Enzyme and Microbial Technology 51 (2012) 211–216

Contents lists available at SciVerse ScienceDirect

Enzyme and Microbial Technology

journal homepage: www.elsevier.com/locate/emt

Production of resveratrol from tyrosine in metabolically engineered

Saccharomyces cerevisiae
So-Yeon Shin a , Sang-Min Jung a , Myoung-Dong Kim b , Nam Soo Han c,∗ , Jin-Ho Seo a,∗∗
a
Department of Agricultural Biotechnology and Center for Agricultural Biomaterials, Seoul National University, Seoul 151-921, Republic of Korea
b
School of Biotechnology and Bioengineering, Institute of Bioscience and Biotechnology, Kangwon National University, Chuncheon 200-701, Republic of Korea
c
Department of Food Science and Technology, Chungbuk National University, Cheongju 361-763, Republic of Korea

a r t i c l e i n f o a b s t r a c t

Article history: Resveratrol, a polyphenol compound found in grape skins, has been proposed to account for the bene-
Received 30 January 2012 ficial effects of red wine against heart disease. To produce resveratrol in Saccharomyces cerevisiae, four
Received in revised form 28 April 2012 heterologous genes were introduced: the phenylalanine ammonia lyase gene from Rhodosporidium toru-
Accepted 20 June 2012
loides, the cinnamic acid 4-hydroxylase and 4-coumarate:coenzyme A ligase genes both from Arabidopsis
thaliana, and the stilbene synthase gene from Arachis hypogaea. When this recombinant yeast was cul-
Keywords:
tivated by batch fermentation in YP medium containing 2% galactose, it produced 2.6 mg/L p-coumaric
Resveratrol
acid and 3.3 mg/L resveratrol. In order to increase the pool of malonyl-CoA, a key precursor in resvera-
Saccharomyces cerevisiae
Phenylalanine ammonia lyase (PAL)
trol biosynthesis, the acetyl-CoA carboxylase (ACC1) gene was additionally overexpressed in the yeast
Cinnamic acid 4-hydroxylase (C4H) by replacing the native promoter of the ACC1 gene with the stronger GAL1 promoter and this resulted
4-Coumarate:coenzyme A ligase (4CL1) in enhanced production of resveratrol (4.3 mg/L). Furthermore, when tyrosine was supplemented in the
Stilbene synthase (STS) medium, the concentration of resveratrol increased up to 5.8 mg/L. This result illustrates a possible strat-
egy for developing metabolically engineered yeast strain for the economical production of resveratrol
from cheap amino acids.
© 2012 Elsevier Inc. All rights reserved.

1. Introduction The production of resveratrol is originally produced by extrac-

Resveratrol (trans-3,5,4 -trihydroxystilbene) is a natural
polyphenolic compound found in grapes, a variety of berries,
peanuts, and their derived food products, such as wine [1,2].
Resveratrol belongs to the family of phytoalexins, which are low
molecular weight secondary metabolites produced by plants for
defense against stresses such as wounding, pathogen attack, and
UV irradiation [3]. Resveratrol is regarded as the main factor in the
French paradox, which is the observation that French people suffer
a relatively low incidence of coronary heart disease despite having
a diet rich in saturated fats, and has received considerable attention
due to its beneficial effects on human health, such as protective
effects against inflammation, carcinogenesis, oxidation, aging,
diabetes, and neurodegenerative diseases [4–6]. Because of these
valuable properties, resveratrol can be used for the production
of pharmaceuticals, cosmetics, and nutraceuticals as a potential
health-functional compound [7,8]. Therefore, the necessity to
develop better and more effective methods rises up.
∗ Corresponding author. Tel.: +82 43 251 2567; fax: +82 43 271 4412.
∗∗ Corresponding author. Tel.: +82 2 880 4855; fax: +82 2 873 5095.
E-mail addresses: namsoo@cbnu.ac.kr (N.S. Han), jhseo94@snu.ac.kr (J.-H. Seo).
tion from plant tissues, but numerous purification processes are
required to obtain pure resveratrol, owing to the low extraction
yield and low degree of purity associated with the extraction
methods [9,10]. Alternatively, biotechnological methods can be
used to produce resveratrol. In plants, resveratrol biosynthesis
occurs via a pathway that branches off from the phenylpropanoid
pathway [11,12] as shown in Fig. 1. The resveratrol pathway
consists of four enzymes: phenylalanine ammonia lyase (PAL),
cinnamic acid 4-hydroxylase (C4H), 4-coumarate:coenzyme A
ligase (4CL1), and stilbene synthase (STS). In the first step of the
resveratrol biosynthesis pathway, PAL catalyzes the non-oxidative
deamination of phenylalanine to cinnamic acid, and then cinnamic
acid is hydroxylated by C4H to p-coumaric acid. The PAL enzyme
derived from certain plants can also utilize tyrosine as substrate
to produce p-coumaric acid [13]. In the third step, 4CL1 attaches
p-coumaric acid to the pantothenic group of coenzyme-A (CoA)
to produce 4-coumaroyl-CoA. These three enzymes, PAL, C4H,
and 4CL1 are common members of the general phenylpropanoid
pathway in plants, which is responsible for the synthesis of major
phenolic compounds found in nature including lignin, flavonols,
and isoflavonoids. In the final step of the pathway, STS catalyzes
the condensation of resveratrol by binding one molecule of 4-
coumaroyl-CoA with three molecules of malonyl-CoA, which is
a product of fatty acid biosynthesis. In some microorganisms,

