| |

Received: 8 February 2019    Revised: 28 October 2019    Accepted: 25 November 2019

DOI: 10.1111/jre.12722

ORIGINAL ARTICLE

The therapeutic role of baicalein in combating experimental

periodontitis with diabetes via Nrf2 antioxidant signaling
pathway

Chunhui Zhu1,2 | Ying Zhao2 | Xiaoyan Wu2 | Cui Qiang1 | Jin Liu1,2 | Jianfeng Shi1 |

Jianzhong Gou2 | Dandan Pei1  | Ang Li1,2

1
Key Laboratory of Shaanxi Province for
Craniofacial Precision Medicine Research,
College of Stomatology, Xi'an Jiaotong
University, Xi'an, China
2 tant pathogenic factor contributing to chronic periodontitis with diabetes mellitus
Department of Periodontology, College
of Stomatology, Xi’an Jiaotong University,
Xi'an, China
Correspondence
Ang Li, Key Laboratory of Shaanxi Province
for Craniofacial Precision Medicine
Research, College of Stomatology, Xi'an
Jiaotong University, Xi'an, China.
Email: drliang@mail.xjtu.edu.cn
Funding information
Fundamental Research Funds for the
Central Universities, Grant/Award Number:
xjj2017025 and xjj2017097; National
Natural Science Foundation of China, Grant/
Award Number: 81901019 and 81870798
Abstract
Background and objective: Oxidative stress has been suggested as an impor-
(CPDM). Previous studies have revealed the potential therapeutic properties of bai-
calein (BCI) in oxidative stress-related diseases; however, the antioxidant effects of
BCI on therapy for individual with CPDM remain largely unexplored. Nuclear fac-
tor erythroid 2-related factor 2 (Nrf2) plays a critical role in cellular defence against
oxidative stress. In this study, we aim to determine whether BCI prevents diabetes-
related periodontal tissue destruction by regulating Nrf2 signaling pathway.
Material and methods: Human gingival epithelial cells (hGECs) were challenged with
high glucose (HG, 25 mmol/L) and/or lipopolysaccharide (LPS, 20 µg/mL). Reactive
oxygen species (ROS) were detected by fluorescence-activated cell sorting. The
changes of antioxidant-related genes, including Nrf2, catalase (Cat), glutamate-
cysteine ligase catalytic subunit (Gclc), superoxide dismutase 1 (Sod1), and superoxide
dismutase 2 (Sod2), were quantified by real-time PCR. The localization of phospho-
Nrf2 (pNrf2, S40) in the nucleus was detected by immunofluorescence staining and
laser scanning confocal microscope (LSCM). PNrf2 and total form of Nrf2 were de-
termined using western blot. The above indicators together with mitochondrial mem-
brane potential (MMP) were further investigated in hGECs pre-treated with different
concentrations of BCI (0.01, 0.1, or 0.5 µg/mL) before stimulated with HG plus LPS
(GP). Finally, the role of BCI in activating Nrf2 signaling pathway and relieving the
alveolar bone absorption was examined in the CPDM model of Sprague Dawley rats.
CPDM rats were oral gavaged with BCI (50, 100, or 200 mg/kg daily). The pNrf2 was
detected by immunohistochemistry, and the alveolar bone absorption was examined
by microcomputed tomography.
Results: Our results showed that ROS were significantly increased in both groups
of HG and LPS, with the strongest generation in the GP group. In terms of ROS-
related gene expression, we found that the mRNA levels of Nrf2, Cat, Gclc, Sod1,
and Sod2 were significantly decreased in HG and LPS groups. In consistent with the
strongest induction of ROS in GP group, the gene expression in GP group was further

Dandan Pei and Ang Li have contributed equally to the work.

J Periodont Res. 2020;55:381–391. wileyonlinelibrary.com/journal/jre © 2019 John Wiley & Sons A/S.     381 |
Published by John Wiley & Sons Ltd
 |
382       ZHU et al.

decreased as compared to those of HG and LPS groups. Also, the expression of pNrf2
exhibited the same trend with the expression of those antioxidant genes. However,
the generation of ROS and the loss of mitochondrial membrane potential induced by
GP were abolished by pre-treatment with different concentrations of BCI (0.01, 0.1,
or 0.5 µg/mL). Interestingly, we observed that BCI promoted the nucleus transloca-
tion of pNrf2, as well as the gene expression levels of pNrf2 and its target genes
(Cat, Gclc, Sod1, and Sod2). Finally, in the CPDM animal model, we found that BCI (at
concentrations: 50, 100, and 200 mg/kg) markedly increased the number of pNrf2-
positive cells in periodontal tissue and mitigated the alveolar bone loss.
Conclusions: Our data revealed a potential role for clinic application of BCI under
CPDM conditions, suggesting a new therapeutic drug for CPDM patients.

KEYWORDS

adjunctive periodontal therapy, antioxidants, diabetes, oxidative stress

1 |  I NTRO D U C TI O N activated Nrf2 to nucleus up-regulates the expression of phase 2

