experimental diets were tested. Increased metabolic syndrome markers were KEYWORDS
found in C, G and GS rats. Cholesterol feeding increased liver size, fat, and cholesterol and Glucomannan; spirulina;
reduced antioxidant enzyme levels and expressions. Cholesterolemia was lower in HG and HGS functional meats; oxidative
than in HC. GS vs. G showed higher stearic but lower oleic levels. SFA and PUFA decreased while stress; fatty acid profile;
MUFA increased by cholesterol feeding. The arachidonic/linoleic and docosahexaenoic/alpha- hypercholesterolemia
linolenic ratios were lower in HC, HG, and HGS vs. C, G, and GS, respectively, suggesting a
delta-6-elongase-desaturase system inhibition. Moreover, cholesterol feeding, mainly in HGS,
decreased low-density-lipoprotein receptor expression and the delta-5-desaturase activity and
increased the delta-9-desaturase activity. In conclusion, the liver production of highly unsaturated
fatty acids was limited to decrease their oxidation in presence of hypercholesterolaemia.
Glucomannan or glucomannan/spirulina-RP has added new attributes to their functional proper-
ties in meat, partially arresting the negative effects induced by high-fat-high-cholesterol feeding
on the liver fatty acid and antioxidant statuses.

Introduction mainly with an increase in low density lipoproteins

(LDL) [7].
The Zucker fa/fa rat is an animal model predisposed to
Food technology is responsible for quantitative and
obesity and metabolic syndrome. This strain is very
qualitative modifications in meat and meat matrices
sensitive to hypercaloric and hyperlipidic diets [1]
creating functional meat products. Our group has
and therefore is prone to hypercholesterolemia.
done extensive work on restructured pork (RP)
Hypercholesterolemic diets can affect the expression
enriched with different ingredients such as algae,
levels of antioxidant enzymes [2,3] while free radicals
omega-3 fatty acids and minerals [8,9]. Those RP
caused by oxidative stress can lead to cell and tissue
must be able to provide a beneficial effect on one or
damage possibly resulting in cancer or cardiovascular
more selective body functions, improving health and
disease [4,5].
wellness while reducing the risk of disease [6].
Meat and meat products are essential in a balanced
Functional ingredients such as Spirulina platensis or
and optimal diet as they contain a large number and
Konjac glucomannan are used in these modifications.
amount of nutrients such as proteins, minerals, vita-
Spirulina is a microalga rich in minerals, antioxidant
mins and fats [6]. Although meat in the diet has been
compounds (mainly carotenoids and phycocyanin) and
indicative of health and prosperity for centuries, in
a biliprotein pigment with hypocholesterolemic activity
recent decades its content in saturated fatty acids has
[10]. Konjac glucomannan is an indigestible polysac-
been associated with cardiovascular disease (CVD),
charide extracted from the tubercle of Amorphophallus

CONTACT Francisco J. Sánchez-Muniz frasan@ucm.es Departamento de Nutrición y Bromatología I. Facultad de Farmacia, Universidad
Complutense de Madrid, Plaza Ramón y Cajal s/n, 28040, Madrid, Spain
The supplemental data for this article can be accessed here.
© 2016 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted
use, distribution, and reproduction in any medium, provided the original work is properly cited.
2 L. GONZÁLEZ-TORRES ET AL.
konjac [11]. Some studies suggest the usefulness of
Konjac glucomannan in the treatment of obesity, dysli-
pidemia and diabetes [12]. Some studies also suggest
that glucomannan promotes satiety [13], has a prebio-
tic effect [14] and acts as an immunomodulator [15] or
hypocholesterolemic [16]. Glucomannan has been
added to squid surimi and promising results on cho-
lesterolemia and antioxidant status have been found in
cholesterol-fed rats, mostly when associated with spir-
ulina [17]. However, controversial results were
observed in some inflammatory biomarkers [17,18].
We very recently published results on the effects of
glucomannan and glucomannan/spirulina-enriched
RP in atherogenic diets on lipids and lipoproteins
[19]. Both RP were able to mitigate the cholesterolemic
effects of dietary cholesterol by decreasing the level of
atherogenic lipoproteins, especially in cholesterol-fed
animals.
Based on previous research done by our group, we
hypothesized that at hypercholesterolemic status the
liver increases the esterification of free-cholesterol
with oleic acid [20]. Body weight gain in cholesterol-
fed animals was also reduced probably due to a hor-
mone-sensitive lipase (HSL) increase accelerating the
release of free fatty acids from adipose tissue [19].
Nevertheless, either liver fatty acid profile or LDL
receptor (Ldlr) expression has been tested in fa/fa rats
in an attempt to discover a potential mechanism link-
ing all these results.
The biological mechanisms linking estimated desa-
turase activity with obesity and diabetes mellitus type 2
(T2DM) are still unclear. Delta-6 desaturase is the rate-
limiting step along the PUFA pathway which includes
arachidonic acid, a precursor from eicosanoids that
may act as an inflammation mediator [21]. Increased
delta-5-desaturase (D5D) activity has been associated
with high plasma concentrations of eicosapentaenoic
(EPA) and docosahexaenoic (DHA) acids, which have
anti-inflammatory properties and triglyceride-lowering
effects [22]. Stearoyl-CoA desaturase-1 (SCD1) is the
rate-limiting enzyme in the synthesis of MUFAs [23].
Genetic variants of SCD1 have been associated with
dyslipidemia, inflammation and increased liver fat in
T2DM [24].
The relevance of the present work lies in the possible
application of Glucomannan- and spirulina-RP to
improve the liver fatty acid and antioxidant status
profiles of hypercholesterolemic rats. Thus, we
hypothesized that adding glucomannan or glucoman-
nan plus spirulina to RP would ameliorate the negative
effect of cholesterol feeding on both profiles. As no
studies have been performed to evaluate these changes,
the aims of this paper were to evaluate the effect that
glucomannan/glucomannan plus spirulina-RP con-
sumption in fa/fa rats have on main liver characteris-
tics: (a) size, fat and cholesterol content; (b) fatty acid
composition and Ldlr expression; (c) desaturases and
desaturase-elongase activities; (d) antioxidant status
based on the quantification of activities and expres-
sions of several antioxidant enzymes.
Material and methods
Diet preparation and experimental design
This study was approved by the Spanish Science and
Technology Advisory Committee (project AGL
2008–04892-C03-02 and Consolider Ingenio 2010,
CSD 2007–00016) and by the ethics committee of the
Complutense University of Madrid (Spain). All experi-
ments were performed in compliance with Directive
2003/65/EEC of the European Parliament and of the
Council of 22 July 2003 on the protection of animals
used for scientific purposes. A total of thirty-six grow-
ing male Zucker fa/fa rats with an initial body weight
of approximately 120 g were obtained from Harlan
Laboratories Models (Harlan, SL, Barcelona, Spain).
The animals were housed individually in metabolic
cells in a temperature-controlled room (22.3 ± 1.9 °C)
with a 12 h light-dark cycle. The rats were fed com-
mercial pellets (Panlab, Barcelona, Spain) for one week
to adapt to environmental conditions and then distrib-
uted into six groups of six animals each according to
their average body weight. Rats were fed the experi-
mental diets for 7 weeks. Food consumption was mea-
sured daily and body weight once per week. Tap water
was provided ad libitum over the experimental period
with an average consumption of 10 mL/100 g body
weight/day. In order to avoid inter-assay variations
that could affect the comparison of data from the
different groups, at the end of the experiment fasting
rats were taken one at a time from each of the six
groups, anesthetized with pentobarbital (45 mg/kg)
and euthanized by extracting blood from the descend-
ing aorta with a syringe. Then, plasma was separated by
centrifugation at 2000 g for 10 min. Livers were col-
lected and weighted immediately after blood
extraction.
Glucomannan (Amorphophallus konjac; powder
from Guinama, S.L.U., Valencia, Spain; 22.5 g/kg
diet) and Spirulina (Arthrospira maxima; micronized
powder from Arkopharma, Madrid, Spain; 3.0 g/kg
diet) were used in the preparation of diets and calcu-
lated according to previous studies from Hozumi et al.
(1995), Bermejo-Bescós et al. (2008), and Ou et al.
(2013). Pork was purchased at a local market, then

