Received: 11 August 2020 | Revised: 25 November 2020 | Accepted: 10 January 2021

DOI: 10.1111/jre.12851

ORIGINAL ARTICLE

Effects of oxidative stress-­induced increases in Zn2+

concentrations in human gingival epithelial cells

Hiroko Yagi | Chiharu Fujihara | Shinya Murakami

Department of Periodontology, Osaka

University Graduate School of Dentistry,
Osaka, Japan
Correspondence
Hiroko Yagi, Department of
Periodontology, Osaka University
Graduate School of Dentistry, 1-­8
Yamadaoka, Suita, Osaka 565-­0 871,
Japan.
Email: m.hiroko@dent.osaka-u.ac.jp
Funding information
KAKENHI, Grant/Award Number:
17H06852 and 19K18996
Abstract
Background and objective: Previous studies have reported that oxidative stress in-
creases intracellular Zn2+ concentrations and induces cytotoxicity. However, no stud-
ies have investigated whether oxidative stress induces such changes in periodontal
tissue cells. In the present study, we investigated the effect of oxidative stress on
intracellular Zn2+ concentration in periodontium constituent cells and its potential re-
lationship with periodontal disease.
Methods: We analyzed changes in intracellular Zn2+ concentrations in human gingival
epithelial (epi4) cells treated with hydrogen peroxide (H2O2). The fluorescent probes
FluoZin-­3 AM and CellTracker Green CMFDA were used to detect intracellular Zn2+
and thiol groups, respectively. Western blot analyses, luciferase reporter assays, and
real-­time polymerase chain reaction (PCR) analyses were performed to examine the
effect of intracellular Zn2+ on epi4 cells.
Results: H2O2 treatment increased intracellular concentrations of Zn2+ in epi4 cells by
facilitating the movement of Zn2+ from cellular nonprotein thiols to the cytoplasm and
promoting cell membrane permeability to Zn2+. Furthermore, H2O2-­induced increases
in intracellular Zn2+ activated the p38 cAMP response element-­binding protein/
mitogen-­activated protein kinase (p38 CREB/MAPK) cascade, upregulated nuclear
factor kappa B (NF-­κB) DNA binding, and increased the expression of inflammatory
cytokines and matrix metallopeptidase-­9 (MMP-­9).
Conclusion: Increases in intracellular Zn2+ induced by oxidative stress activate signal-
ing pathways involved in inflammation, potentially contributing to the progression of
periodontal disease.

KEYWORDS
gingival epithelial cells, inflammation, oxidative stress, periodontitis, Zn

1 | I NTRO D U C TI O N
Oxidative stress is induced by an imbalance between reactive oxygen
species (ROS) production and antioxidant metabolism, leading to in-
creases in ROS expression.1,2 Such increases in ROS expression have
been implicated in the etiology of various chronic inflammatory dis-
eases.3 Excessive ROS production induces damage to cellular nucleic
acids, proteins, and lipids4,5 and increases the expression of inflam-
matory cytokines.6-­10 Factors such as smoking, cellular senescence,
and oral infections are also known to influence ROS production,11,12
thereby contributing to destruction of the periodontal tissue and the
progression of periodontal disease.11,13 Furthermore, previous stud-
ies have reported a positive correlation between oxidative stress and
the severity of periodontal disease.13 In this study, we conducted