1
Periodontitis is a ubiquitous and irreversible inflammatory disease.
Some systemic diseases, such as diabetes mellitus (DM), have been
proved to be closely associated with periodontitis. 2 The risk of peri-
odontitis was reported approximately three times higher in patients
3
with DM than in those without DM. Even if the patients underwent
the same periodontal treatment, DM patients with poor glycaemic
control could not achieve the same curative effect as non-diabet-
ics.4 Numerous studies have been implemented to reveal the un-
derling mechanisms contributing to chronic periodontitis with DM
(CPDM), in which oxidative stress has been suggested as an import-
ant pathogenic factor in this composite disease. 5,6 Clinically, the
immunoglobulin G antibodies to periodontitis-related pathogens
were positively correlated with the levels of serum reactive oxygen
species (ROS) metabolites.7 Moreover, high-glucose exposure could
induce higher gingival oxidative stress, which enhanced alveolar
bone resorption in CPDM.6 These studies indicated that restricting
the ROS level to a certain range could be beneficial for periodontal
health. Therefore, effective antioxidants were believed to have the
potential function to ameliorate CPDM by relieving ROS-induced
oxidative stress.8
Baicalein (BCI) is a natural polyphenolic flavonoid component
extracted from Scutellaria baicalensis Georgi. Diverse pharmaco-
logical properties of BCI were addressed, such as antioxidant, an-
ti-inflammatory, anti-bacterial, and immunomodulating effects.9-12
Jiang et al suggested that the healthy benefits of BCI are mainly at-
tributed to its antioxidant properties.13 Nevertheless, the effect on
protecting periodontal tissue of BCI through its antioxidant effect
has not yet been elucidated. Our previous study found that BCI was
beneficial for periodontal bone regeneration, whereas the underly-
ing mechanisms remained largely unknown.14 One of the primary
cellular antioxidant pathways against ROS is mediated by nuclear
factor erythroid 2-related factor 2 (Nrf2).15 The translocation of
enzyme genes, including catalase (Cat), glutamate-cysteine ligase
catalytic subunit (Gclc), and superoxide dismutase 1 and 2 (Sod1 and
Sod2). Phosphorylation of Nrf2 at serine40 has been confirmed to
play a key mechanistic role in resisting oxidative stress.16 It has been
proved that BCI possesses the ability to activate Nrf2 signaling path-
way in oxidative stress-related diseases, including vitiligo, neurode-
generation, and cardiomyopathy.17-19
Therefore, in the present study, we hypothesized that BCI ex-
erts its protective function against diabetes-related periodontal
tissue damage by activating the Nrf2 antioxidant system. First, we
established the cellular CPDM model using human gingival epithe-
lial cells (hGECs) and characterized this model by determining the
ROS production, the expression levels of pNrf2 protein and Nrf2-
downstream genes (Cat, Gclc, Sod1, and Sod2). Based on this model,
we investigated the effects of BCI, including mitochondrial mem-
brane potential (MMP), the phosphorylation and translocation of
Nrf2, as well as the expression levels of Nrf2-downstream genes.
Particularly, we observed that BCI delivered by oral gavage into rat
CPDM model could halt the alveolar bone absorption. Taken to-
gether, our findings might provide a novel potential drug for patients
with CPDM.
2 | M ATE R I A L A N D M E TH O DS
2.1 | Study design
2.1.1 | In vitro experiments
For dose-response studies, hGECs were treated with glucose
or Porphyromonas gingivalis lipopolysaccharide (P gingivalis LPS;
Invivogen) at the indicated concentration, respectively (glucose: 5.5,
12.5, and 25  mmol/L; LPS: 2.5, 5, 10, and 20  µg/mL). The typical
ZHU et al.
TA B L E 1   Specific primer sequences used for real-time PCR analysis
Abbreviations GenBank number Product size (bp)
Cat NM_001752.3 145
Gclc NM_001197115 90
Sod1 NM_000454.4 109
Sod2 NM_001322820.1 164
Nrf2 NM_001313904.1 215
β-actin NM_001101.3 85
pro-inflammatory mediators, including tumor necrosis factor-alpha
(Tnf-α), interleukin 1β (Il-1β), Interleukin 6 (Il-6), and interleukin 8
(Il-8), were detected to determine the optimum concentrations of
glucose and LPS to simulate CPDM. After the CPDM model was es-
tablished in hGECs, cells were divided into four groups: 5.5 mmol/L
glucose (Con group); 25 mmol/L glucose (HG group); 5.5 mmol/L glu-
cose + 20 µg/mL LPS (LPS group); and 25 mmol/L glucose + 20 µg/
mL LPS (GP group). The oxidative stress level of hGECs in different
conditions was assessed by ROS production, Nrf2-related antioxi-
dant genes expression (Cat, Gclc, Sod1, and Sod2), cellular pNrf2 lo-
calization, and Nrf2 protein expression. Then, cells were incubated
with various concentrations of BCI (0.01, 0.1, 0.5, 1, and 10 µg/mL)
for 24 hours in order to investigate the effect of BCI on the viability
of the hGECs. Cells were pre-treated with BCI (0.01, 0.1, 0.5 µg/mL)
for 1 hour before stimulating with GP. Once the optimum concentra-
tions of BCI were determined, cells were divided into the following
groups: Con group; GP group; BCI + GP groups (exposure of cells to
GP before pre-incubated BCI for 1 hour with a range of concentra-
tions of 0.01, 0.1, 0.5 µg/mL). Antioxidant capacity of BCI was deter-
mined by MMP, ROS production, Nrf2-related antioxidant genes, and
pNrf2 protein expression.
2.1.2 | In vivo experiment
Sprague Dawley rats were divided randomly into four groups
(N = 10 per group): normal control (Con group); ligature and P gin-
givalis 33 277 infection at the maxillary second molars (PD group);
intraperitoneally injected with 35 mg/kg streptozotocin (DM group);
1  month after confirmation of diabetes, periodontitis was induced
for another 1 month (CPDM group). The animal model was verified
by characterizing the alveolar bone absorption, fasting blood glu-
cose, and insulin sensitivity index. Then, the effects of BCI on acti-
vating Nrf2 and inhibiting alveolar bone resorption in CPDM animal
model were assessed at three different doses (50, 100, or 200 mg/
kg/d), via oral gavage for 1 month.
|
      383
Primer sequence (5′-3′)
Forward: TGAGGTTGAACAGATAGC
Reverse: CACAGGTATATGAAGATAATTG
Forward: GCAAGGCCCAGAACAGCACG
Reverse: TCCCTCATCCATCTGGCAACTGT
Forward: CCGATGTGTCTATTGAAGATTCTG
Reverse: TTTCCACCTTTGCCCAAGTC
Forward: TGGTGGTCATATCAATCATAGC
Reverse: AACCTGAGCCTTGGACAC
Forward: TGCCCCTGGAAGTGTCAAACA
Reverse: CAACAGGGAGGTTAATGATTT
Forward: TGTTACAGGAAGTCCCTTGCCATC
Reverse: CTGTGTGGACTTGGGAGAGGAC
2.2 | Cell culture
Human gingival epithelial cells were purchased from Hua Tuo
Biotechnology Co., Ltd. and incubated in Dulbecco's Modified
Eagle's Medium (Gibco Life Technologies) supplemented with
10% fetal bovine serum (Gibco Life Technologies) and antibiotics
(penicillin 100  U/mL and streptomycin 100  µg/mL; Invitrogen Life
Technologies). Cells were cultured at 37°C in a humidified atmos-
phere with 95% air, 5% carbon dioxide. Culture medium was replaced
every three days. The cells were passaged when they reached ~ 80%
confluence using 0.25% trypsin-EDTA (Gibco Life Technologies).
2.3 | Cell viability assay
Human gingival epithelial cells were seeded in 96-well plates at a
density of 5  ×  103 cells per well. After 48  hours, cell vitality and
proliferation were assessed by 3-(4,5-Dimethylthiazol-2-yl)-2,5-
diphenyltetrazolium bromide (MTT) (Sigma-Aldrich) according to
the manufacturer's protocol. 20 The optical density (OD) at 450 nm
was measured using a microplate reader (Bio-Rad™ Model 680).
Experimental values were normalized to those of the untreated cells.
2.4 | Pro-inflammatory and Nrf2-related
antioxidative genes expression
The expression of pro-inflammatory and Nrf2-related antioxidant
genes was analyzed by real-time PCR as described previously.21
Briefly, hGECs were plated on 6-well plates (2.5  ×  105 cells per
well). After 48 hours, the total RNA was extracted using TRIzol rea-
gent (Invitrogen Life Technologies) and its concentration was deter-
mined by the NanoDrop 2000c spectrophotometer (Thermo Fisher
Scientific). Equal amounts of 2 μg total RNA were reverse-transcribed
using a First Strand cDNA Synthesis Kit (Fermentas) according to the
manufacturer's instruction. Gene expression was analyzed by an iQ5
 |
384       ZHU et al.
kit (BIO-RAD) with SYBR® Premix Ex Taq™ II enzyme (TaKaRa) and
normalized to the expression of β-actin. The sequencing primers of
Tnf-α, Il-1β, Il-6, Il-8, and β-actin were listed in Table S1. In addition, the
sequencing primers of human Cat, Gclc, Sod1, Sod2, Nrf2, and β-actin
were listed in Table 1.
2.5 | ROS generation
The ROS production was quantified using 2,7-dichlorodihydrofluo-
rescein diacetate (DCFH-DA, Sigma-Aldrich) by fluorescence-acti-
vated cell sorting (FACS). HGECs were plated in 6-well plates at a
density of 1.5 × 106 for 24 hours. Cells were incubated for 48 hours
with the corresponding treatments and loaded with 10  µmol/L
DCFH-DA for another 1  hour at 37°C. Cells were collected and
analyzed by FACS according to the manufacturer's instructions. 22
Intracellular DCF fluorescence was detected at wavelengths of
488 nm for excitation and 525 nm for emission using fluorescence
microplate reader (Thermo Fischer Scientific) and quantified.
2.6 | Cell localization of pNrf2
Cellular localization of pNrf2 was examined by laser scanning confo-