freeze-dried and mixed with the rest of the ingredients
until fully homogenous to form the restructured pork
(RP). The following six semi-synthetic experimental
diets were prepared: control diet with no added cho-
lesterol (C) was composed of a homogeneous mixture
of 85% rodent diet (AIN-93M purified rodent diet;
Dyets, Inc., Bethlehem, PA, USA) [25] and 15%
freeze-dried RP (with 15% microcrystalline cellulose);
glucomannan normocholesterolaemic diet (G) con-
sisted of a mixture of AIN-93M no.102635 feed (85%)
and freeze-dried glucomannan-enriched RP (15%); glu-
comannan plus spirulina normocholesterolaemic diet
(GS) consisted of a mixture of AIN-93M no.102635
feed (85%) and freeze-dried glucomannan plus spiru-
lina-enriched RP (15%); cholesterol-enriched control
diet (HC) was identical to diet C but with 2.43%
cholesterol (95–98% purity) and 0.49% cholic acid
(98% purity) replacing an equal amount of corn starch
(AIN-93M no. 102,636 diet); cholesterol-enriched glu-
comannan diet (HG) was the G diet enriched with
cholesterol (2.43%) and cholic acid (0.49%); the cho-
lesterol-enriched glucomannan plus spirulina diet
(HGS) consisted of the GS diet enriched with choles-
terol (2.43%) and cholic acid (0.49%). The amount of
cholesterol and cholic acid added to diet was based on
previous studies [26]. Diets were designed to cover rat
nutritional requirements. Details of diet composition
can be found in the Supplementary Table.
Determination of fatty acid profile in liver
Liver fat was extracted following the Folch method
[27]. 50 mg of fat were characterized in the form of
methyl esters in capillary gas chromatography in accor-
dance with the procedure followed by Carrapiso et al.
[28]. Gas chromatography (GC) was performed using
an HP 5890II (Hewlett Packard) equipped with a cold
on-column injector and a flame ionization detector
(FID). Individual fatty acid methyl esters (FAMEs)
were separated with a 30 m × 0.53 mm capillary col-
umn coated with FFAP-TPA stationary phase (1 mm
thickness). The GC conditions were as follows: oven
temperature 220 °C isothermal for 30 min, injector and
detector temperature 230 °C. The flow rate of the
carrier gas (nitrogen) was 2.6 ml/min and 0.1 ml of
solution was injected. Chromatographic data were
recorded and integrated in an HP computer (HP
Vectra QS/20) using a Hewlett Packard ChemStation
A.01.14 software. Fatty acid methyl esters were identi-
fied by comparison of retention times with standards.
Peak areas were corrected using FID response factors
estimated from standards. The concentrations of FA
(g/100 g methyl ester) were calculated by means of the
FOOD & NUTRITION RESEARCH 3
internal standard (tridecanoic acid methyl ester) and
sample weight. Some products-to-precursor ratios were
used as surrogated indices of enzymes desaturase [24]
or desaturase-elongase activities [29], using the follow-
ing formulas:
Delta-6-elongase-desaturase:
(a) Docosahexahenoic acid/linolenic acid (C22:6
n-3/C18:3 n-3)
(b) Arachidonic acid/linoleic acid (C20:4n-6/
C18:2 n-6)
Stearoyl-CoA activity:
Palmitoleic acid/palmitic acid (C16:1 n-7/C16:0)
Oleoyl-CoA activity:
Oleic acid/stearic acid (C18:1 n-9/C18:0)
Delta 5 desaturase activity:
Arachidonic acid/eicosatrienoic acid (C20:4 n-6/
C20:3 n-6)
Delta-6 desaturase activity:
Gamma-linolenic acid/linoleic acid (C18:3 n-6/
C18:2 n-6)
Western blotting and protein levels
Total liver protein lysates were obtained and separated
in 10% sodium dodecyl sulfate-poly-acrylamide gel
electrophoresis (SDS-PAGE). Gels were then blotted
onto PVDF Amersham Hybond-P membranes (GE
Health-care, Buckinghamshire, UK) and incubated
with their corresponding antibodies (anti-β-actin
(A2228), anti-catalase (C0979), anti-superoxide dismu-
tase (S2147) from Sigma–Aldrich, St. Louis, Missouri,
USA; anti-glutathione peroxidase (Ab59546), from
Abcam, Cambridge, UK; anti-glutathione reductase
(sc-32886) from Santa Cruz Biotechnology, Dallas,
Texas, USA). β-actin was used as loading control.
Blots were developed by enhanced chemiluminescence
using an Amersham ECL Plus Western Blotting
Detection Reagent (GE Health-care, Buckinghamshire,
UK) according to manufacturer’s instructions.
RNA extraction
Total RNA was isolated from 100 mg of liver using
Trizol (Invitrogen, Carlsbad, CA, USA) according to
the manufacturer’s instructions.
RNA degradation
Isolated RNA samples were treated with DNase I
RNase-free, DNase treatment and removal reagents
(Thermo Fisher Scientific, Waltham, Massachusetts,
USA) to remove any contamination with genomic
DNA. To check the potential RNA degradation the
4 L. GONZÁLEZ-TORRES ET AL.
methodology published in Sample preparation techni-
ques in analytical chemistry [30] was followed, we per-
formed an agarose gel (1.3%) to visualize the 18S and
28S bands and determine whether degradation have
occurred during the isolation procedure, or if the
RNA was degraded in the tissue prior to RNA isolation.
RNA integrity and quantification
To verify the integrity and to quantify RNA, the Fleige
and Pfuffl protocol [31] with slight modifications was
followed. This protocol permitted us to confirm the
contaminants absence of RNA with proteins, salts, or
organic reagents such as phenol or chloroform. Thus,
we performed a quantity and integrity assessment
using a UV/VIS spectrophotometer at multiple wave
lengths: at 260 nm for nucleic acids; 270 nm for pos-
sible contaminants, mainly phenol derivates; 280 nm
for proteins; and 310 nm for background and presence
of salts or organic solvents. The 260 nm/280 nm ratio
was used to verify the RNA integrity, and the 260 nm/
310 nm ratio to verify the purity and the extraction
performance. A 260 nm/280 nm ratio greater than 1.9
was considered an acceptable indicator of good RNA
quality.
Gene expression and quantification by RT-PCR
Total RNA of each sample (1 µg) was reverse-tran-
scribed to first-strand complementary DNA (cDNA)
using a Revert Aid H minus first strand cDNA synth-
esis kit (Thermo Fisher Scientific, Waltham,
Massachusetts, USA).
Relative superoxide dismutase (Cu/Zn-SOD, Mn-
SOD), catalase (CAT), glutathione peroxidise (GPx),
glutathione reductase (GR) and Ldlr mRNA levels
were quantified using RT-PCR with a LightCycler
Real Time PCR Detection System (Roche Diagnostics,
Indianapolis, Indiana, USA), using a SYBR® Green
(Biotools, Madrid, Spain) as binding dye.
The PCR parameters were as follows: preincubation
at 95 °C for 10 minutes followed by 40 cycles of
denaturation at 95 °C for 5 s, with an annealing tem-
perature dependent of each couple primer (55 °C for
Mn-SOD; 56 °C for Cu/Zn-SOD, 67 ºC for Ldlr and 60
ºC for CAT, GPx and GR), extension 72 °C for 30 s.
Melting curve 95 °C–65 °C–95 °C and cooling 40 °C.
For each gene, primers were designed using average
melting temperature settings near to 60 °C and
Amplicon product sizes ranging from 70 to 180 bp.
Primers sequences were obtained from GenBank of
NCBI as follows:
Cu/Zn-SOD sense: 5ʹ GCCGTGTGCGTGCTGAA 3ʹ
Cu/Zn-SOD antisense: 5ʹ TGACGATGCCGTGCTG
CATG 3ʹ
Mn-SOD sense: 5ʹ GACAAACCTGAGCCCTAAGGG 3ʹ
Mn-SOD antisense: 5ʹ CTTCTTGCAAACTATG 3ʹ
CAT sense: 5ʹ ATCAGGGATGCCATGTTGTT 3ʹ
CAT antisense: 5ʹ GGGTCCTTCAGGTGAGTTTG 3ʹ
GR sense: 5ʹ TCA CTG CTC CGC ACA TCC 3ʹ
GR antisense: 5ʹCTC AAC ACC GCC AGC GTT
CTCC 3ʹ
GPx sense: 5ʹCCAATCAGTTCGGACACCAG 3ʹ
GPx antisense: 5ʹAAAGTTCCAGGCAATGTCGT 3ʹ
Ldlr sense: 5ʹ CTGTATTCACGGTAGCCGCC 3ʹ
Ldlr antisense: 5ʹ TGGGTCACATTGATGCAGCC 3ʹ
β-Actin sense: 5ʹ TACAACCTCCTTGCAGCTCC 3ʹ
β-Actin antisense: 5ʹGGATCTTCATGAGGTAGTCA
GTC 3ʹ
All sample mRNA levels were normalized to their
values of β-actin and the results expressed as fold
changes of threshold cycle (Ct) value relative to con-
trols using the 2−ΔΔCt method [32].
Determination of glutathione and redox index
The determination of oxidized (GSSG) and reduced
(GSH) glutathione was performed according to the
Hissin and Hilf method [33]. This method is based
on the ability of GSH to react with a fluorescent dye
(o-phthaldialdehyde, OPT). Liver tissue was homoge-
nized in phosphate-EDTA buffer (0.1M sodium phos-
phate and 0.005M EDTA, pH 8) at 100 mg/mL, with
the addition of 10 µL/mL of perchloric acid. It was then
centrifuged at 10,000 rpm for 10 min at 4 °C.
Fluorescence was measured at 350 and 420 nm (excita-
tion and emission wavelengths, respectively).
Concentrations were calculated using a standard GSH
and GSSG curve. Results were expressed as μg glu-
tathione/mg tissue. The calculated redox index (RI)
indicates the antioxidant status of tissue obtained as
follows: RI = GSSG/(GSH + GSSG).
Plasma cholesterol, triglyceride, glucose levels and
TyG index
Total cholesterol was measured by following spectro-
photometrically the formation of quinonimine at