© 2021 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd

J Periodont Res. 2021;00:1–11.  wileyonlinelibrary.com/journal/jre | 1

2 |
experiments using gingival epithelial cells because plaque accumula-
tion in the gingival sulcus exposes these cells to oxidative stress prior
to the development of inflammation in periodontal ligament cells.
Then, we thought that analysis using gingival epithelial cells would lead
to elucidation of the mechanism of periodontal disease development.
2+
The trace mineral Zn functions as a cofactor for various en-
14
zymes and transcription factors and is indispensable to living
bodies. When released from the cellular vesicle, Zn2+ functions as
a secondary messenger for the maintenance of intracellular ho-
meostasis.15-­18 While plasma Zn2+ concentrations are typically low
(13.8 μmol/L-­22.9 μmol/L),19 increases in intracellular or plasma Zn2+
concentrations have been associated with the development of can-
cer, diabetes, and inflammation. 20-­22 Several studies have reported
that oxidative stress increases intracellular Zn2+ concentrations
and enhances hydrogen peroxide (H2O2) cytotoxicity in rat thymo-
cytes. 23-­25 Additional evidence indicates that H2O2 cytotoxicity is
attenuated by suppressing increases in intracellular Zn2+ concentra-
23-­25 2+
tions. Therefore, intracellular Zn levels in constituent cells of
the periodontal tissue may fluctuate in loci where periodontal dis-
ease has caused inflammation, and these variations in intracellular
Zn2+ levels may be associated with the progression of periodontal
disease. However, the relationship between periodontal disease and
Zn2+ concentrations remains to be clarified. Therefore, in the pres-
ent study, we aimed to investigate the mechanisms by which intra-
cellular Zn2+ concentration may be related to the pathogenesis and
progression of periodontal disease.
2 | M ATE R I A L S A N D M E TH O DS
2.1 | Cell cultures
A human gingival epithelial cell line (epi4) was established and main-
tained in accordance with previously described methods. 26-­29 The
epi4 cell line was transfected with the simian virus 40 T antigen gene
using calcium phosphate or the transfection reagent Tfx™-­20. This
30,31
cell line expresses E-­cadherin, β-­catenin, and claudin-­1. This cell
line was cultured with HuMedia-­KG2 (Kurabo Industries Ltd.) con-
taining final concentrations of 0.5 μg/ml hydrocortisone, 10 μg/ml
insulin, 0.4% (v/v) bovine pituitary extract, 0.1 ng/ml human epider-
mal growth factor (hEGF), 50 μg/ml gentamycin, and 50 ng/ml am-
photericin B at 37°C in a 5% CO2 incubator.
2.2 | Fluorescence imaging
Epi4 cells (3 × 105 cells/well) were passaged in Matsunami glass
bottom dishes (Matsunami Glass Industries Ltd.) containing
HuMedia-­KG2. Under a fluorescence microscope, the culture me-
dium was replaced with Tyrode's solution (NaCl: 150 nM, KCl: 5 nM,
CaCl2: 2 nM, MgCl2: 1 nM, glucose: 5 nM, HEPES: 5 nM, with an ap-
propriate amount of NaOH to adjust the pH to 7.3.7.4) (Wako Pure
Chemical Industries Ltd.).
YAGI et al.
FluoZin-­3 AM32 (Thermo Fisher Scientific) was used as an indica-
tor of intracellular Zn2+. The epi4 cells were incubated with 500 nM
FluoZin-­3 AM for 30 minutes prior to fluorescence imaging to esti-
mate changes in intracellular Zn2+ concentrations in cells with intact
membranes. FluoZin-­3 AM fluorescence was evident in cells that
had not been stained with 5 μM propidium iodide (PI). 23 To exam-
ine the effects of 10 μM N, N, N′, N′-­tetrakis (2-­pyridylmethyl) eth-
ylenediamine (TPEN) (Abcam), 10 μM diethylenetriamine-­N, N, N′,
N′′, N′′-­pentaacetic acid (DTPA) (Dojin Chemical Laboratory), and
50 μM ethylenediaminetetraacetic acid (EDTA) (Nacalai Tesque, Inc.)
on intracellular Zn2+ concentrations, the three agents were added to
the cell cultures just prior to the application of H2O2 (300 μM) (Wako
Pure Chemical Industries, Ltd.). The cells were incubated with the re-
spective agents and H2O2 for 30 minutes. Cells were then incubated
with FluoZin-­3 AM at 37°C in a 5% CO2 incubator for 30 minutes.
The excitation wavelength for FluoZin-­3 AM was 488 nm, and emis-
sion was detected at 530 ± 20 nm.
CellTracker Green CMFDA (Thermo Fisher Scientific) was used
to monitor changes in the intracellular levels of nonprotein thiols.33
The cells were incubated with 10 μM N-­ethylmaleimide (NEM) (Wako
Pure Chemical Industries, Ltd.) or 300 μM H2O2 for 30 minutes, fol-
lowed by incubation with 1 μM CellTracker Green CMFDA at 37°C in
a 5% CO2 incubator for 30 minutes. CellTracker Green CMFDA fluo-
rescence was observed in cells that had not been stained with 5 μM
PI. The excitation wavelength for the CellTracker Green CMFDA
assay was 488 nm, and emission was detected at 530 ± 15 nm. We
measured the fluorescence intensity of 200–­250 cells in each sam-
ple in one experiment and performed three of them and averaged
the fluorescence intensity.34,35 Fluorescence was examined using a
fluorescence microscope (Nikon) and analyzed using NIS-­Elements
software (Nikon).
2.3 | Western blotting
Epi4 cells (3 × 105 cells/well) were passaged in 6-­well plates (Corning).
Immediately prior to chemical stimulation, the culture medium was
replaced with Tyrode's solution and cultured for 30 minutes with
300 μM H2O2, ensuring that the extracellular fluid remained Zn2+-­
free. Cells were rinsed twice with 1× PBS and solubilized in the
RIPA buffer (Life Science Research). The lysates were centrifuged
for 20 minutes at 4°C at 12 000 g and boiled in the Laemmli sam-
ple buffer (Bio-­Rad) containing M2-­mercaptoethanol (Bio-­Rad) for
5 minutes. Samples were separated via electrophoresis using Mini-­
PROTEAN TGX Precast Gels (Bio-­Rad), transferred to a Trans-­Blot
Turbo Transfer System Transfer Pack (Bio-­Rad), immunoblotted with
primary antibodies, and visualized with horseradish peroxidase-­
linked anti-­
mouse (1:10 000) or anti-­
rabbit (1:10 000) immuno-
globulin G (IgG) antibodies (GE Healthcare, CT) using enhanced
chemiluminescence detection kits with the SuperSignal West Dura
Extended Duration Substrate (Thermo Fisher Scientific). Anti-­
β-­
actin (#3700, 1:1000), anti-­p-­p38 (Thr180/Tyr182) (#4511, 1:1000),
anti-­p38 (#9212, 1:1000), anti-­p-­CREB (Ser133) (#9198, 1:1000),
YAGI et al.
and anti-­CREB (#9197, 1:1000) were purchased from Cell Signaling
Technology. Anti-­SLC30A1 (ab110383, 1:500) was purchased from
Abcam. The band volume is the p-­p38 band volume value with the
background removed divided by the p38 volume value with the back-
ground removed. Furthermore, the average of the values of all three
samples was calculated. The value of p-­CREB was obtained in the
same manner. Band volumes were analyzed using the ImageQuant
TL software (GE Healthcare).
2.4 | Luciferase assay
On the day prior to transfection, the epi4 cells were seeded at 2 × 105
cells/well in 24-­
well plates (Corning) containing HuMedia-­
KG2.
After incubation overnight, the pNL3.2.NF-­κB-­RE [NlucP/NF-­
κB-­RE/Hygro] vector (Promega) was introduced into epi4 cells using
the X-­tremeGENE 9 transfection reagent (Sigma-­Aldrich). After
24 hours of incubation, the cells were exposed to H2O2 for 12 hours
and subjected to a luciferase assay performed using the Nano-­Glo
Luciferase Assay System (Promega).
2.5 | RNA isolation and quantitative real-­time
polymerase chain reaction
5
The epi4 cells were seeded at 3 × 10 cells/well in 6-­well plates
(Corning) containing HuMedia-­KG2, following which they were stim-
ulated with chemicals and incubated for 12 hours. Total RNA was ex-
tracted from the epi4 cells using the NucleoSpin RNA kit (TAKARA),
and cDNA was synthesized using a High-­Capacity RNA-­to-­cDNA kit
(Thermo Fisher Scientific). Quantitative polymerase chain reaction
(PCR) (q-­PCR) was performed using the SYBR Green PCR Master Mix
(Thermo Fisher Scientific) and an Applied Biosystems StepOnePlus
Real-­Time PCR System (Thermo Fisher Scientific). The following primer
sequences were used in this study: hypoxanthine phosphoribosyl-
transferase (HPRT) forward: GGCAGTATAATCCAAAGATGGTCAA;
HPRT reverse: GTCAAGGGCATATCCTACAACAAAC; interleukin-­1​
β (IL-­1β) forward: CCAGGGACAGGATATGGAGCA; IL-­1β reverse:
TTCAACACGCAGGACAGGTACAG; tumor necrosis factor α (TNF-­
α) forward: GTGACAAGCCTGTAGCCCATGTT; TNF-­α reverse: TTAT​
CTCTCAGCTCCACGCCATT; IL-­8 forward: ACACTGCGCCAACACA​
GAAATTA; IL-­8 reverse: TTTGCTTGAAGTTTCACTGGCATC; IL-­6
forward: AAGCCAGAGCTGTGCAGATGAGTA; IL-­6 reverse: TGTCC​
TGCAGCCACTGGTTC; matrix metallopeptidase 9 (MMP-­9) forward:
CGAACTTTGACAGCGACAAG; MMP-­9 reverse: CACTGAGGAA​
TGATCTAAGCCC; Claudin-­
1 forward: CAGCTGGCTGAGACACT​
GAAGA; Cludin-­
1 reverse: AAGGCACTGAACCACATGAAGGTA;
E-­
cadherin forward: CGCCGAGAGCTACACGTTCA; E-­
cadherin
reverse: TGTCGACCGGTGCAATCTTC; zonula occludens-­1 (ZO-­
1) forward: CGAGGCATCATCCCTAATAAGAACA; ZO-­
1 reverse:
GGAGCTGCGAAGACCTCTGAA; solute carrier family 30 member 1
(SLC30A1) forward: ATACCAGCAACTCCAACGG; SLC30A1 reverse:
TGTTAAGTTGTCCAGCCCTATC. SLC30A1 primer was purchased
| 3
from Greiner Japan, and the rest were purchased from TAKARA Bio
Inc.
2.6 | Statistical analysis
Values are expressed as means ± standard deviation for four experi-
ments. Statistical comparisons were performed using Tukey's multi-
variate analysis. A p-­value of <.05 was considered significant.
3 | R E S U LT S
3.1 | H2O2 increases intracellular Zn2+
concentrations in epi4 cells
We examined whether oxidative stress increased intracellular
Zn2+ levels in epi4 cells. In epi4 cells, the fluorescence intensity of
FluoZin-­3 was observed at concentrations of 10, 30, 100, 300, and
1000 μM of H2O2. FluoZin-­3 showed an increase in fluorescence
intensity from 100 μM of H2O2, but the fluorescence intensity
was always stable at 300 μM (data not shown). We also reported
that treatment with H2O2 at 300 μM increased the intensity of
3 in rat thymocytes. 25 As shown in Figure 1A, incuba-
FluoZin-­
tion with 300 μM H2O2 for 30 minutes increased FluoZin-­3 fluo-
rescence in epi4 cells. Given that few dead cells were detected, PI
images were not included. We speculate that most dead cells had
been removed when they were washed with Tyrode's solution prior
to fluorescence microscopy. TPEN (at 10 μM), a chelator for intra-
cellular Zn2+, significantly attenuated the intensity of H2O2-­induced
increases in FluoZin-­3 fluorescence (Figure 1A). DTPA (10 μM),
a chelator for extracellular Zn2+, did not affect H2O2-­induced in-
creases in the intensity of FluoZin-­3 fluorescence (Figure 1A). EDTA
(50 μM), a membrane-­impermeable divalent metal chelator, had lit-
tle effect on intracellular Zn2+ concentrations following treatment
with H2O2 (Figure 1A). Furthermore, in the absence of external Ca2+,
H2O2 stimulation increased the intensity of FluoZin-­3 fluorescence
(Figure 1A). These results suggest that H2O2 increases intracellular
Zn2+ concentrations and that excess Zn2+ is derived from intracellu-
lar Zn2+ stores. Furthermore, this phenomenon was independent of
the extracellular Ca2+ concentration. Figure 1B depicts the fluores-
cence intensity under various conditions.
3.2 | H2O2 releases Zn2+ from
intracellular nonprotein thiols
To investigate the source of excess Zn2+ following stimulation with
H2O2, we used carboxymethylflavin (CMF) to monitor changes in the
intracellular levels of nonprotein thiols.33 NEM was used to chemi-
cally deplete cellular nonprotein thiols.33 Stimulation with 300 μM
H2O2 for 30 minutes significantly decreased the intensity of CMF
fluorescence compared with the control intensity in epi4 cells that
4 | YAGI et al.