cal microscopy (LSCM) as described previously. 23 Briefly, cells were
4
cultured in 20-mm glass-bottom dishes at a density of 5 × 10 cells
per dish. After treating for 48 hours, cells were fixed in paraformal-
dehyde for 10 minutes at room temperature, washed and incubated
with an anti-pNrf2 antibody (1:50 dilution; Abcam, cat. no. 76026)
for 12 hours at 4°C. Then, cells were incubated with goat anti-rabbit
Cy3 antibody (1:1000 dilution; Abcam, cat. no. 6939) for 2 hours at
room temperature. Cells were counterstained with 4′, 6′-diamidino-
2-phenylindole-dihydrochloride (DAPI) (1:1000 dilution; Sigma, cat.
no. 9542) for visualizing the nucleus. Cells were mounted on slides
using 90% glycerol in PBS as mounting medium, and images were ob-
tained using LSCM (Olympus FV3000, Japan). To analyze the locali-
zation of each interesting protein in cells, different images obtained
from the same area were merged using EZ-C1 software (EZ-C1;
Nikon) and measured using NIS-Elements AR 3.2 software (Nikon
Instruments). Fluorescence intensity of pNrf2 was analyzed using
ImageJ software.
2.7 | Protein expression of Nrf2
Protein expression of Nrf2 and pNrf2 was analyzed by western blot
as described previously. 24 Briefly, protein extracts were performed
using the protein extraction kit (Jiancheng Bioengineering Institute)
according to the manufacturer's instruction. The total concentration
of protein in each sample was determined by the BCA protein assay
kit (Thermo Scientific). Equal amounts of protein (25 μg) were sepa-
rated on 10% SDS-PAGE (w/v) Bis-Tris gels, transferred to polyvi-
nylidene fluoride membranes, and then incubated overnight at 4°C
with corresponding primary antibodies. The following primary anti-
bodies were used: rabbit anti-pNrf2 antibody (diluted 1:500; Abcam,
cat. no. 76026), rabbit anti-Nrf2 antibody (diluted 1:500; Abcam,
cat. no. 31163) and rabbit anti-lamin B (diluted 1:1000; Abcam, cat.
no. 32535). Membranes were incubated at room temperature for
2  hours with HRP-conjugated anti-rabbit IgG (diluted 1:3000; Cell
Signaling Technology, cat. no. 7074) or anti-mouse IgG secondary
antibodies (diluted 1:3000; Cell Signaling Technology, cat. no. 7076).
Then, immunoreactive bands were detected using the ECL detec-
tion kit (Millipore). The band intensity was quantitated with Image
J software.
2.8 | MMP
5,5′,6,6′-tetrachloro-1,1′,3,3′ tetraethylbenzimidazolylcarbocya-
nine iodide (JC-1) kit (Beyotime Biotechnology Co., Ltd.) combined
with Mitochondrial Membrane Potential Assay Kit (Beyotime
Biotechnology Co., Ltd.) were employed to measure mitochondrial
depolarization in hGECs according to instruction of manufacturer. 25
Briefly, hGECs were seeded in laser confocal dishes at a density of
8  ×  10 4 cells per well and they were exposed to different stimu-
lation after 24  hours incubation. JC-1 accumulates in depolarized
mitochondria as J-monomers emitting green fluorescence and ac-
cumulates in healthy mitochondria to form J-aggregates emitting
red fluorescence. HGECs were incubated with JC-1 dye (10 µmol/L
final) for 20 min at 37°C in dark. The results of the assay were ob-
tained by LSCM (J-aggregates: excitation/emission  =  525/590 nm;
JC-1 monomers: excitation/emission  =  490/530  nm). The ratio of
JC-1 red/green fluorescence was calculated and normalized to the
Con group.
2.9 | Animals and experimental treatments
The experimental protocol was approved by Xi'an Jiaotong University
according to the guidelines of the Care and Use of Laboratory
Animals of the Chinese Council on Animal Research and Care. The
animal studies were conducted strictly following the University of
Xi'an Jiaotong University Guidelines for Animals in Research.
Seventy Sprague Dawley (male, 6-8  weeks old, 180-220  g)
rats were obtained from the animal research center, Xi'an Jiaotong
University. Rats were kept in a temperature-controlled (24°C) and
humidity-controlled (50%) room on a 12 hours light/dark cycle in a
specific pathogen-free facility with free access to food and water.
Rats were fed with high-sugar and high-fat diet for 1 month before
grouping. The rats were divided randomly into the following groups
(N = 10 per group):
Con group: normal control.
PD group: rats were induced using a ligature and P gingivalis
33 277 infection at the maxillary second molars as previously
described. 26
ZHU et al.
DM group: rats were intraperitoneally injected with 35  mg/kg
streptozotocin (STZ; dissolved in 1% sodium citrate buffer,
pH  =  4.5; Sigma-Aldrich) to induce type 2 DM. Three days
following STZ administration, rats with fasting blood glucose
concentrations ≥16.7 mmol/L and decreased insulin sensitivity
27
were selected as the STZ-induced DM group.
CPDM group: 1 month after confirmation of diabetes, periodon-
titis was induced for another 1 month.
CPDM treatment groups: rats were administered with BCI di-
luted in PBS by oral gavage for 1 month at three dose groups
(50, 100, or 200 mg/kg/d).
2.10 | Alveolar bone absorption
All rats were sacrificed after treatments via cervical dislocation
under ketamine (100  mg/kg) and xylazine (20  mg/kg) anesthesia.
The alveolar bone absorption was examined by Quantum GX micro-
computed tomography (micro-CT) (PerkinElmer). The changes of al-
veolar bone height at the maxillary second molars were assessed via
measuring the distance of the cemento-enamel junction (CEJ) to the
alveolar bone crest (ABC). The CEJ-ABC distance along the long axis
of the buccal roots of each maxillary second molar was measured
and presented in millimeters (mm).
2.11 | Fasting blood glucose
The fasting blood glucose level of Sprague Dawley rats was moni-
tored three days after the rats were intraperitoneally injected with
35 mg/kg STZ. The fasting blood glucose level of the rats was meas-
ured and recorded by a blood glucose meter (ACCU-CHEK, Roche
Company) using tail tip blood sampling after fasting 12 hours.
2.12 | Insulin sensitivity index
The rat insulin (INS) ELISA kit (Mercodia) was used to detect the
serum insulin content of the rats. The assay process was performed
according to the kit's instructions. The absorbance (OD value) at
450 nm was measured by a microplate reader to determine the in-
sulin concentration. The insulin sensitivity index was calculated ac-
cording to the formula: ISI = 22.5/(FBG × INS).
2.13 | Immunohistochemical analysis of pNrf2
Animals were sacrificed via cervical dislocation after euthanized with
ketamine (100 mg/kg) and xylazine (20 mg/kg). One-side maxillary
specimens were harvested and immediately fixed in 4% (w/v) para-
formaldehyde for at least two days, and sectioned at 5 μm as previ-
ously described. 26 The sections were then stained with anti-pNrf2
primary antibody (1:50; Abcam, cat. no. 76  026) at 4℃ overnight.
|
      385
Sections were then incubated with streptavidin biotin conjugated
anti-rabbit IgG. Diaminobenzidine chromogenic reagent kit (Boster,
Wuhan, China) was used to visualize the specific staining, following
by counterstaining with hematoxylin. The images were captured by
microscope (Olympus BX51, Japan) with × 400 magnification. Five
slides per sample were analyzed, and the percentage of pNrf2-posi-
tive cells was calculated.
2.14 | Statistical analysis
All experiments were performed in triplicate and repeated at least
three times. Data were presented as the means  ±  standard devia-
tions (SD). One-way analysis of variance followed by Dunnett's tests
was performed to determine the significant differences between
groups by SPSS 16.0. Statistically significant differences were con-
sidered at P < .05.
3 | R E S U LT S
3.1 | HGECs were challenged with P gingivalis LPS
in the context of high glucose to establish a stable
model of CPDM in vitro
A stable model of CPDM in vitro has been widely used by chal-
lenging the periodontal cells with P gingivalis LPS in high-glucose
environments. 28,29 MTT results showed that 25 mmol/L glucose sig-
nificantly reduced hGECs cell viability, when compared to the con-
trol group of hGECs in 5.5 mmol/L glucose (Figure S1A). In addition,
proliferative activity of hGECs was reduced by 10 and 20 µg/mL LPS
challenges, respectively (Figure S1B). Then, we verified the valid-
ity of the model by detecting the pro-inflammatory mediators (Tnf-
α, Il-1β, Il-6, and Il-8) that were typically expressed in periodontitis
with DM. HGECs treated with 25 mmol/L glucose + 20 µg/mL LPS
significantly up-regulated the gene expression of pro-inflammatory
cytokines, including Tnf-α, Il-1β, Il-6, and Il-8 (Figure S1C). According
to the results of MTT and real-time PCR, cells were divided into the
following groups: (a) Con group, cells were incubated in 5.5 mmol/L
glucose; (b) HG group, cells were incubated in 25 mmol/L glucose;
(c) LPS group, cells were incubated in 5.5 mmol/L glucose + 20 µg/
mL LPS; (d) GP group, cells were incubated in 25  mmol/L glu-
cose  +  20  µg/mL LPS. These four groups simulated the state of
health, periodontitis, DM, and periodontitis with DM in human at
the cellular level.
3.2 | GP stimulated the ROS production,
suppressed the gene expression level of antioxidant
enzymes and phosphorylation of Nrf2 in hGECs
Reactive oxygen species production is augmented in response
to inflammatory mediators. 30 Furthermore, oxidative stress, as
 |
386       ZHU et al.