505 nm. Triglyceride and glucose levels were measured
by following spectrophotometrically the formation of
quinone with their corresponding lipases (lipoprotein
lipase and phospholipase respectively) at 505 nm. All
reactions were determined from 10 µL of plasma using
standard enzymatic colorimetric kits from
SPINREACT (San Esteve de Bas, Girona, Spain)
according to manufacturer´s instructions. Intra- and
inter-assay variation coefficients for glucose, triglycer-
ides and cholesterol were < 5%.
The triglyceride-glucose index (TyG) was used to
establish the existence of insulin resistance. This
index has been considered a surrogate index of the
HOMA index [34] and was calculated according to
the following formula:
TyG ¼ Ln ½fasting plasma triglycerides ðmg=dLÞ

fasting glucoseðmg=dLÞ=2
Statistical analyses
All experiments were performed in triplicate. Statistical
analyses were performed using the SPSS version 19.0 sta-
tistical analysis package (SPSS, Inc., Chicago, IL, USA).
Results were expressed as means and standard deviations.
A two-way ANOVA (cholesterol and diet) was used.
Pairwise comparisons of diet responses between groups
were made employing the Bonferroni test. Where var-
iances were assumed to be unequal, the T2 of the
Tamhane post hoc test was applied. The effect of choles-
terol consumption was evaluated using an unpaired
Student’s t test. Differences in growth rate induced by
diets were assessed by the ANOVA test (SAS statistical
packet 9.2).
Results
Figures 1(a,b) show the relationship between cumula-
tive feed intake and body weight gain, together with
linear adjustment parameters (r2, slope and intercept,
and their respective mean errors). All growth rate
curves showed linear adjustments. Growth rate of C
and HC rats significantly differ from those of their G
and GS and HG and HGS counterparts, respectively.
Supplementary dietary cholesterol significantly affected
growth curves (HC vs. C, HG vs. G, and HGS vs. GS).
Table 1 shows that feed intake was significantly
affected by the interaction of RP and cholesterol.
Supplementary cholesterol and the type of RP influ-
enced significantly weight gain, feed intake and feed
conversion rate. The post hoc study showed that HC,
HG, HGS vs. C, G, GS groups showed lower growth
and lower feed intake while HC and HG presented
FOOD & NUTRITION RESEARCH 5
lower feed conversion ratio than C and G. The addition
of spirulina to glucomannan increased weight gain,
final body weight and feed intake when compared to
C animals. HG rats displayed higher feed intake than
HC and HGS.
Liver weight, fat and cholesterol content together
with the hepatosomatic index were significantly
affected by cholesterol feeding but not by the RP-type
or the cholesterol-RP type interaction. Liver fat was
significantly higher in groups HG, HGS vs. G, GS.
Plasma cholesterol increased in HC and HG vs. C
and G groups. HG and HGS rats had lower plasma
cholesterol levels than those of the HC group. Plasma
glucose was lower in HC vs. C group. Plasma glucose
was lowered by cholesterol feeding and HC presented
significantly lower glycemia than C rats. The TyG
index was modified by the RP-cholesterol interaction
and cholesterol effect. TyG was lower in HGS com-
pared to HC rats.
Ldlr expression was significantly reduced by choles-
terol feeding. Significant differences were observed in
HC, HG and HGS rats vs. C, G and GS rats, respec-
tively. Although no significant differences were
observed between the non-cholesterol-fed groups, Ldlr
expression was significantly lower in HG and HGS
than HC rats. Table 2 shows that the percentage of
arachidonic acid in liver was significantly affected by
the type of RP* cholesterol interaction. The ‘cholesterol
factor’ significantly affected the percentages of palmitic,
stearic, oleic, linolenic, arachidonic, EPA, DHA, SFA,
MUFA and PUFA. The ‘RP factor’ significantly affected
the percentages of stearic, linoleic, linolenic, eicosatrie-
noic, arachidonic acids, SFA, and PUFA.
Palmitic acid (C16:0) percentage was significantly
lower in HC vs. C and in HGS vs. GS rats but higher
in HG vs. HC and HGS animals. Stearic acid (C18:0)
percentage was lower in HGS vs. GS rats and in C
and G vs. GS rats (p < 0.05). Oleic acid (C18:1n9)
percentages were higher in HC, HG and HGS than in
their C, G and GS counterparts. GS oleic percentage
was lower in Gs vs. G rats. Linoleic acid (C18:2n6)
percentage was lower in G and GS vs. C livers.
Gamma-linolenic acid (C18:3n6) percentage was
higher in HG vs. G. Eicosenoic acid (C20:1) was
higher in HC vs. C rats. Linolenic acid (C18:3n3)
percentages were lower in HG vs. HC and HGS
groups; HC vs. C and HG vs. G livers presented
higher linolenic acid percentages. Eicosatrienoic acid
(C20:3n6) percentages were lower in G and GS vs. C
livers and in HGS vs. HC liver. Arachidonic acid
(C20:4n6) percentage was lower in HC, HG, HGS
vs. C, G, GS livers and in HG and HGS vs. HC livers.
Eicosapentaenoic acid (C20:5n3) percentage was
6 L. GONZÁLEZ-TORRES ET AL.

a
350

300 C G GS

Body weight gain (g)

250

200

150

100

50

5 10 15 20
Cumulative intakes (MJ)
b
300

HC HG HGS
250
Body weight gain (g)

200

150

100

50

2 4 6 8 10 12 14
Cumulative intakes (MJ)

Figure 1. (a) Growth rates (body weight gain (g)/food consumption (MJ)) in rats fed the control, glucomannan- and glucomannan
plus spirulina-enriched pork experimental diets. Y = (slope with their standard error) X + (intercept with their standard error). Where
Y is the body weight gain and X is the food consumption. Control-RP (C): Y = (19.07 ± 3.38) X + (−5.94 ± 0.001); r2 = 0.996
(p < 0.001); β = 0.998. Glucomannan-RP (G): Y = (18.13 ± 3.22)X + (−9.94 ± 0.001); r2 = 0.995 (p < 0.001); β = 0.990. Glucomannan
plus spirulina-RP: Y = (18.86 ± 1.76) X + (−3.73 ± 0.001); r2 = 0.998 (p < 0.001); β = 0.998. Mean values were significantly different
(ANCOVA test) for C vs. G. C vs. GS. and G vs. GS (all p < 0.05). (b) Growth rates in rats fed the control. Glucomannan- and
glucomannan plus spirulina-RP experimental diets with supplementary cholesterol. Hypercholesterolemic control-RP (HC):
Y = (17.62 ± 3.28) X + (4.69 ± 0.001); r2 = 0.973 (p < 0.001); β = 0.987. Hypercholesterolemic glucomannan-RP (HG):
Y = (16.88 ± 2.01) X + (2.77 ± 0.001); r2 = 0.997 (p < 0.001); β = 0.995. Hypercholesterolemic glucomannan plus spirulina-RP
(HGS): Y = (17.54 ± 2.94) X + (0.15 ± 0.001); r2 = 0.998 (p < 0.001); β = 0.989. Mean values were significantly different (ANCOVA
test) for HC vs. HG and HC vs. HGS (both p < 0.05). RP: restructured pork.

significantly lower in HC and HG vs. C and in G
livers, and in HGS vs. HC groups. Docosahexaenoic
acid (C22:6n3) percentages were lower in HC, HG,
HGS vs. C, G, GS livers.
SFA percentages were lower in HC and HGS vs.
their C and GS counterparts’ livers and in HC vs. HG
and HGS livers. MUFA percentages were higher in HC,
HG, HGS vs. C, G, GS rats. The PUFA percentages
were significantly lower in HC, HG and HGS vs. C, G,
and GS.
Information regarding estimated desaturase and
desaturase-elongase activity is shown in Table 3. The
C20:4 n-6/C18:2 n-6 ratio and delta-5-desaturase activ-
ity were significantly affected by the type of RP*
cholesterol interaction. None of the estimated activities
were affected by 2RP effects; however, the cholesterol
effect affected all activities except that of delta-6-desa-
turase. The C22:6n3/C18:3n3 ratio was lower in HC,
HG and HGS vs. C, G, GS livers. The C20:4n6/C18:2n6
ratio was lower in HG and HGS vs. G and GS livers
and in HG and HGS vs. HC livers. The C18:1n9/C18:0
ratio was higher in HG vs. G livers while SCD activity
was higher in HC and HG vs. C and GS livers and in
HC than in HG livers. Delta-5-desaturase activity was
higher in G and GS livers vs. C livers.
Results in Table 4 show that liver redox indices
(RI), GSH and GSSG were unaffected by the different
diets.
 FOOD & NUTRITION RESEARCH 7