(A) (B) (C)

+ TPEN + DTPA
10μM 10μM
Cont Cont Cont

H 2 O2 H2 O 2 H 2 O2
300μM 300μM 300μM
n=3 n=3 n=3

(D) (E)
+ EDTA Ca2+
50μM free

Cont Cont

H 2 O2 H2O2
300μM 300μM
n=3 n=3

(F) FluoZin-3
6

4
Intensity

H2O2 - + - + - + - + - +
300μM
+ TPEN + DTPA + EDTA Ca2+-free n=3

F I G U R E 1 Change in FluoZin-­3 AM fluorescence in epi4 cells incubated with hydrogen peroxide (H2O2). (A) Effect of H2O2 on the
intensity of FluoZin-­3 AM fluorescence. Effects of TPEN, DTPA, EDTA, and Ca2+-­free conditions on the intensity of FluoZin-­3 AM
fluorescence following treatment with H2O2. (B) Fluorescence intensity in each condition. Columns and bars represent the average and
standard deviation for intensity across three experiments. Asterisks (*) indicate significant differences (p < .05) between the respective
control and test groups. DTPA, diethylenetriamine-­N, N, N′, N′′, N′′-­pentaacetic acid; EDTA, ethylenediaminetetraacetic acid; TPEN: N, N,
N′, N′-­tetrakis (2-­pyridylmethyl) ethylenediamine

had not been treated with H2O2 (Figure 2A). Similarly, incubation
with 10 μM NEM for 30 minutes considerably attenuated CMF flu-
orescence (Figure 2A). Treatment with 10 μM NEM for 30 minutes
also increased the intensity of FluoZin-­3 fluorescence (Figure 2B).
These results are similar to those obtained from experiments using
H2O2 (Figure 2B). CMF and FluoZin-­3 fluorescence intensities are
depicted in Figure 2C. These results suggest that treatment with
NEM or H2O2 promotes the release of intracellular Zn2+ from cel-
lular nonprotein thiols to the cytoplasm. Nonprotein thiols contain
a cysteine residue with a thiol group, which chelates zinc ions, and
YAGI et al. | 5