0141-0229/$ – see front matter © 2012 Elsevier Inc. All rights reserved.
http://dx.doi.org/10.1016/j.enzmictec.2012.06.005
212 S.-Y. Shin et al. / Enzyme and Microbial Technology 51 (2012) 211–216
Fig. 1. Biosynthetic pathway of resveratrol in plants. The names of the metabolic enzymes are abbreviated as follows: PAL, phenylalanine ammonia lyase; C4H, cinnamic
acid 4-hydroxylase; 4CL1, 4-coumarate:coenzyme A ligase; STS, stilbene synthase; TAL, tyrosine ammonia lyase.
malonyl-CoA, a substrate for resveratrol production, plays a
key role in chain elongation in fatty acid biosynthesis and is
formed by the carboxylation of acetyl-CoA by acetyl-CoA car-
boxylase (ACC1) [14]. Therefore, overexpression of the ACC1 gene
might result in an enhancement of the malonyl-CoA pool in the
cell.
Many studies have demonstrated that resveratrol can be syn-
thesized by recombinant yeasts when p-coumaric acid is fed to
the culture as a starting compound. Recombinant Saccharomyces
cerevisiae (SC FY23) containing the 4CL1 gene from Populus tri-
chocarpa and the STS gene from Vitis vinifera was shown to produce
1.45 ␮g/L resveratrol using p-coumaric acid as the starting mate-
rial [15]. Similarly, S. cerevisiae CEN.PK 113-3b containing the 4CL1
gene from tobacco and the STS gene from grapevine was able to
produce 5.8 mg/L resveratrol [16]. When the 4CL1 gene from Ara-
bidopsis thaliana and the STS gene from Arachis hypogaea were
constitutively expressed in S. cerevisiae W303-1A, 3.1 mg/L resver-
atrol was produced [17]. Even though these studies have suggested
a possible way to produce resveratrol from p-coumaric acid using
a recombinant microbial system, the use of p-coumaric acid as a
precursor has drawbacks such as the inhibition of cell growth at
high concentrations and an economical burden owing to its high
price.
Herein, we investigated whether the yeast can synthesize
resveratrol from tyrosine, a starting material that is cheaper than
p-coumaric acid. To accomplish this, we introduced four genes into
S. cerevisiae: PAL from Rhodosporidium toruloides, C4H and 4CL1
from Arabidopsis thaliana, and STS from Arachis hypogaea. It has
been known that PAL from R. toruloides exerts catalytic activity
on both tyrosine and phenylalanine [18]. Furthermore, we exam-
ined whether an increases in the malonyl-CoA pool can improve
resveratrol production. To accomplish this, we replaced the native
promoter of the ACC1 gene with the stronger GAL1 promoter.
2. Materials and methods
2.1. Strains and plasmids
Escherichia coli TOP10 (Invitrogen, Carlsbad, CA, USA) was used for DNA manip-
ulation. S. cerevisiae W303-1A [MAT˛ leu2-3, 112; ura3-1; trp1-1; his3-11, 15; ade2-1]
was used as the host for the production of p-coumaric acid and resveratrol. All
plasmids and oligonucleotides used in this study are listed in Table 1.
2.2. Construction of expression plasmids
The PAL gene, derived from the red yeast Rhodosporidium toruloides (GeneBank
accession number: X12702), was amplified using plasmid pKS2 ␮Hyg-PAL (donated
by Prof. John A. Morgan, Purdue University, West Lafayette, IN, USA) as a tem-
plate. Two primers, PAL F and PAL R were designed to contain the SpeI and EcoRI
 S.-Y. Shin et al. / Enzyme and Microbial Technology 51 (2012) 211–216 213