Table 1. Effects of glucomannan or glucomannan plus spirulina-RP on final weight, liver fat, total cholesterol and glucose of
cholesterol-fed fa/fa rats.
ANOVA
Cholesterol Control RP (C/ Glucomanan-RP Glucomanan plus Spirulina-RP RP Cholesterol RP*Cholesterol
addition HC) (G/HG) (GS/HGS) effect effect interaction
Weight gain (g) No 285.6 ± 39.1 a 314.7 ± 28.5 ab 349.4 ± 11.7 b 0.002 <0.001 0.60
Yes 210 ± 23.3** 240.3 ± 17.9*** 250.7 ± 43.0**
Feed conversion No 0.23 ± 0.02 0.25 ± 0.01 0.26 ± 0.01 0.005 <0.001 0.47
ratio1 Yes 0.20 ± 0.02* 0.21 ± 0.02*** 0.23 ± 0.04
Feed intake (g) No 1239 ± 69.9 a 1279 ± 91.0 ab 1344 ± 39.7 b <0.001 <0.001 0.005
Yes 1058 ± 59.7 a*** 1129 ± 80.4 b* 1089 ± 32.1 a***
Liver weight (g) No 11.8 ± 1.2 13.4 ± 2.8 15.0 ± 0.7 0.55 <0.001 0.11
Yes 28.2 ± 3.2*** 29.7 ± 2.4*** 25.5 ± 6.7**
Liver fat (%) No 13.6 ± 7.6 10.2 ± 3.1 11.17 ± 2.9 0.52 ˂0.001 0.14
Yes 19.4 ± 5.2 24.4 ± 5.8* 27.9 ± 6.4*
Liver cholesterol No 7.9 ± 3.6 12.5 ± 4.2 12.6 ± 3.7 0.073 0.015 0.71
(mmol/g) Yes 12.9 ± 4.3 15.5 ± 4.3 19.3 ± 6.3
Plasma cholesterol No 4.4 ± 0.9 4.3 ± 0.4 4.7 ± 0.9 ˂0.001 ˂0.001 ˂0.001
(mmol/L) Yes 25.6 ± 8.4a*** 10.8 ± 2.1b*** 6.1 ± 3.6b
Plasma glucose No 19.3 ± 1.9 19.7 ± 4.1 18.9 ± 3.4 0.99 ˂0.001 0.83
(mmol/L) Yes 12.8 ± 3.5** 12.4 ± 7.9 13.8 ± 4.8
Plasma triglycerides No 1.69 ± 1.08 1.75 ± 0.77 1.74 ± 0.47 0.055 0.12 0.022
(mmol/L) Yes 2.95 ± 0.79 a* 1.84 ± 0.27 b 0.96 ± 0.41 c*
TyG index2 No 10.0 ± 0.6 10.1 ± 0.4 10.1 ± 0.3 0.085 0.025 0.026
Yes 10.3 ± 0.3a 9.7 ± 0.5ab 9.1 ± 0.7b*
Ldlr expression No 100.0 ± 44.8 110.0 ± 78.5 92.0 ± 28.8 0.56 <0.001 0.52
Yes 28.7 ± 23.0a** 0.9 ± 0.7b** 0.2 ± 0.2b***
Values (mean ± SD, n = 6) in the same row bearing different letters were significantly different (p < 0.05; Bonferroni or T2-Tamhane tests). Values for the
same diet but with different cholesterol content bearing asterisks were significantly different (*p < 0.05, **p < 0.01, ***p < 0.001). 1Feed conversion
ratio = weight gain (g/day)/food intake (g/day); 2TyG index: Ln (fasting triglycerides (mg/dL) x fasting glucose (mg/dL) /2). C/CH, control-RP with or
without added cholesterol; G/HG, glucomannan-RP with or without added cholesterol; GS/HGS, glucomannan plus spirulina-RP with or without added
cholesterol.

Table 5 shows results of antioxidant enzyme activ-
ities and expressions. Enzyme activities were not sig-
nificantly modified by the RP-type factor or the RP-
type and cholesterol. GPx and CAT activity tended to
low with cholesterol feeding. Western blot (WB)
(Figure 2) shows that both factors and their interaction
relevantly and significantly affect enzyme levels. The
protein level (Western-blot) was significantly higher in
all tested enzymes for HC vs. C rat livers. A significant
decrease in CAT and SOD levels was observed in HG
and HGS vs. G and GS rats. Spirulina addition signifi-
cantly increase GPx and GR protein levels when com-
pared HGS vs. GS.
Only CAT expression was significantly affected by RP-
type and cholesterol interaction. RP-type significantly
affected Mn-SOD and CAT expressions. Cholesterol sig-
nificantly affected all enzyme expression. Cu/Zn-SOD
expression in HGS vs. HC rats; Mn-SOD expression in
GS vs. C and in HGS vs. HC rats were significantly lower;
CAT expression in GS vs. C animals; and the GR and GPx
expressions in HGS vs. HC rats. Glucomannan plus spir-
ulina vs. glucomannan affected the CAT and GPx expres-
sion in HGS vs. HG rats.
Cu/Zn-SOD, CAT, GR and GPx were significantly
lower in HC, HG and HGS vs. C, G and GS rats. Mn-
SOD expression was significantly higher in HC vs. C
rats (p < 0.01).
Several significant correlations were found. Liver
weight and the hepatosomatic index correlated nega-
tively and significantly with Ldlr expression, Cu/Zn-
SOD, CAT, GPx and GR expression and WB levels,
delta-6-elongase-desaturase and delta-5-desaturase
activities (all p < 0.001) and GPx activity (at least
p < 0.01) while a positive correlation was found with
SCD and oleoyl-CoA reductase activities and Mn-SOD
(at least p < 0.01).
Discussion
This study shows for the first time that RP and choles-
terol modified liver fatty acid profile and antioxidant
enzyme activities, levels and expressions and Ldlr
expression in fa/fa rats. These results were interrelated
and also highly dependent on body weight. Zucker fa/
fa rats became severely obese, their daily food intake
was very high and they exhibited hypercholesterolemia
as described by other others, very high daily intake and
hypercholesterolemia in concurrence with other
authors [35]. Surprisingly, G and GS included in RP
did not have a satiating effect as has been suggested by
other authors in relation to Konjac glucomannan
[18,36]. In fact, comparison of slopes shows that for
each kJ consumed, G and GS animals gained 0.002–
8 L. GONZÁLEZ-TORRES ET AL.

Table 2. Effects of glucomannan or glucomannan plus spirulina-RP on liver fatty acid profile (g/100 g of methyl ester) of cholesterol-
fed fa/fa rats.
ANOVA
Cholesterol Control RP (C/ Glucomannan-RP Glucomannan plus Spirulin-RP RP Cholesterol RP*Cholesterol
addition HC) (G/HG) (GS/HGS) effect effect interaction
Myristic (C14:0) No 1.32 ± 0.53 1.51 ± 0.39 1.73 ± 0.67 0.41 0.28 0.71
Yes 1.22 ± 0.08 1.44 ± 0.20 1.34 ± 0.30
Palmitic (C16:0) No 16.31 ± 1.31 19.05 ± 4.60 17.40 ± 3.22 0.059 0.010 0.75
Yes 12.45 ± 2.38a* 16.91 ± 3.07b 13.17 ± 1.50a*
Palmitoleic (C16:1) No 20.40 ± 0.25 19.01 ± 3.27 20.78 ± 1.29 0.57 0.13 0.88
Yes 22.67 ± 2.06 22.48 ± 2.35 23.30 ± 3.66
Stearic (C18:0) No 7.10 ± 1.29a 7.07 ± 1.19a 9.92 ± 1.68 b
0.026 0.037 0.25
Yes 6.32 ± 0.73 6.67 ± 0.85 7.27 ± 2.11**
Oleic (C18:1n9) No 31.96 ± 2.03ab 32.61 ± 1.64a 29.26 ± 2.40b 0.94 ˂0.001 0.088
Yes 38.50 ± 0.59** 38.62 ± 0.74*** 41.12 ± 5.60**
Linoleic (C18:2n6) No 6.26 ± 1.31a 4.90 ± 0.35b 4.89 ± 0.44 b
0.025 0.25 0.74
Yes 6.29 ± 0.25 5.45 ± 0.84 5.51 ± 1.16
γ-linolenic (C18:3n6) No 0.21 ± 0.04 0.13 ± 0.04 0.22 ± 0.08 0.52 0.55 0.57
Yes 0.17 ± 0.08 0.21 ± 0.07** 0.25 ± 0.22
Eicosenoic (C20:1) No 0.23 ± 0.10 0.19 ± 0.06 0.26 ± 0.22 0.43 0.50 0.86
Yes 0.39 ± 0.10* 0.29 ± 0.15 0.44 ± 0.29
Linolenic (C18:3n3) No 0.27 ± 0.05 0.21 ± 0.03 0.26 ± 0.17 0.041 0.020 0.43
Yes 0.41 ± 0.05a** 0.28 ± 0.05b* 0.46 ± 0.11a
Eicosatrienoic No 0.62 ± 0.12a 0.36 ± 0.14b 0.36 ± 0.14 b
0.030 0.22 0.50
(C20:3n6) Yes 0.64 ± 0.16a 0.52 ± 0.11ab 0.39 ± 0.11b
Eicosatetraenoic No 9.78 ± 0.76 9.56 ± 1.17 9.25 ± 0.76 0.001 ˂0.001 0.010
(C20:4n6) Yes 7.97 ± 0.84a* 5.16 ± 0.24b** 5.02 ± 0.94b***
Eicosapentaenoic No 2.11 ± 0.82 2.23 ± 0.49 2.75 ± 0.83 0.79 ˂0.001 0.098
C20:5n3 Yes 1.06 ± 0.22a* 0.61 ± 0.37ab** 0.42 ± 0.29b
Docosahexaenoic No 3.45 ± 0.40 3.17 ± 0.84 2.92 ± 0.91 0.18 ˂0.001 0.89
(C22:6n3) Yes 1.91 ± 0.44** 1.35 ± 0.22** 1.32 ± 0.42*
Saturated Fatty No 24.72 ± 1.53 27.63 ± 4.35 29.05 ± 3.67 0.031 ˂0.001 0.29
Acids Yes 19.99 ± 2.18a* 25.02 ± 2.59b 21.77 ± 1.75b*
Monosaturated Fatty No 52.58 ± 1.85 51.81 ± 2.66 50.30 ± 2.57 0.72 ˂0.001 0.061
Acids Yes 61.56 ± 2.49a*** 64.39 ± 2.23b** 64.86 ± 2.46b***
Polyunsaturated No 22.70 ± 0.69 20.55 ± 2.35 20.65 ± 2.83 0.003 ˂0.001 0.279
Fatty Acids Yes 18.45 ± 0.92*** 13.59 ± 0.56*** 13.37 ± 3.02**
Values (mean ± SD, n = 6) in the same row bearing different letters were significantly different (p < 0.05; Bonferroni or T2-Tamhane tests). Values for the
same diet but with different cholesterol content bearing asterisks were significantly different (*p < 0.05, **p < 0.01, ***p < 0.001). C/CH, control-RP with or
without added cholesterol; G/HG, glucomannan-RP with or without added cholesterol; GS/HGS, glucomannan plus spirulina-RP with or without added
cholesterol.