F I G U R E 1   Intracellular ROS, Nrf2 gene and its downstream antioxidant genes, pNrf2 translocation and protein levels in physiological
and high concentration of glucose to hGECs with or without LPS. A, Intracellular ROS levels were indicated using DCFH-DA fluorescence
by FACS and the DCF fluorescence intensity was statistical analyzed. B, The mRNA levels of five antioxidant genes as indicated were
determined by real-time PCR and statistically analyzed. C, The translocation of pNrf2 (S40) was determined by LSCM (representative images
and statistical analysis). The nuclei was stained with DAPI. Scale bar = 30 μm. D, The protein levels of pNrf2 (S40) and total Nrf2 (t-Nrf2)
were determined by western blot analysis (representative images and statistical analysis). Data from representative results were expressed
as mean ± SD from a minimum of three replicates per experiment. *P < .05 represents significant differences compared to the Con group;
#
P < .05 represents significant differences compared to the GP group

a result of elevated intracellular ROS, has been proved as an im-
portant contributor to CPDM. 5,6 FACS analysis revealed a shift of
2',7'-dichlorofluorescein (DCF)-specific fluorescence signal after
HG, LPS, and GP treatment. Moreover, DCF-specific fluorescence
signal was significantly elevated in the GP group compared with
DCF-specific fluorescence signal in HG or LPS group (Figure 1A).
As a response to excess intracellular ROS, cells normally have
several protective mechanisms to scavenge ROS, such as the activa-
tion of antioxidant enzymes.31 In the present study, we found that
the mRNA levels of some representative anti-antioxidant-related
genes (Cat, Gclc, Sod1, Sod2, and Nrf2) were significantly decreased
after hGECs were treated with GP (Figure 1B). It indicated that the
antioxidant systems were compromised when the hGECs were ex-
posed to GP environment.
The antioxidant enzymes mentioned above were regulated by
the nuclear transcription factor Nrf2. Immunofluorescence analysis
showed that the fluorescent intensities in the nucleus of pNrf2 were
decreased in groups challenged with HG, LPS, or GP. Furthermore,
the relative fluorescence intensities of pNrf2 in the GP-treated
groups were weaker compared with the fluorescent intensities of
pNrf2 in the HG group and LPS group (Figure 1C), and this result was
further confirmed by western blot using a specific antibody against
pNrf2 (Figure 1D). Taken together, the results from Figure 1 indi-
cated that Nrf2-mediated signaling pathway might be compromised
by stimulation of GP in hGECs.
3.3 | BCI prevented hGECs from oxidative damage
caused by GP via the Nrf2 signaling pathway
Cells were incubated with various concentrations of the compound
(0.01, 0.1, 0.5, 1, and 10 µg/mL) for 24 hours in order to investigate
the effect of BCI on the viability of hGECs. Treatment with BCI at
concentrations of 0.01, 0.1, and 0.5  µg/mL increased cell viability
of the hGECs in a dose-dependent manner (Figure S2A), while 1 and
10 µg/mL BCI inhibited the cell viability compared with the control.
Accordingly, BCI at concentrations of 0.01, 0.1, and 0.5 µg/mL was
selected for subsequent experiments. And the MTT results showed
that 0.01 to 0.5 µg/mL BCI could promote the viability of hGECs in
BCI + GP groups (Figure S2B).
The anti-antioxidant activity of BCI against GP-induced oxidative
damage was further examined. FACS analysis indicated that pre-treat-
ment with BCI could significantly suppress the excess ROS production
induced by GP (Figure 2A). Moreover, GP caused a loss of MMP as
ZHU et al. |
      387