F I G U R E 2 Effects of H2O2 and NEM (A) CMFDA (B) FluoZin-3

on FluoZin-­3 AM and CMF fluorescence
in epi4 cells. (A) CMF fluorescence. (B)
FluoZin-­3 AM fluorescence. Effects of
Cont Cont
H2O2 and NEM on the mean intensity of
FluoZin-­3 AM or CMF fluorescence. (C)
Fluorescence intensity in each condition.
Columns and bars represent the average
and standard deviation for intensity across H2O2 300μM H2O2 300μM
three experiments. Asterisks (*) indicate
significant differences (p < .05) between the
respective control and test groups. CMF,
carboxymethylflavin; epi4 cells, human
gingival epithelial cells; H2O2, hydrogen NEM 10μM NEM 10μM

peroxide; NEM, N-­ethylmaleimide

n=3 n=3

(C) CMFDA FluoZin-3

1.4 2.5

1.2
2
1

Intensity
1.5
Intensity

0.8

0.6 1

0.4
0.5
0.2

0 0
Cont H 2O 2 NEM Cont H 2O 2 NEM
300μM 10μM 300μM 10μM
n=3 n=3

both NEM and H2O2 oxidize nonprotein thiols. The sulfonic acid or
disulfide bridges established in the process are thus thought to lead
to the release of Zn2+.
3.3 | H2O2 increases the cell membrane
permeability of Zn2+
To examine the mechanism by which oxidative stress increases intra-
2+
cellular Zn concentrations, epi4 cells were stimulated with 300 μM
H2O2 in the presence or absence of 30 μM zinc chloride. However,
zinc chloride stimulation did not increase the intensity of FluoZin-­3
fluorescence (Figure 3A). In contrast, simultaneous stimulation
with H2O2 and zinc chloride significantly increased the intensity of
FluoZin-­3 fluorescence to a level greater than that observed follow-
ing stimulation with zinc chloride or H2O2 alone (Figure 3A). Such
increases in fluorescence intensity were attenuated by treatment
with TPEN (Figure 3B). Figure 3C depicts the FluoZin-­3 fluorescence
intensity. These results suggest that H2O2 increases the membrane
permeability of extracellular Zn2+, resulting in an increase in the in-
2+
tracellular Zn concentration.
3.4 | H2O2-­induced increases in Zn2+ increase
phosphorylation in the p38-­MAPK cascade
We investigated the role of intracellular Zn2+ during oxidative
stress in epi4 cells using Western blots. The intracellular Zn2+
chelator TPEN was added to epi4 cells prior to H2O2 stimula-
tion. The cells were incubated with H2O2 in Tyrode's solution for
30 minutes, and the proteins were collected and subjected to
Western blotting.
We focused on the MAPK and NF-­κB signaling pathways, which
are well known to contribute to inflammation. H2O2 (300 μM) in-
creased the phosphorylation of p38, a proline-­directed Ser/Thr MAP
kinase, and this H2O2-­
induced p-­
p38 expression was inhibited by
TPEN (10 μM) (Figure 4A). However, H2O2 did not increase the phos-
phorylation of JNK and ERK (date not shown). Furthermore, H2O2
increased the phosphorylation of CREB, a transcription factor that
functions downstream of p38. This phenomenon was also attenuated
by treatment with TPEN (Figure 4A). The band volumes are shown in
Figure 4B. These results suggest that, under the conditions of oxida-
tive stress, Zn2+ contributes to p38 and CREB phosphorylation.
3.5 | H2O2-­induced increases in Zn2+ activate the
NF-­κB pathway
The above mentioned results suggest that oxidative stress-­induced in-
creases in intracellular Zn2+ activate inflammatory signaling pathways,
such as the p38-­MAPK cascade. Thus, we performed a luciferase
assay to examine the activity of NF-­κB in response to H2O2-­induced
increases in intracellular Zn2+ concentrations. Epi4 cells were trans-
fected with the pNL3.2.NF-­κB-­RE [NlucP/NF-­κB-­RE/Hygro] vector in
HuMedia-­KG2 (Figure 5). H2O2 (300 μM) increased luciferase activity
and upregulated NF-­κB DNA-­binding activity (Figure 5). This H2O2-­
induced luciferase activity was suppressed by the 5 μM TPEN treat-
ment but not by the 5 μM DTPA treatment (Figure 5). These results
suggest that Zn2+, under the conditions of H2O2-­induced oxidative
stress, activates NF-­κB as a transcription factor.
6 | YAGI et al.

(A) (B) F I G U R E 3 Effects of H2O2 and ZnCl2

on FluoZin-­3 AM fluorescence in epi4
cells. (A) Effects of H2O2 and ZnCl2 on
Cont Cont FluoZin-­3 AM fluorescence. (B) Effects of
TPEN on FluoZin-­3 AM fluorescence. (C)
Fluorescence intensity in each condition.
Columns and bars represent the average
and standard deviation for intensity
across three experiments. Asterisks (*)
H2O2 300μM H2O2 300μM indicate significant differences (p < .05)
between the respective control and
test groups. Pound signs (#) indicate
significant differences (p < .05) between
the H2O2 and ZnCl2 group and the H2O2,
ZnCl2, and TPEN group. epi4 cells, human
gingival epithelial cells; H2O2, hydrogen
ZnCl2 30μM ZnCl2 30μM peroxide; TPEN, N, N, N′, N′-­tetrakis
(2-­pyridylmethyl) ethylenediamine; ZnCl2,
zinc chloride