Table 3. Effects of glucomannan or glucomannan plus spirulina-RP on liver fatty acid ratios (g/100 g of methyl ester) of cholesterol-
fed fa/fa rats.
ANOVA
Cholesterol Control RP (C/ Glucomannan-RP Glucomannan plus Spirulin-RP RP Cholesterol RP*Cholesterol
addition HC) (G/HG) (GS/HGS) effect effect interaction
C22:6n3/C18:3n3 No 12.99 ± 2.91 15.21 ± 2.27 12.47 ± 3.43 0.13 ˂0.001 0.70
ratio Yes 4.73 ± 1.52a** 5.05 ± 1.89a*** 2.85 ± 0.47b***
C20:4n6/C18:2n6 No 1.62 ± 0.42 1.97 ± 0.32 1.90 ± 0.22 0.91 ˂0.001 0.030
ratio Yes 1.27 ± 0.17a 0.96 ± 0.15b*** 0.92 ± 0.09b***
C16:1n7/C16:0 No 1.26 ± 0.10 1.08 ± 0.43 1.23 ± 0.24 0.15 0.002 0.63
ratio Yes 1.90 ± 0.38a* 1.38 ± 0.27b 1.77 ± 0.20ab*
C18:1n9/C18:0 No 4.66 ± 1.11 4.73 ± 0.98 3.04 ± 0.73 0.21 ˂0.001 0.22
ratio Yes 6.16 ± 0.73 5.86 ± 0.82* 5.99 ± 1.65
Delta-5- No 16.40 ± 3.30a 20.61 ± 5.79ab 28.22 ± 5.14a 0.10 ˂0.001 0.046
desaturase Yes 13.33 ± 5.08 10.30 ± 3.03** 13.63 ± 3.53**
Delta-6- No 0.034 ± 0.010 0.026 ± 0.010 0.044 ± 0.014 0.33 0.85 0.45
desaturase Yes 0.027 ± 0.012 0.040 ± 0.016 0.041 ± 0.028
Values (mean ± SD, n = 6) in the same row bearing different letters were significantly different (p < 0.05; Bonferroni or T2-Tamhane tests). Values for the
same diet but with different cholesterol content bearing asterisks were significantly different (*p < 0.05, **p < 0.01, ***p < 0.001).
Stearoyl-CoA-desaturase, C16:1 n-7/C16:0; Delta-5-desaturase: C20:4 n-6/C20:3 n-6; Delta-6- desaturase: C18:3 n-6/C18:2 n-6. C/CH, control-RP with or
without added cholesterol; G/HG, glucomannan-RP with or without added cholesterol; GS/HGS, glucomannan plus spirulina-RP with or without added
cholesterol.

0.005 g less than C rats. The stomach is known to satiation has to be studied carefully. In addition, fruc-
produce ghrelin and leptin, two important food intake tose and saturated fatty acids, two major compounds of
controllers. However, as fa/fa rats are leptin-resistant the assayed diets, modify the production response of
[37], any expected mechanism linking leptin and both gastric hormones [38]. In agreement with Beynen
 FOOD & NUTRITION RESEARCH 9

Table 4. Effects of glucomannan or glucomannan plus spirulina-RP on liver redox ratio, GSH and GSSG of cholesterol-fed fa/fa rats.
ANOVA
Cholesterol Control RP Glucomannan-RP Glucomannan plus Spirulina- RP Cholesterol RP*Cholesterol
addition (C/HC) (G/HG) RP (GS/HGS) effect effect interaction
GSH No 0.60 ± 0.25 0.61 ± 0.22 0.52 ± 0.19 0.98 0.14 0.830
(µg/mg tissue) Yes 0.50 ± 0.14 0.47 ± 0.12 0.52 ± 0.18
GSSG No 0.63 ± 0.22 0.55 ± 0.03 0.62 ± 0.18 0.70 0.27 0.875
(µg/mg tissue) Yes 0.54 ± 0.06 0.51 ± 0.07 0.57 ± 0.15
RI No 0.48 ± 0.09 0.51 ± 0.10 0.45 ± 0.06 0.90 0.53 0.817
Yes 0.47 ± 0.10 0.47 ± 0.09 0.48 ± 0.11
Values (mean ± SD, n = 6) in the same row bearing different letters were significantly different (p < 0.05; Bonferroni or T2-Tamhane tests). Values for the
same diet but with different cholesterol content bearing asterisks were significantly different (*p < 0.05, **p < 0.01, ***p < 0.001). GSH, reduced
glutathione; GSSG, oxidized glutathione; RI, redox index; RI = [GSH/(GSH+GSSG)]. C/CH, control-RP with or without added cholesterol; G/HG, glucomannan-
RP with or without added cholesterol; GS/HGS, glucomannan plus spirulina-RP with or without added cholesterol.

Table 5. Effects of glucomannan or glucomannan plus spirulina-RP on liver antioxidant enzymes of cholesterol-fed fa/fa rats.
ANOVA
Cholesterol Glucomannan-RP Glucomannan plus RP Cholesterol RP*Cholesterol
addition Control RP (C/HC) (G/HG) Spirulina-RP (GS/HGS) effect effect interaction
Cu,Zn-SOD Expression (% vs. C) No 100.0 ± 19.04 121.11 ± 30.47 95.32 ± 45.94 0.26 <0.001 0.41
Yes 5.78 ± 3.27 a*** 5.14 ± 4.07 ab** 0.35 ± 0.21 b***
Mn-SOD Expression (%vs.C) No 100.0 ± 18.67 a 44.30 ± 15.03 b 52.91 ± 27.71 b <0.001 0.001 0.122
Yes 183.2 ± 46.63 a** 92.78 ± 61.20 b 67.11 ± 10.42 b
SOD Activity (U/mg de protein) No 0.14 ± 0.08 0.18 ± 0.08 0.16 ± 0.11 0.45 0.60 0.92
Yes 0.16 ± 0.05 0.20 ± 0.06 0.16 ± 0.06
CAT Expression (%vs. C) No 100.0 ± 31.63 a 60.28 ± 16.95 ab 48.78 ± 18.02 b 0.009 <0.001 0.010
Yes 10.13 ± 6.22 ab*** 20.52 ± 9.02 a*** 3.99 ± 1.43 b***
CAT Activity (U/mg protein) No 37.54 ± 7.94 33.91 ± 3.74 38.61 ± 11.82 0.87 0.061 0.79
Yes 30.33 ± 7.53 30.41 ± 8.41 29.49 ± 13.51
GPx Expression (% vs. C) No 100.0 ± 27.53 96.45 ± 38.28 75.87 ± 25.48 0.085 <0.001 0.92
Yes 23.67 ± 8.03a*** 22.69 ± 10.46a*** 7.39 ± 3.26b***
GPx Activity (U/mg protein) No 11952 ± 5986 9103 ± 2678 10952 ± 3011 0.47 0.006 0.72
Yes 7364 ± 3072 6791 ± 1545 7307 ± 945
GR Expression (% vs. C) No 100.0 ± 34.42 100.5 ± 27.70 86.94 ± 23.05 0.14 <0.001 0.92
Yes 31.60 ± 9.08a*** 31.14 ± 15.90a*** 11.56 ± 1.37b***
Values (mean ± SD, n = 6) in the same row bearing different letters were significantly different (p < 0.05; Bonferroni or T2-Tamhane tests). Values for the
same diet but with different cholesterol content bearing asterisks were significantly different (*p < 0.05, **p < 0.01, ***p < 0.001). C/CH, control-RP with or
without added cholesterol; G/HG, glucomannan-RP with or without added cholesterol; GS/HGS, glucomannan plus spirulina-RP with or without added
cholesterol.

et al. [39], lower feed intake and growth were found in
cholesterol-fed rats. As a result of this reduction, lower
values of plasma glucose were found in the HC group.
The higher plasma glucose and TyG values clearly
suggest that diabetes and insulin resistance was perva-
sively present in all rat groups [40]. The TyG index was
not significantly modified in HC when compared to C
because of the mathematical proportion of the loga-
rithm. The triglycerides are higher in HC due to cho-
lesterol addition to diet, while glucose is lower because
the food intake reduction.
All of the non-cholesterol and cholesterol-fed fa/fa
rats were diabetic as their plasma glucose surpassed the
cut-off point of 7 mmol/L, diabetes cut-off point for
humans [41]. However, the prevalence of hyperglyce-
mia >11.1 mmol/L was lower in groups that consumed
cholesterol-added diets (50% in HC; 33% in HG and
17% in HGS rats). The presence of glucomannan and
spirulina in the cholesterol-fed animals also reduced
the TyG index with respect to their counterparts
suggesting improvement of insulin resistance as TyG
values of 9.1 and 10.3 have been proposed as the
median and 95th percentile in patients affected by
metabolic syndrome [40]. Rats consuming cholesterol-
enriched diets showed lower weight gain and growth
rates than their non-cholesterol counterparts. In addi-
tion, those rats presented lower total adipose tissue
mass (data not shown), interestingly a positive signifi-
cant correlation was found between plasma glucose and
growth rate (r = 0.387; p = 0.024) and with total
adipose tissue mass (r = 0.397; p = 0.020); explaining
why cholesterol-fed animals glucose level
improvement.
Data from a previous paper showed that the preva-
lence of severe cholesterolemia in non-cholesterol fa/fa
rats was reduced by G-RP and GS-RP intake. The
benefits of consuming G-RP and GS-RP were also
much more evident as these meat products strongly
limited the hypercholesterolemic effects of dietary cho-
lesterol [42]. However, HG and HGS diets
10 L. GONZÁLEZ-TORRES ET AL.