F I G U R E 2   Effects of BCI on ROS production and MMP in high concentration of glucose to hGECs with LPS. A, Intracellular ROS levels
were indicated using the DCF fluorescence intensity (representative images and statistical analysis). B, MMP was measured by LSCM
analysis of JC-1 staining (representative images and statistical analysis). Scale bar = 50 μm. Data from representative results were shown
as mean ± SD from a minimum of three replicates per experiment. *P < .05 represents significant differences compared to the Con group;
#
P < .05 represents significant differences compared to the GP group

showed by the loss of the red signal and the increase of green signal.
However, pre-treatment with BCI reversed the MMP loss (Figure 2B).
We further examined the production of antioxidant enzymes of
BCI-mediated cytoprotection. Cells that pre-treated with 0.01, 0.1,
and 0.5  µg/mL BCI in BCI  +  GP groups significantly increased the
mRNA levels of Nrf2, Sod1, Sod2, Cat and Gclc as compared with the
GP group without BCI treatment (Figure 3A). Moreover, pNrf2 was
augmented in the BCI  +  GP treatment groups than the GP group,
as showed by increased fluorescent intensities of pNrf2 detected
by LSCM (Figure 3B). The western blot analysis also showed an in-
creased ratio of pNrf2/total Nrf2 expression in BCI + GP treatment
groups (Figure 3C).
than that in the Con group (Figure S3C). DM groups exhibited hyper-
glycemia with higher fasting blood glucose levels (Figure S3D) and
significantly decreased insulin sensitivity index (Figure S3E) than the
non-DM groups. These results indicated that a DM model could be
induced in rats by treating the animals with a high-fat and high-sugar
diet before intraperitoneally injection of 35 mg/kg STZ. Thread liga-
tion combined with P gingivalis ATCC 33  277 local injection at the
maxillary second molars could induce a periodontitis model. Rats un-
derwent these two combined methods exhibited a CPDM phenotype.
3.5 | BCI treatment had no effect on fasting blood
glucose and insulin sensitivity index in CPDM in vivo

3.4 | Characterizations of the stable CPDM model
in vivo
The stable CPDM model in Sprague Dawley rats used in the present
study was established and illustrated in Figure S3A,B. All animals
enrolled in the study were maintained in good systemic health dur-
ing the observation period. The lengths of CEJ-ABC at the maxillary
second molars in the PD and CPDM groups were significantly greater
Our previous study demonstrated that 50, 100, and 200 mg/mL BCI
significantly inhibited the absorption of alveolar bone in rats with no
side effects. 26 Accordingly, rats in the present study were adminis-
trated with BCI at the same doses. Individual diabetes effected the
development of periodontitis.32 In order to examine whether BCI af-
fects the diabetic level, we tested the fasting blood glucose and insu-
lin sensitivity index. The results showed that there was no significant
difference after BCI treatment in CPDM in vivo (Figure S4).
 |
388       ZHU et al.

F I G U R E 3   Effects of BCI on the expression of antioxidant enzymes, nucleus accumulation and protein expression of pNrf2 in high
concentration of glucose to hGECs with LPS. A, The mRNA levels of five antioxidant genes as indicated were determined by real-time
PCR and statistically analyzed. B, The translocation of pNrf2 (S40) was determined by LSCM (representative images and statistical
analysis). Nuclei were stained with DAPI. Scale bar = 25 μm. C, The protein level of pNrf2 (S40) and t-Nrf2 was determined by western
blot (representative images and statistical analysis). Data from representative results were shown as mean ± SD from a minimum of three
replicates per experiment. *P < .05 represents significant differences compared to the Con group; #P < .05 represents significant differences
compared to the GP group