H2O2 300μM H2O2 300μM

+ +
ZnCl2 30μM ZnCl2 30μM
n=3 n=3

(C) FluoZin-3
14

12

10
Intensity

0
H2O2 300mM - + - + - + - +
ZnCl2 30mM - - + + - - + +
TPEN 10mM - - - - + + + +
n=3

3.6 | H2O2-­induced increases in Zn2+ amplify the
expression of inflammatory cytokines and MMP-­9
We further examined the effect of oxidative stress-­induced increases
in the intracellular concentrations of Zn2+ on the expression of
inflammation-­related genes. Real-­time PCR was used to examine the
production of inflammatory cytokines and MMP-­9 in epi4 cells ex-
posed to oxidative stress. Stimulation with 300 μM H2O2 increased
IL-­1β mRNA expression; however, such increases were attenuated by
the addition of 5 μM TPEN (Figure 6A). In contrast, 5 μM DTPA did
not suppress the increase in IL-­1β mRNA expression (Figure 6A).
Similarly, H2O2 treatment increased the expression of TNF-­α, IL-­6,
and IL-­8 mRNA, while the addition of TPEN also attenuated these in-
creases (Figure 6B,C, D). Furthermore, DTPA did not attenuate H2O2-­
induced increases in the expression of TNF-­α, IL-­6, or IL-­8 mRNA
(Figure 6B,C,D), and similar results were obtained for MMP-­9 mRNA
expression (Figure 6E). These results suggest that intracellular Zn2+,
under the conditions of H2O2-­
induced oxidative stress, contributes
to the production of inflammatory cytokines and MMP-­9. We also as-
sessed the effect of H2O2-­induced Zn2+ behavior on epithelial barrier
function by examining the changes in claudin-­1, E-­cadherin, and ZO-­1
mRNA expressions. These results showed that H2O2-­induced Zn2+ had
no effect on their expression (Figure 6F-­H). However, with the addition
of TPEN and chelated endogenous Zn2+, claudin-­1 showed a decrease
in expression (Figure 6F).
3.7 | H2O2 amplify the expression of Zn2+
transporter SLC30A1
It was suggested that H2O2 increases intracellular Zn2+ concentrations
and may be involved in the phosphorylation of the MAPK cascade
and the expression of inflammatory cytokines. Thus, we conducted
an experiment to determine whether the system that regulates
YAGI et al. | 7

F I G U R E 4 Effects of H2O2-­induced (A) (B) p-p38

increases in intracellular Zn2+ on the
10
phosphorylation of a proline-­directed - + - +
H2O2 300μM 9
p38 CREB/MAPK cascade. (A) Levels - - + +
TPEN 10μM 8

of p-­p38, p38, p-­CREB, CREB, and 7

β-­Actin were evaluated via Western

p-p38/p38
6

blotting. (B) Band volumes. Columns p-p38 5

4
and bars represent the average and 3

standard deviation for intensity across 2

three experiments. Asterisks (*) indicate p38 1

0
significant differences (p < .05) between H2O2 300μM - + - +
the respective control and test groups. TPEN 10μM - - + +

CREB, cAMP response element-­binding p-CREB

protein; H2O2, hydrogen peroxide; MAPK,
mitogen-­activated protein kinase
CREB
n=3

β-Actin p-CREB
6

n=3
5

p-CREB /CREB
4

H2O2 300μM - + - +
TPEN 10μM - - + +

n=3

the H2O2-­induced Zn2+ increase is changed by H2O2. As shown in

Figure 7A, stimulation with 300 μM H2O2 for 12 hours increased 4 | DISCUSSION
SLC30A1 mRNA expression. After 24 hours of incubation, H2O2 in-
creased the SLC30A1 protein (Figure 7B). Increases in oxidative stress are strongly associated with the onset
and progression of periodontal disease.11 In the present study, we
NF-κB-RE Lucifarase assay investigated the effect of oxidative stress on intracellular Zn2+ con-
900000
centrations in periodontium constituent cells. Our findings demon-
800000
strated that oxidative stress not only promoted Zn2+ release from
700000
600000
intracellular nonproteinic thiols (Figure 2) but also increased the Zn2+
500000 permeability of the cell membrane, leading to an influx of Zn2+ from
RLUs

400000 the extracellular space (Figure 3). In addition to nonprotein thiols

300000 such as glutathione,36 Zn2+may be liberated from metallothionein
200000
under the conditions of oxidative stress, given that metallothio-
100000
nein also contains thiol groups.37 Furthermore, oxidative stress-­
0
H2O2 300μM – + – + – + induced increases in intracellular Zn2+ concentrations contributed
TPEN 5μM – – + + – –
DTPA 5μM – – – – + + n=3 to the phosphorylation of p38 and CREB (Figure 4), increasing the
DNA-­binding activity of NF-­κB (Figure 5). Oxidative stress-­induced
F I G U R E 5 Effects of H2O2-­induced increases in intracellular increases in intracellular Zn2+ concentrations did not affect epithe-
Zn2+ on NF-­κB DNA-­binding activity. The DNA binding of NF-­κB lial barrier function but increased the expression of inflammatory
was evaluated via a luciferase assay. Columns and bars represent
cytokines and MMP-­9 mRNA in epi4 cells (Figure 6). A previous
the average and standard deviation for intensity across three
experiments. Asterisks (*) indicate significant differences (p < .05) study reported that lipopolysaccharide (LPS) increases intracellu-
between the respective control and test groups. H2O2, hydrogen lar Zn2+ concentrations in RAW 264.7 murine macrophages.38 We
peroxide; NF-­κB, nuclear factor kappa B also observed an increase in FluoZin-­3 fluorescence intensity upon
8 | YAGI et al.

(A) 10 IL-1β mRNA (B)

5
TNF-α mRNA

Relative ration of gene expression

Relative ration of gene expression

9 4.5

8 4

7 3.5

6 3

5 2.5

4 2

3 1.5

2 1

1 0.5

0 0

H2O2 300μM - + - + - + H2O2 300μM - + - + - +

TPEN 5μM - - + + - - TPEN 5μM - - + + - -
DTPA 5μM - - - - + + DTPA 5μM - - - - + +
n=3 n=3

(C) IL-6 mRNA (D) IL-8 mRNA

14
30
Relative ration of gene expression

Relative ration of gene expression

12
25
10
20
8

15
6

4 10

2 5

0
0
H2O2 300μM - + - + - + H2O2 300μM - + - + - +
TPEN 5μM - - + + - - TPEN 5μM - - + + - -
DTPA 5μM - - - - + + DTPA 5μM - - - - + +

n=3 n=3

(E) MMP9 mRNA (F) Claudin-1 mRNA

4.5 1.2
Relative ration of gene expression

Relative ration of gene expression

4
1
3.5

3 0.8

2.5
0.6
2

1.5 0.4

1
0.2
0.5

0 0

H2O2 300μM - + - + - + H2O2 300μM - + - + - +

TPEN 5μM - - + + - - TPEN 5μM - - + + - -
DTPA 5μM - - - - + + DTPA 5μM - - - - + +
n=3 n=3

(G) (H)
E-Cadherin mRNA ZO-1 mRNA
2 1.8
Relative ration of gene expression
Relative ration of gene expression

1.8 1.6
1.6 1.4
1.4
1.2
1.2
1
1
0.8
0.8
0.6
0.6

0.4 0.4

0.2 0.2

0 0

H2O2 300μM - + - + - + H2O2 300μM - + - + - +

TPEN 5μM - - + + - - TPEN 5μM - - + + - -
DTPA 5μM - - - - + + DTPA 5μM - - - - + +
n=3 n=3