Figure 2. Protein levels of the main antioxidant enzymes measured by Western-blot in rats fed the glucomannan- and glucoman-
nan plus spirulina-enriched pork experimental diets. Mean values and standard deviations (n = 6). Statistical comparison between
HC vs. C, HG vs. G and HGS vs. GS groups, * indicate significant differences (*p < 0.05, **p < 0.01, ***p < 0.001). Bars with different
letters indicate significant differences (at least p < 0.05) between C, G and GS or HC, HG and HGS groups. CAT, catalase; SOD,
superoxide dismutase; GR, glutathione reductase; GPx, glutathione peroxidase. C/CH, control-RP with or without added cholesterol;
G/HG, glucomannan-RP with or without added cholesterol; GS/HGS, glucomannan plus spirulina-RP with or without added
cholesterol. Results were calculated as percentage relative to control.

unexpectedly blocked Ldlr expression, thus the hypo-
cholesterolemic effect of glucomannan or glucoman-
nan plus spirulina appeared clearly unrelated with
modifications in the Ldlr expression. Therefore it
must be accepted that through fat retention by adsorp-
tion and/or the seizing of bile salts, glucomannan con-
tributes to reducing the effects of high fat diets [16].
According to our data, 3 g/kg of spirulina present in
HGS diets improved the hypocholesterolemic response
of glucomannan in cholesterol-fed animals [43], prob-
ably by seizing bile salts as has been suggested in the
case of some polyphenols [44]. Although we are far
from knowing the mechanism involved in this expres-
sion inhibition, it can be suggested that it prevents
additional liver cholesterol uptake (via lipoproteins)
and steatosis.
As a consequence of their inner metabolism [33]
and diet composition, C rats presented hypercholester-
olemia [45] and have an increased percentage of oleic
and palmitoleic acids in the liver in comparison to
those reported by Viejo et al. [29] in control Wistar
rats fed semisynthetic diets containing casein and olive
oil. In addition, cholesterolemia and oleic acid
appeared increased in cholesterol fed animals (HC,
HG and HGS rats in comparison to C, G and GS
rats). According to the ANOVA test the consumption
of the hypercholesterolemic agent induced significant
decrease on palmitic and steric acids and an increase
on palmitoleic and oleic acids, their metabolic pro-
ducts. With respect to the comparison HC vs. C, both
palmitic and stearic acid levels tended to decrease while
palmitoleic and oleic acids to increase; clearly suggest-
ing that the SCD activity (palmitoleic acid/palmitic
acid and oleic acid/stearic acid ratios), a surrogate
index of delta-9-desaturase activity, increased in HC
vs. C animals. Viejo et al. [29] reported that oleic acid
and the oleic/stearic acid ratio increased in the liver of
rats fed cholesterol-enriched diets and suggested that
this increase occurred in the form of cholesteryl oleate
as a mechanism to reduce the free cholesterol pool in
the liver, which in turn increases the activity of VLDL
and LDL receptors in an attempt to decrease the
plasma levels of the atherogenic VLDL and LDL
particles.
HC, HG and HGS rats in comparison to C, G and
GS rats have lower polyunsaturated fatty acids (total,

arachidonic acid (AA), eicosapentaenoic acid (EPA)
and docosahexaenoic acid (DHA)) while HC and
HGS vs. C and GS also presented lower amounts of
saturated fatty acid in the liver. In addition, arachido-
nic/linoleic acid (AA/AL) and docosahexaenoic/linole-
nic acid (DHA/LL) ratios were lower, suggesting that
feeding fa/fa rats with cholesterol enriched experimen-
tal diets partially inhibited the delta-6-desaturase-elon-
gase system, known to be responsible for transforming
linoleic and linolenic acids into longer and more unsa-
turated fatty acids of the omega-6 and omega-3
families, respectively [20]. Bochenek and Rodgers [46]
and Huang et al. [47] have described that delta-6-desa-
turase-elongase system activity diminishes in the pre-
sence of a cholesterol-enriched diet. Very recently,
Jacobs et al. [24] suggested that delta-5-desaturase
(D5D), delta-6-desaturase (D6D) and stearoyl-CoA
desaturase (SCD) activities are related with the inci-
dence of T2DM.
Our results suggest that SCD as liver fat increased
due to cholesterol feeding. Elevated SCD activity in
liver, estimated from total fatty acids, was positively
related to liver fat histologically determined [48].
However, HG diet decreased the SCD activity
observed in HC animals. According to [28], the
SCD index should be preferably based on defined
lipid fraction whereas SCD derived from total hepa-
tic fatty acids should be cautiously interpreted. D5D
activity was higher in GS vs. C rats suggesting that
GS diet promoted anti-inflammatory properties [49].
In cholesterol fed rats, principally in diet HG and
HGS vs. G and HGS, D5D activity decreased suggest-
ing that, although glucomannan has a potent hypo-
cholesterolemic effect, a side inflammatory effect
should not be discarded. However, even though
D6D was not significantly affected, a tendency to
increase was also observed in those animals. The
rise in D6D has been related to an increase in ara-
chidonic acid which is a precursor from eicosanoids
that can act as inflammatory mediators [6].
Unpublished histological data clearly suggest that
inflammatory focal points were observed in the cho-
lesterol-fa/fa rats.
The decrease in delta-6-desaturase-elongase observed
in cholesterol-fed fa/fa rats was greater in HG and HGS
animals vs. their G and GS counterparts. It is well
known that linoleic and linolenic acids are less oxidiz-
able than arachidonic acid, EPA and DHA. It can be
speculated that partial inhibition of the transformation
of linolenic acid in EPA and DHA and that of linoleic
acid in arachidonic acid, could occur as a protective
mechanism to avoid excess of highly peroxidable fatty
acids and oxysterol in the liver.
FOOD & NUTRITION RESEARCH 11
Alterations in the regulation of the redox balance
and an increase of reactive oxygen species (ROS) has
been reported in animal models of diabetes [50]. The
results in Table 4, expressed in µmol/g, showed GSH
levels three times lower and GSSG levels three times
higher than those reported for Wistar control rats by
Bocanegra et al. [51]. The redox index of 0.60 found in
the C group was also much lower than the one
reported by Schultz et al. [52] for Wistar rats fed RP.
This suggests that Zucker fa/fa rats have a genetic
predisposition to develop diabetes, dyslipidemia and
low redox index. The pre-existing antioxidant defense
deficiency tended to be impaired after cholesterol feed-
ing as reported by others in Wistar rats [51]. In dia-
betes the enzyme glucose-6-phosphate dehydrogenase
(G6PD) is inhibited; therefore, the entire defense
mechanism becomes compromised and lower amounts
of enzymatic-cofactor NADPH are formed and avail-
able [50,53]. This cofactor is essential for GSH regen-
eration. The consumption of GS and G diets did not
provide any change in the liver levels of GSH, GSSG
and RI. Also, other studies have proved that dietary
components, like fat or cholesterol affect the antioxi-
dant defense in cells [54], leading to unexpected levels
of non-enzymatic antioxidants (e.g. glutathione levels)
and modifications of the enzymatic pathway. Our
group have recently proved that elevated levels of diet-
ary fat lead to high lipid peroxidation indirectly mod-
ifying GSH levels and glutathione enzyme activity [55].
In addition, in the groups that consumed cholesterol
the RI, GSH and GSSG remained unchanged in rela-
tion to their non-cholesterol counterparts. With the
exception of SOD, all other enzyme activities studied
were negatively affected by cholesterol feeding.
However, basal values of CAT activities were much
lower while those of GPx were higher in this experi-
ment than in a previous ones [52,56] suggesting that fa/
fa rats address these enzyme activities to reduce the
hydroperoxydes coming from PUFA. Once again, the
relationship between delta-6-desaturase-enlogase and
liver oxidation can be suggested. Our group has
found that cholesterol-feeding greatly increased the
absorption and bioavailability of iron (unpublished
data) which is known to have pro-oxidant effects.
Cordero Herrera et al. [57] reported that obese
Zucker rats showed increased ROS production but no
modification of GR or GPx enzymes with respect to
lean Zucker rats.
Interestingly, in cholesterol-fed rats vs. non-choles-
terol-fed ones, WB and PCR exhibited similar tenden-
cies. The decrease in enzyme WB levels for GR was
completely arrested in HG and HGS vs. G and GS rats;
however, for most enzymes HG and overall HGS diets
12 L. GONZÁLEZ-TORRES ET AL.
significantly blocked antioxidant enzyme expressions.
Vázquez-Velasco et al. [17] also showed the negative
effects of glucomannan or glucomannan plus spirulina-
enriched surimies in fa/fa rats. Again, the negative
effects of consuming glucomannan plus spirulina
together with dietary cholesterol can be suggested.
However, our results clearly differ from those of
Vázquez-Velasco et al. [17,18] which found much
lower final body weight and cholesterolemia than in
this study, both in non-cholesterol and cholesterol fed
animals. In addition, liver size was not arrested by
GHG and HGS diets as it was in the Vázquez-Velasco
et al. studies [17,18] in both cholesterol or non-choles-
terol groups. This suggests the importance of the
matrix used for incorporating those ingredients.
Some important limitations of this paper are that
only male growth fa/fa rats were used. Also, the study
was performed with only one concentration of gluco-
mannan or glucomannan plus spirulina added to RP.
Future studies should assess potential benefits of dif-
ferent concentrations of glucomannan and glucoman-
nan plus spirulina-RP and in a wider age range of fa/fa
rats and their possible extrapolation to obese and dys-
lipidemic humans.
Conclusion
RP with glucomannan or glucomannan/spirulina affect
liver fatty acid profile and antioxidant status. Spirulina
added to glucomannan tended to increase diet accept-
ability and D5D activity. Cholesterol feeding reduced
delta-6-desaturase-elongase and D5D activities and
increased SCD activity while markedly decreasing
most antioxidant enzyme expression and levels and
expression of Ldlr suggesting that the two mechanisms
are linked. Although GHS arrested the hypercholester-
olemic effect of dietary cholesterol observed and
improved insulin resistance, given by the TyG index
in HC animals, this diet negatively affected the delta-6-
desaturase-elongase activity and markedly depressed
the gene expression of antioxidant enzymes and Ldlr
suggesting that caution needs to be taken when incor-
porating large amounts of glucomannan or glucoman-
nan plus spirulina to cholesterol enriched diets.
Acknowledgments
We gratefully acknowledge the foreign fellowship for gradu-
ate studies granted by the Consejo Nacional de Ciencia y
Tecnología (CONACYT) from Mexico to Laura González-
Torres. All authors have significantly contributed to the
paper and agree with the present version of the manuscript.
FJS-M and JB are the guarantors of the paper and have
contributed to the study design, data discussion, and writing
of the manuscript. LG-T, C-M, MV-V and JAS-L have con-
tributed to the data acquisition, analysis and writing of the
manuscript. IS and CG-F have contributed to the data acqui-
sition and analysis. SB and JB have contributed to data
discussion and have made a critical review of the paper.
Disclosure statement
No potential conflict of interest was reported by the authors.
Funding
This work was supported by the Spanish projects; [AGL-2008
04892-C03-02]; Consolider-Ingenio 2010 project; [#
CSD2007-00016]; Consejo Nacional de Ciencia y Tecnología
(CONACYT).
ORCID
Jorge A. Santos-López http://orcid.org/0000-0003-4924-
0809
Sara Bastida http://orcid.org/0000-0002-2188-5966
Juana Benedí http://orcid.org/0000-0002-3796-639X
Francisco J. Sánchez-Muniz http://orcid.org/0000-0002-
2660-5126
References
[1] Aleixandre de Artinano A, Miguel Castro M.
Experimental rat models to study the metabolic syn-
drome. Br J Nutr. 2009;102(9):1246–1253.
DOI:10.1017/S0007114509990729
[2] Olivero-David R, Schultz A, Vázquez-Velasco M, et al.
Effects of Nori-and Wakame-enriched meats with or
without supplementary cholesterol on arylesterase activ-
ity, lipaemia and lipoproteinaemia in growing Wistar
rats. Br J Nutr. 2011;106(10):1476–1486. DOI:10.1017/
S000711451100198X
[3] Sikder K, Kesh SB, Das N, et al. The high antioxidative
power of quercetin (aglycone flavonoid) and its glycone
(rutin) avert high cholesterol diet induced hepatotoxi-
city and inflammation in Swiss albino mice. Food Funct.
2014;5(6):1294–1303. DOI:10.1039/c3fo60526d
[4] Wu W-T, Chen H-L. Konjac glucomannan and inulin
systematically modulate antioxidant defense in rats fed a
high-fat fiber-free diet. J Agr Food Chem. 2011;59
(17):9194–9200. DOI:10.1021/jf202060p
[5] Sikder K, Das N, Kesh SB, et al. Quercetin and beta-
sitosterol prevent high fat diet induced dyslipidemia and
hepatotoxicity in Swiss albino mice. Indian J Exp Biol.
2014;52(1):60–66.
[6] Jiménez-Colmenero F, Sánchez-Muniz FJ, Olmedilla-
Alonso B. Design and development of meat-based func-
tional foods with walnut: technological, nutritional and
health impact. Food Chem. 2010;123(4):959–967.
DOI:10.1016/j.foodchem.2010.05.104
[7] Davidson MH, Hunninghake D, Maki KC, et al.
Comparison of the effects of lean red meat vs lean
white meat on serum lipid levels among free-living