Table 1
List of plasmids and oligonucleotides used in this study.

Plasmids and primers Relevant properties and sequences (5 –3 ) Sources

Plasmids
pESCTRP Galactose-inducible GAL1 and GAL10 promoters, 2 ␮M, Ampr , Invitrogen
Trp
p425GAL1 Galactose-inducible GAL1 promoter, 2 ␮M, Ampr , Leu ATCC
p423GAL1 Galactose-inducible GAL1 promoter, 2 ␮M, Ampr , His ATCC
pMCS5 Inducible T7 promoter with multiple cloning sites (59 MCS), Mo Bi Tec
Ampr
pWJ1077 Plasmid containing KlURA3 gene [14]
pKS2 Hyg-PAL Plasmid containing PAL gene from R. toruloidse [15]
p425PAL p425GAL1 carrying PAL from R. toruloides This study
p423C4H p423GAL1 carrying C4H from A. thaliana This study
pESCTRP4CL1-STS pESCTRP carrying 4CL1 from A. thaliana and STS from A. This study
hypogaea
pAUGA4 pMCS5 containing upstream fragment of ACC1 promoter, This study
KlURA3 selectable maker, GAL1 promoter, and a portion of
ACC1 ORF
Oligonucleotides
PAL F (SpeI) GAGCACTAGTATGGCACCCTCGCTCGACTCG
PAL R (EcoRI) GAGCGAATTCCTAAGCGAGCATCTTGAGGA
C4H F (SalI) GCGCGTCGACATGGACCTCCTCTTGCTGGAG
C4H R (XhoI) CCGCCTCGAGTTAACAGTTCCTTGGTTTC
STS F (SpeI) CTAGGACTAGTATGGTGTCTGTGAGTGGA
STS R (BglII) GGAAAGATCTTTATATGGCCACACTGC
4CL1 F (ApaI) CGGGGCCCATGGCGCCACAAGAACAA
4CL1 R (XhoI) CCGCTCGAGTCACAATCCATTTGCTAG
PACC1 F CTGCCCTAGGCACAATTGTTATCGGTTCTACAA
PACC1 R AGGCACTAGTTCTCGGAGGCGTGACCC
ACC1-CK F AACAACAAACTCCGGGCACAT
ACC1-CK R GAGCAATGAACCCAATAACGAAATC

The underlined characters indicate the recognition sites of the restriction enzymes.