F I G U R E 6 Effects of H2O2-­induced increases in intracellular Zn2+ on the transcription of inflammatory cytokines, MMP-­9, and epithelial
cell adhesion factors mRNA. (A) IL-­1β, (B) TNF-­α , (C) IL-­6, (D) IL-­8, (E) MMP-­9, (F) Claudin-­1, (G) E-­C adherin, and (H) ZO-­1. The expressions
of inflammatory cytokines, MMP-­9, and epithelial cell adhesion factors were normalized by the expression of HPRT. Columns and bars
represent the average and standard deviation for intensity across three experiments. Asterisks (*) indicate significant differences (p < .05)
between the respective control and test groups. Pound signs (#) indicate a significant difference (p < .05) between the H2O2 group and the
H2O2 and TPEN group. H2O2, hydrogen peroxide; IL-­1β, interleukin 1B; MMP-­9, matrix metallopeptidase-­9; TNF-­α , tumor necrosis factor α;
TPEN, N, N, N’, N’-­tetrakis (2-­pyridylmethyl) ethylenediamine; ZO-­1, zonula occludens-­1
YAGI et al. | 9

F I G U R E 7 H2O2 increases in the (A) (B)

expression of Zn2+ transporter SLC30A1. SLC30A1 mRNA Cont H2O2
2.5
300μM

Relative ration of gene expression

(A) SLC30A1 mRNA. The expression
of SLC30A1 was normalized by the 2

expression of HPRT. (B) Level of SLC30A1 SLC30A1

was evaluated via Western blotting. 1.5

Columns and bars represent the average 1 β-Actin

and standard deviation for intensity across
three experiments. Asterisks (*) indicate 0.5
n=3
significant differences (p < .05) between
SLC30A1
the respective control and test groups. 0
0.3
Cont H2O2
H2O2, hydrogen peroxide; SLC30A1, 300μM
0.25
solute carrier family 30 member 1 n=3