persons with hypercholesterolemia: a long-term, rando-
mized clinical trial. Arch Intern Med. 1999;159
(12):1331–1338. DOI:10.1001/archinte.159.12.1331
[8] Schultz A, Olivero-David R, Vázquez-Velasco M, et al.
Protective effects of sea spaghetti-enriched restructured
pork against dietary cholesterol: effects on arylesterase and
lipoprotein profile and composition of growing rats. J Med
Food. 2014;17(8):921–928. DOI:10.1089/jmf.2013.0100
[9] Garcimartín A, Santos-López JA, Bastida S, et al.
Silicon-enriched restructured pork affects the lipopro-
tein profile, VLDL oxidation, and LDL-receptor gene
expression in aged rats fed an atherogenic diet. J Nutr.
2015;145(9):2039–2045. DOI: 10.3945/jn.115.213934
[10] Cheong SH, Kim MY, Sok D-E, et al. Spirulina prevents
atherosclerosis by reducing hypercholesterolemia in
rabbits fed a high-cholesterol diet. J Nutr Sci
Vitaminol. 2010;56(1):34–40. DOI:10.3177/jnsv.56.34
[11] Ratcliffe I, Williams PA, Viebke C, et al.
Physicochemical characterization of konjac glucoman-
nan. Biomacromolecules. 2005;6(4):1977–1986.
DOI:10.1021/bm0492226
[12] Vuksan V, Jenkins D, Spadafora P, et al. Konjac-man-
nan (glucomannan) improves glycemia and other asso-
ciated risk factors for coronary heart disease in type 2
diabetes. A randomized controlled metabolic trial.
Diabetes Care. 1999;22(6):913–919.
[13] Sood N, Baker WL, Coleman CI. Effect of glucomannan
on plasma lipid and glucose concentrations, body weight,
and blood pressure: systematic review and meta-analysis.
The Am J Clin Nutr. 2008;88(4):1167–1175.
[14] Al-Ghazzewi FH, Khanna S, Tester RF, et al. The poten-
tial use of hydrolysed konjac glucomannan as a prebiotic.
J Sci Food Agric. 2007;87(9):1758–1766. DOI:10.1002/
(ISSN)1097-0010
[15] Onishi N, Kawamoto S, Suzuki H, et al. Dietary pulver-
ized konjac glucomannan suppresses scratching beha-
vior and skin inflammatory immune responses in NC/
Nga mice. Int Arch Allergy Immunol. 2007;144(2):95–
104. DOI:10.1159/000103220
[16] Shimizu H, Yamauchi M, Kuramoto T, et al. Effects of
dietary konjac mannan on serum and liver cholesterol
levels and biliary bile acid composition in hamsters.
J Pharmacobiodyn. 1991;14(7):371–375. DOI:10.1248/
bpb1978.14.371
[17] Vázquez-Velasco M, González-Torres L, López-Gasco
P, et al. Effects of glucomannan/spirulina-surimi on
liver oxidation and inflammation in Zucker rats fed
atherogenic diets. J Physiol Biochem. 2015;71(4):611–
622. DOI: 10.1007/s13105-015-0425-9
[18] Vázquez-Velasco M, González-Torres L, López-
Gasco P, et al. Liver oxidation and inflammation in
Fa/Fa rats fed glucomannan/spirulina-surimi. Food
Chem. 2014;159:215–221. DOI:10.1016/j.foodchem.
2014.03.015
[19] González-Torres L, Churruca I, Schultz A, et al. Effects of
restructured pork containing Himanthalia elongata on
adipose tissue lipogenic and lipolytic enzyme expression
of normo-and hypercholesterolemic rats. J Nutrigen
Nutrigenom. 2012;5(3):158–167. DOI:10.1159/000343722
[20] Sánchez-Muniz FJ, García-Linares MC, García-Arias
MT, et al. Fat and protein from olive oil-fried sardines
interact to normalize serum lipoproteins and reduce
FOOD & NUTRITION RESEARCH 13
liver lipids in hypercholesterolemic rats. J Nutr.
2003;133(7):2302–2308.
[21] Calder PC. Mechanisms of action of (n-3) fatty acids. J
Nutr. 2012;142(3):592S-9S. DOI:10.3945/jn.111.155259
[22] Lu Y, Vaarhorst A, Merry A, et al. Markers of endogen-
ous desaturase activity and risk of coronary heart dis-
ease in the CAREMA cohort study. PloS One. 2012;7(7):
e41681. DOI:10.1371/journal.pone.0041681
[23] Rudkowska I, Julien P, Couture P, et al.
Cardiometabolic risk factors are influenced by
Stearoyl-CoA Desaturase (SCD)− 1 gene polymorph-
isms and n-3 polyunsaturated fatty acid supplementa-
tion. Mol Nutr Food Res. 2014;58(5):1079–1086.
DOI:10.1002/mnfr.201300426
[24] Jacobs S, Schiller K, Jansen EH, et al. Evaluation of
various biomarkers as potential mediators of the associa-
tion between Δ5 desaturase, Δ6 desaturase, and stearoyl-
CoA desaturase activity and incident type 2 diabetes in
the European Prospective Investigation into Cancer and
Nutrition–Potsdam Study. Am J Clin Nutr. 2015;102
(1):155–164. DOI:10.3945/ajcn.114.102707ajcn102707.
[25] Hozumi T, Yoshida M, Ishida Y, Mimoto H, Sawa J, Doi
K, Kazumi T. Long-term effects of dietary fiber supple-
mentation on serum glucose and lipoprotein levels in
diabetic rats fed a high cholesterol diet. Endocrine J.
1995;42(2):187–192.
[26] Bermejo-Bescós P, Piñero-Estrada E, Del Fresno AMV.
Neuroprotection by Spirulina platensis protean extract
and phycocyanin against iron-induced toxicity in SH-
SY5Y neuroblastoma cells. Toxicol In Vitro. 2008;22
(6):1496–1502. DOI: 10.1016/j.tiv.2008.05.004
[27] Ou Y, Lin L, Yang X, Pan Q, Cheng X. Antidiabetic poten-
tial of phycocyanin: effects on KKAy mice. Pharm Biol.
2013;51(5):539–544. DOI:10.3109/13880209.2012.747545
[28] Reeves PG, Nielsen FH, Fahey Jr GC. AIN-93 purified
diets for laboratory rodents: final report of the
American Institute of Nutrition ad hoc writing commit-
tee on the reformulation of the AIN-76A rodent diet.
J Nutr. 1993;123(11):1939–1951.
[29] Schultz A, García-Fernandez RA, Bocanegra A, et al.
Effects of seaweed-restructured pork diets enriched or
not with cholesterol on rat cholesterolaemia and liver
damage. Food Chem Toxicol. 2013;56:223–230.
DOI:10.1016/j.fct.2013.02.028
[30] Folch J, Lees M, Sloane-Stanley G. A simple method for
the isolation and purification of total lipids from animal
tissues. J Biol Chem. 1957;226(1):497–509.
[31] Carrapiso AI, Timón ML, Petrón MJ, et al. In situ
transesterification of fatty acids from Iberian pig sub-
cutaneous adipose tissue. Meat Sci. 2000;56(2):159–164.
DOI:10.1016/S0309-1740(00)00035-8
[32] Viejo J, Bastida S, Sánchez-Muniz FJ, et al. Effect of
olive oil-fried sardine consumption on liver lipid com-
position and fatty acid cholesterol esterification in
hypercholesterolemic rats. Food Sci Technol Int.
2003;9(5):329–338. DOI:10.1177/1082013203038860
[33] Mitra S. Sample preparation techniques in analytical