3.6 | BCI increased pNrf2 expression and
mitigated the alveolar bone loss in rats
Immunohistochemical analysis revealed that treatment with 50, 100,
and 200 mg/kg BCI markedly increased the number of pNrf2-posi-
tive cells compared with CPDM group (Figure 4). We further inves-
tigated the effect of BCI on the prevention of alveolar bone loss by
micro-CT (Figure 5). The results showed that administering rats with
BCI (50, 100, 200  mg/kg body weight) dramatically mitigated the
CPDM-mediated alveolar bone loss.
4 |  D I S CU S S I O N
It is well known that ROS in redox biology state act as signaling mol-
ecules to the maintenance of the cells’ normal actions. The balance
between redox physiological and biochemical homeostasis is precisely
regulated by antioxidant system including a series of enzymes that can
scavenge ROS and dietary-derived molecules, for example Nrf2, Cat,
Gclc, Sod1, and Sod2 33,34 However, the excessive ROS leads to tissue
damage in the state of oxidative stress which has been also recognized
as an important contributor to periodontal destruction in CPDM.6
Studies reported that the systemic level of ROS in serum of patients
with CPDM was excessively increased.5 Previous results further im-
plied a disturbance in antioxidant defence system that the activities
of SOD and CAT were reduced in saliva.35 This may be attributable
to excessive ROS production from glucose and glycated antioxidative
enzymes which destroy their capacity to scavenge ROS. The results
of the present study showed that ROS was elevated, mitochondria
membrane potential was reduced, pNrf2 and Nrf2-related antioxidant
genes were decreased after hGECs were stimulated with 25 mmol/L
glucose plus 20 µg/mL LPS. Accordingly, the model that hGECs stim-
ulated with 25  mmol/L glucose plus 20  µg/mL LPS can be used for
evaluating the level of oxidative stress for CPDM in vitro.
Periodontitis is caused by the host response to various bac-
terial infections.1 The gingival epithelium serves as the primary
physical and chemical barrier affecting the immune system and
responding to the foreign bacteria. 36 Thus, gingival epithelial
cells play a pivotal role in the maintenance of periodontal health.
However, it has been documented that inflammatory conditions
ZHU et al.
F I G U R E 4   Effects of BCI on pNrf2 (S40) expression in periodontal tissue in rats with CPDM. PNrf2-positive cells were detected by
immunohistochemical analysis (representative images and statistical analysis). Data from representative results were shown as mean ± SD
from a minimum of three replicates per experiment. *P < .05 represents significant differences compared to the CPDM group
such as periodontitis could reduce gingival epithelium functions
associated with periodontal homeostasis. 37 Thus, it is important to
enhance the proliferation of gingival epithelium cells of the peri-
odontium. Li et al suggested that the cell proliferation activity in
primary hGECs was significantly decreased at the concentration
of BCI > 4.7 μg/mL. 38 In the present work, more than 1 µg/mL BCI
decreased the proliferation of hGECs. These results indicated that
the treatment with high concentrations of BCI was not conducive
to cell proliferation. Interestingly, the BCI concentration used in
this study was lower than Li's report, this probably because the
hGECs cell line used in the present study was more sensitive to
BCI stimulation than the primary hGECs.
The association of periodontitis and DM has been well docu-
mented recently. Based on the latest classification standard 2018,
DM was believed and defined as an important descriptor in the stag-
ing and grading process of periodontitis.39 DM shifts the immune
defence outside their normal boundary responses to bacterial chal-
lenges, which can negatively affect periodontal tissues, resulting in
the severity and prognosis of periodontitis. In our present study,
diabetic rats with periodontitis exhibited a more severe periodon-
titis status. It has been demonstrated that glycemic control of indi-
viduals affects the progress of periodontitis.40 Thus, we detected
the fasting blood glucose level and insulin sensitivity index after BCI
administration. The results showed that there were no significant
differences for these two indexes between CPDM and CPDM + BCI
F I G U R E 5   Effects of BCI on alveolar
bone loss in rats with CPDM. The distance
of CEJ to ABC was measured by micro-
CT (representative images and statistical
analysis). Data from representative results
were shown as mean ± SD from a
minimum of three replicates per
experiment. *P < .05 represents significant
differences compared to the CPDM group
|
      389
groups. Epidemiological evidence has demonstrated a bidirectional
relationship between periodontitis and DM.41 In our study, BCI ad-
ministration for one month inhibited the absorption of alveolar bone
with no effect on blood glucose. However, the long-term therapeutic
effect of BCI on blood glucose requires further observation.
Nrf2 has been recognized as a possible drug target for enhancing
antioxidant production of the host.31 Several antioxidant compounds
such as resveratrol, paeonol, and isorhamnetin were reported to be
able to promote the expression of Nrf2.42-44 A recent study has
described an increase in the oxidative damage indicators and a de-
crease of total Nrf2 in an experiment CPDM model.45 However, the
phosphorylation form of Nrf2 at serine40 has been confirmed to
play a key mechanistic role in regulating the resistance to oxidative
stress.16 Thus, under the oxidative stress condition, the phosphor-
ylation form of Nrf2 should be examined instead of the total level
of Nrf2. Posttranslational regulation of Nrf2 is known to be mod-
ulated by different kinases that phosphorylate Nrf2 and affect its
activation. Previous study showed that selective inhibitors of phos-
phoinositol-3-kinase/AKT could block the cytoprotective effect of
BCI.46 In our study, immunofluorescence technique and western
blot were used to evaluate the activation of pNrf2 and its related
downstream genes; however, further investigations are needed to
clarify the detailed molecular mechanism on Nrf2 activation.
A relationship between periodontitis and cytoprotective en-
zymes themselves has also been demonstrated. 31 Genetic mutation
 |
390       ZHU et al.
of SOD was identified as a risk factor for periodontitis.47 In addi-
tion, both Nrf2 and sirtuin 1 have been reported to play important
roles in regulating SOD. 31 Therefore, not only Nrf2-dependent an-
tioxidant axis but also sirtuin 1 mediated cytoprotective mecha-