SLC30A1/β-Actin
0.2

0.15

0.1

0.05

Cont H2O2
300μM

H2O2
Cont 300μM
ave 0.031782 0.225677213
SD 0.044116 0.039409858
n=3

exposure to LPS in epi4 cells (data not shown). These findings sug-
gest that LPS-­induced increases in intracellular Zn2+ concentrations
occur either directly or indirectly due to oxidative stress in epi4
cells. Therefore, our findings support the notion that intracellular
Zn2+ concentrations may be elevated in gingival epithelial cells at the
onset of periodontal disease.
A previous study reported that mast cells stimulated through
the high-­affinity IgE receptor (FcεRI) rapidly released intracellular
Zn2+ from the endoplasmic reticulum (ER), a phenomenon generally
15
referred to as the “Zn wave”. Evidence suggests that intracellu-
lar Zn2+ activates the proteins of the GADD45 family (GADD45/
α/β/γ), 39 which in turn activates MAPK as well as 12-­lipoxygenase
(12-­LOX), an enzyme that adds oxygen to arachidonic acid.40,41
These factors contribute to the activation of the p38-­MAPK cas-
cade.40-­4 3 Other studies have suggested that Zn waves upregulate
NF-­κB transcriptional activity by increasing the affinity between
NF-­κB and DNA rather than via the nuclear translocation of NF-­
κB.44-­48 These results suggest that oxidative stress-­
induced in-
2+
creases in intracellular Zn act like a “Zn wave,” enhancing the
phosphorylation of the p38-­MAPK cascade and increasing binding
between DNA and NF-­κB. Oxidative stress is also known to lead to
the production of inflammatory cytokines such as IL-­1β,9,10 TNF-­α , 8
IL-­6 ,6 IL-­8 ,7 and MMP-­9.49,50 Zn waves generated by oxidative stress
may contribute to this phenomenon. Furthermore, intracellular Zn2+
is associated with the activity of enzymes that combat intracellular
51
oxidative stress, such as superoxide dismutase (SOD).
tects biological structures from oxidative stress by maintaining the
levels of glutathione and metallothionein and by interacting with
other transient metal ions that promote the formation of hydroxyl
radicals. 52 However, in this study, we observed that oxidative
stress-­induced excessive increases in intracellular Zn2+ concentra-
tions, thereby activating inflammatory signaling pathways. These
changes may contribute to the progression of inflammation in peri-
odontal tissues. As Figure 6 illustrated, we detected upregulation of
gene expression of inflammatory cytokines such as IL-­1β, IL-­6 , and
IL-­8 after H2O2 stimulation at the mRNA level. However, we failed
to detect increase of the production of these inflammatory cyto-
kines after 24 hours—­H2O2 stimulation at the protein level (data not
shown). The possible reason of this discrepancy is that the incuba-
tion time was too short to detect to these cytokines at the protein
level. In contrast, longer incubation with TPEN increased the death
rate of epi4 cells, resulted in less amounts of total cytokine pro-
duction (data not shown). Since controlling the culturing condition
which was long enough to produce cytokines and maintain viabil-
ity was difficult in our experiments, different experimental system
such as novel intracellular Zn2+ regulation needed to elucidate the
involvement of Zn2+-­dependent inflammatory cytokine production
in inflammation in periodontal tissue.
In this study, we did not analyze the regulation mechanism of
intracellular Zn2+ increased by oxidative stress. However, as shown
in Figure 7, we have identified that oxidative stress increases the ex-
pression of the zinc transporter SLC30A1, which regulates intracel-
lular Zn2+ concentrations.53,54 Elucidating the functions of SLC30A1
during oxidative stress may aid in determining how increases in in-
2+
Zn pro- tracellular Zn2+ contribute to the onset and progression of periodon-
tal disease. The above study paves the way for the development of
therapeutic drugs targeting factors that control intracellular Zn2+
that increase due to oxidative stress.
10 | YAGI et al.
AC K N OW L E D G E M E N T S
This work was supported by a Grant-­in-­Aid for Scientific Research
(KAKENHI) from the Japanese Society for the Promotion of Science
(No. 17H06852 and No. 19K18996) to H.Y. All authors approved the
current and any revised version to be submitted.
DATA AVA I L A B I L I T Y S TAT E M E N T
All date generated or analyzed during this study are included in this
published article.
ORCID
Hiroko Yagi https://orcid.org/0000-0003-1749-3254
REFERENCES
1. Hyslop PA, Hinshaw DB, Halsey WA Jr, et al. Mechanisms of
oxidant-­mediated cell injury. The glycolytic and mitochondrial path-
ways of ADP phosphorylation are major intracellular targets inacti-
vated by hydrogen peroxide. J Biol Chem. 1988;263(4):1665-­1675.
2. Downey GP, Fukushima T, Fialkow L. Signaling mechanisms in
human neutrophils. Curr Opin Hematol. 1995;2(1):76-­88.
3. El-­Kenawi A, Ruffell B. Inflammation, ROS, and mutagenesis. Cancer
Cell. 2017;32(6):727-­729.
4. Kohen R, Nyska A. Oxidation of biological systems: oxidative stress
phenomena, antioxidants, redox reactions, and methods for their
quantification. Toxicol Pathol. 2002;30(6):620-­650.
5. Pisoschi AM, Pop A. The role of antioxidants in the chemistry of
oxidative stress: a review. Eur J Med Chem. 2015;97:55-­74.
6. Brach MA, De Vos S, Arnold C, Gruß HJ, Mertelsmann R,
Herrmann F. Leukotriene B4 transcriptionally activates inter-
leukin-­6 expression involving NK-­xB and NF-­IL6. Eur J Immunol.
1992;22(10):2705-­2711.
7. Hwang YS, Jeong M, Park JS, et al. Interleukin-­1beta stimulates IL-­8
expression through MAP kinase and ROS signaling in human gastric
carcinoma cells. Oncogene. 2004;23(39):6603-­6611.
8. de Oliveira-­Marques V, Cyrne L, Marinho HS, Antunes F. A
quantitative study of NF-­kappaB activation by H2O2: rele-
vance in inflammation and synergy with TNF-­alpha. J Immunol.
2007;178(6):3893-­3902.
9. Zhuang C, Xu NW, Gao GM, et al. Polysaccharide from Angelica sin-
ensis protects chondrocytes from H2O2-­induced apoptosis through
its antioxidant effects in vitro. Int J Biol Macromol. 2016;87:322-­328.
10. Maldaner DR, Azzolin VF, Barbisan F, et al. In vitro effect of
low-­ level laser therapy on the proliferative, apoptosis modu-
lation, and oxi-­ inflammatory markers of premature-­ s enescent
hydrogen peroxide-­induced dermal fibroblasts. Lasers Med Sci.
2019;34(7):1333-­1343.
11. Chapple IL, Matthews JB. The role of reactive oxygen and an-
tioxidant species in periodontal tissue destruction. Periodontol.
2000;2007(43):160-­232.
12. Żukowski P, Maciejczyk M, Waszkiel D. Sources of free radicals and
oxidative stress in the oral cavity. Arch Oral Biol. 2018;92:8-­17.
13. D'Aiuto F, Nibali L, Parkar M, Patel K, Suvan J, Donos N. Oxidative
stress, systemic inflammation, and severe periodontitis. J Dent Res.
2010;89(11):1241-­1246.
14. Vallee BL, Falchuk KH. The biochemical basis of zinc physiology.
Physiol Rev. 1993;73(1):79-­118.
15. Yamasaki S, Sakata-­Sogawa K, Hasegawa A, et al. Zinc is a novel
intracellular second messenger. J Cell Biol. 2007;177(4):637-­6 45.
16. Hirano T, Murakami M, Fukada T, Nishida K, Yamasaki S, Suzuki T.
Roles of zinc and zinc signaling in immunity: zinc as an intracellular
signaling molecule. Adv Immunol. 2008;97:149-­176.
17. Nishida K, Yamasaki S. Zinc signaling by “Zinc Wave”. In: Toshiyuki
F, Taiho K (eds.), Zinc signals in cellular functions and disorders. Tokyo,