chemistry. John Wiley & Sons; Hoboken, New Jersey,
USA. 2004.
[34] Fleige S, Pfaffl MW. RNA integrity and the effect on the
real-time qRT-PCR performance. Mol Aspects Med.
2006;27(2):126–139. DOI:10.1016/j.mam.2005.12.003
14 L. GONZÁLEZ-TORRES ET AL.
[35] Livak KJ, Schmittgen TD. Analysis of relative gene
expression data using real-time quantitative PCR and
the 2− ΔΔCT method. Methods. 2001;25(4):402–408.
DOI:10.1006/meth.2001.1262
[36] Hissin PJ, Hilf R. A fluorometric method for determina-
tion of oxidized and reduced glutathione in tissues. Anal
Biochem. 1976;74(1):214–226. DOI:10.1016/0003-2697
(76)90326-2
[37] Guerrero-Romero F, Simental-Mendía LE, González-
Ortiz M, et al. The product of triglycerides and glucose, a
simple measure of insulin sensitivity. comparison with the
euglycemic-hyperinsulinemic clamp. J Clin Endocrinol
Met. 2010;95(7):3347–3351. DOI:10.1210/jc.2010-0288
[38] Aprikian O, Busserolles J, Manach C, et al. Lyophilized
apple counteracts the development of hypercholestero-
lemia, oxidative stress, and renal dysfunction in obese
Zucker rats. J Nutr. 2002;132(7):1969–1976.
[39] González Canga A, Fernández Martínez N, Sahagún A,
et al. Glucomanano: propiedades y aplicaciones
terapéuticas. Nutr Hosp. 2004;19(1):45–50.
[40] Friedman JM. Leptin and the regulation of body weigh.
Keio J Med. 2011;60(1):1–9. DOI:10.2302/kjm.60.1
[41] Havel PT, Bremer A. Endocrine regulation of energy
homeostasis: implications for obesity and diabetes. In:
Obesity. Amsterdam: Elsevier; Edited by Serrano Rios
M, Ordovás JM, Gutiérrez-Fuentes JA. 2011. p. 107–125
[42] Beynen A, Boogaard A, Van Laack H, et al. Cholesterol
metabolism in two strains of rats with high or low
response of serum cholesterol to a cholesterol-rich
diet. J Nutr. 1984;114(9):1640–1651.
[43] Unger G, Benozzi SF, Perruzza F, et al. Triglycerides and
glucose index: a useful indicator of insulin resistance.
Endocrinología y Nutrición (English Edition). 2014;61
(10):533–540. DOI:10.1016/j.endoen.2014.11.006
[44] ADA. Diagnosis and classification of diabetes mellitus.
Diabetes Care. 2014;37(Supplement 1):S81–S90.
DOI:10.2337/dc14-S081
[45] González-Torres L, Vázquez-Velasco M, Olivero-David R,
et al. Glucomannan and glucomannan plus spirulina
added to pork significantly block dietary cholesterol effects
on lipoproteinemia, arylesterase activity, and CYP7A1
expression in Zucker fa/fa rats. J Physiol Biochem.
2015;71(4):773–784. DOI:10.1007/s13105-015-0441-9
[46] Harris WS. n-3 fatty acids and serum lipoproteins:
human studies. Am J Clin Nutr. 1997;65(5):1645S-54S.
[47] Doi K, Matsuura M, Kawara A, et al. Influence of diet-
ary fiber (konjac mannan) on absorption of vitamin B12
and vitamin E. Tohoku J Exp Med. 1983;141:677–681.
DOI:10.1620/tjem.141.Suppl_677
[48] Sánchez-Muniz FJ, Bastida S. Do not use the Friedewald
formula to calculate LDL-cholesterol in hypercholester-
olaemic rats. Eur J Lipid Sci Tecnol. 2008;110(4):295–
301. DOI:10.1002/ejlt.200700280
[49] Bochenek WJ, Rodgers JB. Dietary regulation of 3-
hydroxy-3-methylglutaryl-CoA reductase from rat intes-
tine. BBA-Lipids Lipid Met. 1979;575(1):57–62.
DOI:10.1016/0005-2760(79)90130-9
[50] Huang Y, Nassar B, Horrobin D. Changes of plasma
lipids and long-chain n− 3 and n− 6 fatty acids in
plasma, liver, heart and kidney phospholipids of rats
fed variable levels of fish oil with or without cholesterol
supplementation. BBA-Lipids Lipid Met. 1986;879
(1):22–27. DOI:10.1016/0005-2760(86)90261-4
[51] Kotronen A, Seppänen-Laakso T, Westerbacka J, et al.
Hepatic stearoyl-CoA desaturase (SCD)-1 activity and
diacylglycerol but not ceramide concentrations are
increased in the nonalcoholic human fatty liver.
Diabetes. 2009;58(1):203–208. DOI:10.2337/db08-1074
[52] Reiner Ž, Catapano AL, De Backer G, et al. ESC/EAS
Guidelines for the management of dyslipidaemias. Eur
Heart J. 2011;32(14):1769–1818. DOI:10.1093/eurheartj/
ehr158
[53] Zhang Z, Yang Z, Zhu B, et al. Increasing glucose 6-
phosphate dehydrogenase activity restores redox bal-
ance in vascular endothelial cells exposed to high glu-
cose. PloS One. 2012;7(11):e49128. DOI:10.1371/
journal.pone.0049128
[54] Bocanegra A, Beneduí J, Sé Nchez-Muniz FJ.
Differential effects of konbu and nori seaweed dietary
supplementation on liver glutathione status in normo-
and hypercholesterolaemic growing rats. Br J Nutr.
2006;95(04):696–702. DOI:10.1079/BJN20051682
[55] Schultz A, González-Torres L, Olivero-David R, et al.
Wakame and Nori in restructured meats included in
cholesterol-enriched diets affect the antioxidant enzyme
gene expressions and activities in Wistar rats. Plant
Foods Hum Nutr. 2010;65(3):290–298. DOI:10.1007/
s11130-010-0179-z
[56] Xu Y, Osborne BW, Stanton RC. Diabetes causes inhi-
bition of glucose-6-phosphate dehydrogenase via activa-
tion of PKA, which contributes to oxidative stress in rat
kidney cortex. Am J Physiol-Renal Physiol. 2005;289(5):
F1040–F7. DOI:10.1152/ajprenal.00076.2005
[57] Christon R, Haloui RB, Durand G. Dietary polyunsatu-
rated fatty-acids and aging modulate glutathione-related
antioxidants in rat-liver. J Nutr. 1995;125(12):3062–
3070.
[58] Santos-López JA, Garcimartin A, Merino P, et al. Effects
of silicon vs. hydroxytyrosol-enriched restructured pork
on liver oxidation status of aged rats fed high-saturated/
high-cholesterol diets. PloS One. 2016;11(1):e0147469.
DOI:10.1371/journal.pone.0147469
[59] Schultz A, Benedí J, González-Torres L, et al. Effects of
diet enriched with restructured meats, containing
Himanthalia elongata, on hypercholesterolaemic induc-
tion, CYP7A1 expression and antioxidant enzyme activ-
ity and expression in growing rats. Food Chem.
2011;129(4):1623–1630. DOI:10.1016/j.foodchem.2011.
06.019
[60] Cordero Herrera I. Mecanismos de acción de los flava-
noles del cacao en las células hepáticas durante la resisten-
cia a la insulina y la diabetes: estudio en cultivos celulares y
en animales de experimentación [European Thesis].
Madrid: Universidad Complutense de Madrid; 2015.