nisms may play roles in control periodontal homeostasis. Further
study is needed to investigate the regulatory role of other antiox-
idant signaling pathways and their relationship with CPDM. Apart
from the role in the antioxidant system, Nrf2 has been reported
to participate in inflammatory responses via activation of its tar-
31
get genes. The present study revealed that exposure of hGECs
to GP up-regulated the pro-inflammatory factors and at the same
time reduced Nrf2 expression. It was reported that Nrf2 activa-
tion could inhibit the oxidative stress driven by the nuclear factor
kappa beta-mediated inflammatory response via heme oxygenase
1 end-products.48 In contrast, the nuclear factor kappa beta p65
subunit also repressed the Nrf2/ARE pathway at the transcriptional
level via deprivation of cAMP response element binding protein
from Nrf2.49 Activation of Nrf2 by BCI promoted the antioxidant
ability of the hGECs and subsequently down-regulated the inflam-
matory responses to protect alveolar bone, as shown by mitigation
of CPDM-induced alveolar bone resorption in rats.
Oral administration of BCI is safe and well tolerated. The com-
pound exhibited favorable pharmacokinetics (100-2800 mg daily).50
In our study, rats were orally gavaged with BCI at three doses (50,
100, and 200  mg/mL), and no side effects of BCI were observed
during the study. In addition, BCI significantly up-regulated the
expression of pNrf2 and inhibited the absorption of alveolar bone
in rats with CPDM. However, oral bioavailability of BCI is very low
which may be due to its poor solubility and short half-life.51 The
clinical applications of BCI must be highly improved if we develop
drugs to treat periodontitis via periodontal pocket in the future, and
different delivery ways need to be studied, such as BCI-loaded nano-
structured lipid carriers.38
5 |  CO N C LU S I O N
In the present study, we examined the mechanisms by which BCI
prevented oxidative stress via Nrf2 signaling pathway in two experi-
mental CPDM models in vitro and in vivo. This study demonstrated
that BCI significantly reduced ROS formation, increased the expres-
sion of Nrf2 and its downstream genes (Cat, Gclc, Sod1, and Sod2).
Furthermore, rats administrated with BCI markedly increased the
number of pNrf2-positive cells and mitigated the CPDM-mediated
alveolar bone loss. Our findings suggested that BCI promoted peri-
odontal health by stimulating Nrf2-mediated antioxidant defence
systems. On the basis of the present studies, we proposed that BCI
might be developed as a novel therapeutic drug for the clinical treat-
ment of periodontitis with DM.
AC K N OW L E D G E M E N T S
We thank Drs Jianmin Yang and Zhongbo Liu for carefully read-
ing the manuscript. This work was supported by a grant from the
National Natural Science Foundation of China (Grant No. 81901019
and 81870798), and from the Fundamental Research Funds for the
Central Universities (Grant No. xjj2017025 and xjj2017097).
C O N FL I C T O F I N T E R E S T
The authors declare no conflicts of interest with respect to the au-
thorship and/or publication of this article.
ORCID
Dandan Pei  https://orcid.org/0000-0003-4470-5400
Ang Li  https://orcid.org/0000-0001-6720-0785
REFERENCES
1. Chapple ILC, Van der Weijden F, Doerfer C, et al. Primary pre-
vention of periodontitis: managing gingivitis. J Clin Periodontol.
2015;42(Suppl 16):S71-76.
2. Costa KL, Taboza ZA, Angelino GB, et al. Influence of periodontal
disease on changes of glycated hemoglobin levels in patients with
type 2 diabetes mellitus: a retrospective cohort study. J Periodontol.
2017;88:17-25.
3. Stanko P, Izakovicova HL. Bidirectional association between di-
abetes mellitus and inflammatory periodontal disease. A review.
Biomed Pap. 2014;158:35-38.
4. Gurav AN. Management of diabolical diabetes mellitus and
periodontitis nexus: are we doing enough? World J Diabetes.
2016;7:50-66.
5. Patil VS, Patil VP, Gokhale N, Acharya A, Kangokar P. Chronic peri-
odontitis in type 2 diabetes mellitus: oxidative stress as a common
factor in periodontal tissue injury. J Clin Diagn Res. 2016;10:BC12-16.
6. Vincent RR, Appukuttan D, Victor DJ, Balasundaram A. Oxidative
stress in chronic periodontitis patients with type II diabetes melli-
tus. Eur J Dent. 2018;12:225-231.
7. Tamaki N, Hayashida H, Fukui M, et al. Oxidative stress and anti-
body levels to periodontal bacteria in adults: the Nagasaki Islands
study. Oral Dis. 2014;20:e49-e56.
8. Luigi N, Nikos D. Periodontitis and redox status: a review. Curr
Pharm Design. 2013;19:2687-2697.
9. Tian Y, Li X, Xie H, et al. Protective mechanism of the antioxidant
baicalein toward hydroxyl radical-treated bone marrow-derived
mesenchymal stem cells. Molecules. 2018;23:223.
10. Patwardhan RS, Sharma D, Thoh M, Checker R, Sandur SK. Baicalein
exhibits anti-inflammatory effects via inhibition of NF-κB transacti-
vation. Biochem Pharmacol. 2016;108:75-89.
11. Tsou LK, Lara-Tejero M, RoseFigura J, et al. Antibacterial flavonoids
from medicinal plants covalently inactivate type iii protein secre-
tion substrates. J Am Chem Soc. 2016;138:2209-2218.
12. Shen YC, Chiou WF, Chou YC, Chen CF. Mechanisms in mediating
the anti-inflammatory effects of baicalin and baicalein in human
leukocytes. Eur J Pharmacol. 2003;465:171-181.
13. Jiang M, Li Z, Zhu G. Protective role of flavonoid baicalin from
Scutellaria baicalensis in periodontal disease pathogenesis: a litera-
ture review. Complement Ther Med. 2018;38:11-18.
14. Liu J, Wang S, Sun J, et al. Screening of osteoanagenesis-active
compounds from scutellaria baicalensis georgi by hPDLC/CMC–on-
line-HPLC/MS. Fitoterapia. 2014;93:105-114.
15. Kraft AD, Lee JM, Johnson DA, Kan YW, Johnson JA. Neuronal
sensitivity to kainic acid is dependent on the Nrf2-mediated ac-
tions of the antioxidant response element. J Neurochem. 2006;98:
1852-1865.
16. D'Autréaux B, Toledano MB. ROS as signalling molecules: mecha-
nisms that generate specificity in ROS homeostasis. Nat Rev Mol Cell
Bio. 2007;8:813-824.
ZHU et al.
17. Ma J, Li S, Zhu L, et al. Baicalein protects human vitiligo melanocytes
from oxidative stress through activation of NF-E2-related factor2
(Nrf2) signaling pathway. Free Radical Bio Med. 2018;129:492-503.
18. Choi E-O, Jeong J-W, Park C, et al. Baicalein protects C6 glial cells
against hydrogen peroxide-induced oxidative stress and apoptosis
through regulation of the Nrf2 signaling pathway. Int J Mol Med.
2016;37:798-806.
19. Cui G, Chui Wah Luk S, Li RA, et al. Cytoprotection of baicalein
against oxidative stress-induced cardiomyocytes injury through the
Nrf2/Keap1 pathway. J Cardiovasc Pharm. 2015;65:39-46.