Japan: Springer; 2014:89-­109.
18. Maywald M, Rink L. Zinc homeostasis and immunosenescence. J
Trace Elem Med Biol. 2015;29:24-­3 0.
19. Bonaventura P, Benedetti G, Albarede F, Miossec P. Zinc and its role
in immunity and inflammation. Autoimmun Rev. 2015;14(4):277-­285.
20. Miao X, Sun W, Miao L, et al. Zinc and diabetic retinopathy. J
Diabetes Res. 2013;2013:1-­8.
21. Nuttall JR, Oteiza PI. Zinc and the aging brain. Genes Nutri.
2014;9(1):379.
22. Takatani-­Nakase T, Matsui C, Maeda S, Kawahara S, Takahashi K.
High glucose level promotes migration behavior of breast cancer
cells through zinc and its transporters. PLoS One. 2014;9(2):e90136.
23. Matsui H, Sakanashi Y, Oyama TM, et al. Imidazole antifungals,
but not triazole antifungals, increase membrane Zn2+ permeabil-
ity in rat thymocytes Possible contribution to their cytotoxicity.
Toxicology. 2008;248(2–­3):142-­150.
24. Matsui H, Sakanashi Y, Nishimura Y, et al. Effects of Zn2+ chelators,
DTPA and TPEN, and ZnCl2 on the cells treated with hydrogen per-
oxide: a flow-­c ytometric study using rat thymocytes. Nat Sci Res
Univ Tokushima. 2009;23:12-­18.
25. Matsui H, Oyama TM, Okano Y, Hashimoto E, Kawanai T, Oyama Y.
Low micromolar zinc exerts cytotoxic action under H2O2-­induced
oxidative stress: excessive increase in intracellular Zn2+ concentra-
tion. Toxicology. 2010;276(1):27-­32.
26. Kashiwagi Y, Yanagita M, Kojima Y, Shimabukuro Y, Murakami S.
Nicotine up-­regulates IL-­8 expression in human gingival epithelial
cells following stimulation with IL-­1beta or P. gingivalis lipopoly-
saccharide via nicotinic acetylcholine receptor signalling. Arch Oral
Biol. 2012;57(5):483-­490.
27. Murakami S, Yoshimura N, Koide H, et al. Activation of adenosine-­
receptor-­enhanced iNOS mRNA expression by gingival epithelial
cells. J Dent Res. 2002;81(4):236-­240.
28. Kusumoto Y, Hirano H, Saitoh K, et al. Human gingival epithelial
cells produce chemotactic factors interleukin-­8 and monocyte che-
moattractant protein-­1 after stimulation with Porphyromonas gingi-
valis via toll-­like receptor 2. J Periodontol. 2004;75(3):370-­379.
29. Kashiwagi Y, Takedachi M, Mori K, et al. High glucose-­induced oxi-
dative stress increases IL-­8 production in human gingival epithelial
cells. Oral Dis. 2016;22(6):578-­584.
30. Fujita T, Yumoto H, Shiba H, et al. Irsogladine maleate regulates
epithelial barrier function in tumor necrosis factor-­α-­stimulated
human gingival epithelial cells. J Periodontal Res. 2012;47(1):55-­61.
31. Yamada M, Takahashi N, Matsuda Y, et al. A bacterial metabolite
ameliorates periodontal pathogen-­induced gingival epithelial bar-
rier disruption via GPR40 signaling. Sci Rep. 2018;8(1):9008.
32. Gee KR, Zhou ZL, Qian WJ, Kennedy R. Detection and imaging of
zinc secretion from pancreatic beta-­cells using a new fluorescent
zinc indicator. J Am Chem Soc. 2002;124(5):776-­778.
33. Chikahisa L, Oyama Y, Okazaki E, Noda K. Fluorescent estima-
tion of H2O2-­induced changes in cell viability and cellular non-
protein thiol level of dissociated rat thymocytes. Jpn J Pharmacol.
1996;71(4):299-­3 05.
34. Kanada A, Nishimura Y, Yamaguchi JY, et al. Extract of Ginkgo bi-
loba leaves attenuates kainate-­ induced increase in intracellular
Ca2+ concentration of rat cerebellar granule neurons. Biol Pharm
Bull. 2005;28(5):934-­936.
35. Nishimura Y, Yamaguchi JY, Kanada A, et al. Increase in intracel-
lular Cd(2+) concentration of rat cerebellar granule neurons incu-
bated with cadmium chloride: cadmium cytotoxicity under external
Ca(2+)-­free condition. Toxicol In Vitro. 2006;20(2):211-­216.
36. Jocelyn P, Biochemistry of the SH Group. The occurrence, chemical
properties, metabolism and biological function of thiols and disulphi-
des. New York, NY: Academic Press; 1972.
YAGI et al.
37. Evans GW, Majors PF, Cornatzer WE. Ascorbic acid inter-
action with metallothionein. Biochem Biophys Res Commun.
1970;41(5):1244-­1247.
38. Haase H, Ober-­Blöbaum JL, Engelhardt G, et al. Zinc signals are es-
sential for lipopolysaccharide-­induced signal transduction in mono-
cytes. J Immunol. 2008;181(9):6491-­6502.
39. Fanzo JC, Reaves SK, Cui L, et al. Zinc status affects p53, gadd45,
and c-­fos expression and caspase-­3 activity in human bronchial ep-
ithelial cells. Am J Physiol Cell Physiol. 2001;281(3):C751-­757.
40. Zhang Y, Wang H, Li J, et al. Peroxynitrite-­induced neuronal apop-
tosis is mediated by intracellular zinc release and 12-­lipoxygenase
activation. J Neurosci. 2004;24(47):10616-­10627.
41. Zhang Y, Aizenman E, DeFranco DB, Rosenberg PA. Intracellular
zinc release, 12-­lipoxygenase activation and MAPK dependent neu-
ronal and oligodendroglial death. Mol Med. 2007;13(7-­8):350-­355.
42. Takekawa M, Saito H. A family of stress-­inducible GADD45-­like
proteins mediate activation of the stress-­responsive MTK1/MEKK4
MAPKKK. Cell. 1998;95(4):521-­530.
43. Miyake Z, Takekawa M, Ge Q, Saito H. Activation of MTK1/MEKK4
by GADD45 through induced N-­C dissociation and dimerization-­
mediated trans autophosphorylation of the MTK1 kinase domain.
Mol Cell Biol. 2007;27(7):2765-­2776.
44. Kabu K, Yamasaki S, Kamimura D, et al. Zinc is required for Fc epsilon
RI-­mediated mast cell activation. J Immunol. 2006;177(2):1296-­1305.
45. Yamasaki S, Hasegawa A, Hojyo S, et al. A novel role of the L-­t ype
calcium channel alpha1D subunit as a gatekeeper for intracellular
zinc signaling: zinc wave. PLoS One. 2012;7(6):e39654.
46. Nishida K, Uchida R. Regulatory mechanism of mast cell activation
by zinc signaling. Yakugaku Zasshi. 2017;137(5):495-­501.
47. Nishida K, Hasegawa A, Yamasaki S, et al. Mast cells play role
in wound healing through the ZnT2/GPR39/IL-­6 axis. Sci Rep.
2019;9(1):e10842.
| 11
48. Uchida R, Xiang H, Arai H, Kitamura H, Nishida K. L-­t ype calcium
channel-­mediated zinc wave is involved in the regulation of IL-­6 by
stimulating Non-­IgE with LPS and IL-­33 in mast cells and dendritic
cells. Biol Pharm Bull. 2019;42(1):87-­93.
49. Ohno T, Okahashi N, Morisaki I, Amano A. Signaling pathways in os-
teoblast proinflammatory responses to infection by Porphyromonas
gingivalis. Oral Microbiol Immunol. 2008;23(2):96-­104.
50. Ariyoshi W, Okinaga T, Chaweewannakorn W, Akifusa S, Nisihara
T. Mechanisms involved in enhancement of matrix metalloprotein-
ase-­9 expression in macrophages by interleukin-­33. J Cell Physiol.
2017;232(12):3481-­3 495.
51. Tainer JA, Getzoff ED, Beem KM, Richardson JS, Richardson DC.
Determination and analysis of the 2 Å structure of copper, zinc su-
peroxide dismutase. J Mol Biol. 1982;160(2):181-­217.
52. Formigari A, Irato P, Santon A. Zinc, antioxidant systems and
metallothionein in metal mediated-­ apoptosis: biochemical and
cytochemical aspects. Comp Biochem Physiol C Toxicol Pharmacol.
2007;146(4):443-­459.
53. Palmiter RD, Huang L. Efflux and compartmentalization of zinc
by members of the SLC30 family of solute carriers. Pflugers Arch.
2004;447(5):744-­751.
54. Palmiter RD. Protection against zinc toxicity by metallothionein and
zinc transporter 1. Proc Natl Acad Sci U S A. 2004;101(14):4918-­4923.
How to cite this article: Yagi H, Fujihara C, Murakami S.
Effects of oxidative stress-­induced increases in Zn2+
concentrations in human gingival epithelial cells. J Periodont
Res. 2021;00:1–11. https://doi.org/10.1111/jre.12851