20. Zhang Y, Cui L, Guan G, et al. Matrine suppresses cardiac fibrosis by
inhibiting the TGF-β/Smad pathway in experimental diabetic car-
diomyopathy. Mol Med Rep. 2018;17:1775-1781.
21. Ren Y, Li Y, Yan J, et al. Adiponectin modulates oxidative stress-in-
duced mitophagy and protects C2C12 myoblasts against apoptosis.
Sci Rep. 2017;7:3209.
22. Yerra VG, Kalvala AK, Sherkhane B, Areti A, Kumar A. Adenosine
monophosphate-activated protein kinase modulation by berberine
attenuates mitochondrial deficits and redox imbalance in experimen-
tal diabetic neuropathy. Neuropharmacology. 2018;131:256-270.
23. Zhou H, Yue Y, Wang J, Ma Q, Chen Y. Melatonin therapy for di-
abetic cardiomyopathy: a mechanism involving Syk-mitochondrial
complex I-SERCA pathway. Cell Signal. 2018;47:88-100.
24. Wang D, Sun H, Song G, et al. Resveratrol improves muscle atrophy
by modulating mitochondrial quality control in STZ-induced dia-
betic mice. Mol Nutr Food Res. 2018;62:e1700941.
25. Sun L, Zhao M, Yang Y, et al. Acetylcholine attenuates hypoxia/re-
oxygenation injury by inducing mitophagy through PINK1/Parkin
signal pathway in H9c2 cells. J Cell Physiol. 2016;231:1171-1181.
26. Sun J-Y, Li D-L, Dong Y, et al. Baicalin inhibits toll-like receptor 2/4
expression and downstream signaling in rat experimental periodon-
titis. Int Immunopharmacol. 2016;36:86-93.
27. Li X, Sun X, Zhang X, et al. Enhanced oxidative damage and Nrf2
downregulation contribute to the aggravation of periodontitis by
diabetes mellitus. Oxid Med Cell Longev. 2018;2018:9421019.
28. Yang XI, Zhang J, Ni J, et al. Toll-like receptor 4-mediated hyper-re-
sponsiveness of gingival epithelial cells to lipopolysaccharide in
high-glucose environments. J Periodontol. 2014;85:1620-1628.
29. Chiu HC, Fu M, Yang T, et al. Effect of high glucose, porphyromonas
gingivalis lipopolysaccharide and advanced glycation end-prod-
ucts on production of interleukin-6/-8 by gingival fibroblasts. J
Periodontal Res. 2017;52:268-276.
3 0. Lee IT, Yang C. Role of NADPH oxidase/ROS in pro-inflamma-
tory mediators-induced airway and pulmonary diseases. Biochem
Pharmacol. 2012;84:581-590.
31. Kanzaki H, Wada S, Narimiya T, et al. Pathways that regulate ROS
scavenging enzymes, and their role in defense against tissue de-
struction in periodontitis. Front Physiol. 2017;8:351.
32. Caton JG, Armitage G, Berglundh T, et al. A new classification
scheme for periodontal and peri-implant diseases and conditions
- introduction and key changes from the 1999 classification. J
Periodontol. 2018;89:S1-S8.
33. Kakkar R, Kalra J, Mantha SV, Prasad K. Lipid peroxidation and
activity of antioxidant enzymes in diabetic rats. Mol Cell Biochem.
1995;151:113-119.
3 4. Netto LES, Antunes F. The roles of peroxiredoxin and thioredoxin
in hydrogen peroxide sensing and in signal transduction. Mol Cells.
2016;39:65-71.
35. Trivedi S, Lal N, Mahdi AA, Mittal M, Singh B, Pandey S. Evaluation
of antioxidant enzymes activity and malondialdehyde levels in pa-
tients with chronic periodontitis and diabetes mellitus. J Periodontol.
2014;85:713-720.
36. Takuji N, Hideki S, Hitoshi K, et al. Syntheses of prostaglandin E2
and E-cadherin and gene expression of beta-defensin-2 by human
gingival epithelial cells in response to Actinobacillus actinomycetem-
comitans. Inflammation. 2003;27:341-349.
|
      391
37. Huang X, Yang XI, Ni J, et al. Hyperglucose contributes to periodon-
titis: involvement of the NLRP3 pathway by engaging the innate im-
munity of oral gingival epithelium. J Periodontol. 2015;86:327-335.
38. Li X, Luo W, Ng TW, et al. Nanoparticle-encapsulated baicalein
markedly modulates pro-inflammatory response in gingival epithe-
lial cells. Nanoscale. 2017;9:12897-12907.
39. Tonetti MS, Greenwell H, Kornman KS. Staging and grading of peri-
odontitis: framework and proposal of a new classification and case
definition. J Periodontol. 2018;89:S159-S172.
4 0. Teshome A, Yitayeh A. The effect of periodontal therapy on gly-
cemic control and fasting plasma glucose level in type 2 diabetic
patients: systematic review and meta-analysis. Bmc Oral Health.
2017;17:31.
41. Khazaii R, Kamareh S. Relationship between diabetes and periodon-
tal disease: a review of literature. Ann Dent Spec. 2018;6:57-60.
42. Tamaki N, Orihuela-Campos RC, Inagaki Y, Fukui M, Nagata T, Ito
HO. Resveratrol improves oxidative stress and prevents the pro-
gression of periodontitis via the activation of the Sirtl/AMPK and
the Nrf2/antioxidant defense pathways in a rat periodontitis model.
Free Radical Bio Med. 2014;75:222-229.
43. Li J, Li YP, Pan S, Zhang L, He L, Niu Y. Paeonol attenuates liga-
tion-induced periodontitis in rats by inhibiting osteoclastogen-
esis via regulating Nrf2/NF-kappaB/NFATc1 signaling pathway.
Biochimie. 2019;156:129-137.
4 4. Qi F, Sun JH, Yan JQ, Li CM, Lv XC. Anti-inflammatory effects of isor-
hamnetin on LPS-stimulated human gingival fibroblasts by activat-
ing Nrf2 signaling pathway. Microb Pathogenesis. 2018;120:37-41.
45. Bi C-S, Wang J, Qu H-L, et al. Calcitriol suppresses lipopolysaccha-
ride-induced alveolar bone damage in rats by regulating T helper
cell subset polarization. J Periodontal Res. 2019;1–12.
46. Zhang Z, Cui W, Li G, et al. Baicalein protects against 6-OHDA-
induced neurotoxicity through activation of Keap1/Nrf2/HO-1 and
involving PKCα and PI3K/AKT signaling pathways. J Agr Food Chem.
2012;60:8171-8182.
47. Kazemi E, Moradi MT, Yari K, Mousavi SAR, Kahrizi D. Association
between manganese superoxide dismutase (MnSOD Val-9Ala) gen-
otypes with the risk of generalized aggressive periodontitis disease.
Cell Mol Biol. 2015;61:49-52.
48. Morgan MJ, Liu Z. Crosstalk of reactive oxygen species and NF-
kappa B signaling. Cell Res. 2011;21:103-115.
49. Liu GH, Qu J, Shen X. NF-kappa B/p65 antagonizes Nrf2-ARE path-
way by depriving CBP from Nrf2 and facilitating recruitment of
HDAC3 to MafK. Biochim Biophys Acta. 2008;1783:713-727.
50. Lai M-Y, Hsiu S-L, Tsai S-Y, Hou Y-C, Chao P-D. Comparison of met-
abolic pharmacokinetics of baicalin and baicalein in rats. J Pharm
Pharmacol. 2003;55:205-209.
51. Zhang J, Lv H, Jiang K, Gao Y. Enhanced bioavailability after oral
and pulmonary administration of baicalein nanocrystal. Int J
Pharmaceut. 2011;420:180-188.
S U P P O R T I N G I N FO R M AT I O N
Additional supporting information may be found online in the
Supporting Information section. 
How to cite this article: Zhu C, Zhao Y, Wu X, et al. The
therapeutic role of baicalein in combating experimental
periodontitis with diabetes via Nrf2 antioxidant signaling
pathway. J Periodont Res. 2020;55:381–391. https​://doi.
org/10.1111/jre.12722​