sites, respectively. Plasmid p425PAL was constructed by ligating the digested PCR
fragment and p425GAL with SpeI and EcoRI individually to generate the PAL gene
expression system under the control of the GAL promoter. The gene for C4H was
obtained by polymerase chain reaction (PCR) amplification from the cDNA of A.
thaliana (GeneBank accession number: NM128601) using the two primers C4H F
and C4H R (Table 1). After digestion of the PCR fragment with SalI and XhoI, the
DNA fragment was cloned into p423GAL1 to construct plasmid p423C4H. All four
genes were under the control of the GAL promoter. The 4CL1 gene from A. thaliana,
containing the entire 4CL1 open reading frame (ORF) (GeneBank accession number:
NM104046), was donated by Prof. S. O. Kim (Seoul National University, Seoul, Korea).
The structural STS gene from A. hypogaea (GeneBank accession number: AF227963)
was donated by Honam Agricultural Research Institute (Jeonbuk-do, Korea). In order
to construct the 4CL1 gene expression vector, the 4CL1 gene was amplified using the
primers 4CL1 F and 4CL1 R (Table 1). After enzyme digestion with ApaI and XhoI,
the amplified gene fragment was inserted into pESCTRP vector, resulting in plas-
mid pESCTRP4CL1. The STS gene was PCR-amplified using the primers STS F and
STS R (Table 1). The PCR product containing the STS gene was inserted into pESC-
TRP4CL1 vector between the SpeI and BglII sites. Finally, plasmid pESCTRP4CL1-STS
was constructed to express the 4CL1 and STS genes under the control of the GAL1
and GAL10 promoters, respectively. Restriction enzyme analysis and DNA sequenc-
ing were performed to ensure the accuracy of cloning all PAL, C4H, 4CL1, and STS
genes.
2.3. Replacement of the ACC1 promoter
To overexpress the ACC1 gene, the native promoter of ACC1 was replaced with
the strong GAL1 promoter via homologous recombination [19]. The upstream frag-
ment of the ACC1 promoter, a selectable marker, the GAL1 promoter, and a portion of
ACC1 ORF fragment were assembled to construct a vector (pAUGA4). The upstream
fragment of the ACC1 promoter and a portion of the ACC1 ORF were amplified from
S. cerevisiae CENPK2-1D genomic DNA. The selectable marker, KlURA3, was ampli-
fied using pWJ1077 (donated from Prof. Rothstein, Columbia University, New York,
NY, USA) as a template [20]. The entire cassette for ACC1 promoter replacement
was amplified from the constructed pAUGA4 vector using two primers, PACC1 F
and PACC1 R. The PCR product was transformed into S. cerevisiae W303-1A for
integration into the yeast chromosome by homologous recombination (Fig. 6A).
YNB medium [0.67% (w/v) yeast nitrogen base without amino acids and with 2%
glucose] was used to select the transformants harboring the TRP1, HIS, URA3, and
LEU genes. Batch culture was carried out in a 5-L-scale jar fermentor (Bioengineering
AG, Wald, Switzerland) with 1 L of YP medium (1% yeast extract and 2% peptone)
containing 2% galactose. Agitation speed of 500 rpm, aeration of 1 vvm and culture
temperature of 30 ◦ C were maintained. The pH was controlled at 5.5 by the addition
of 2N HCl or 2N NaOH.
2.5. Analytical methods
Optical density was measured at 600 nm using a spectrophotometer (Ultro-
spec 2000, Amersham Phamacia Biotech, Uppsala, Sweden) and multiplied by a
pre-determined conversion factor of 0.2 to obtain the dry cell concentration. The
concentrations of galactose and ethanol were quantified by high-performance liq-
uid chromatography (1100LC, Agilent, Santa Clara, CA, USA) equipped with an RI
detector. Samples were analyzed on a carbohydrate analysis column (Phenomenex,
Torrance, CA, USA) at 60 ◦ C. The mobile phase was 5 mM H2 SO4 and the flow rate
was 0.6 mL/min.
2.6. Extraction and analysis of resveratrol, p-coumaric acid, and cinnamic acid
Resveratrol was extracted twice from the culture medium and the disrupted
cells of S. cerevisiae with an equal volume of ethyl acetate. The organic phase con-
taining resveratrol was collected and dried, and the residue was dissolved in 40%
acetonitrile. To determine the concentrations of cinnamic acid and p-coumaric acid,
samples taken at various times were centrifuged and the culture supernatant was
diluted with 40% acetonitrile. Cinnamic acid and p-coumaric acid were analyzed by
HPLC using the Inersil ODS-3(C18) column (GL Sciences, Tokyo, Japan) by the fol-
lowing method. Solvent A was 0.1% (v/v) trifluoroacetic acid (TFA) in water; solvent
B was 0.1% (v/v) TFA in acetonitrile. The flow rate was 0.8 mL/min and the column
was kept at 40 ◦ C. Cinnamic acid and p-coumaric acid were quantified based on the
peak area at 280 nm and 310 nm, respectively. Resveratrol was analyzed by HPLC
using the same method. The UV absorbance was recorded at 310 nm.
3. Results and discussion

2.4. Culture conditions 3.1. Production of p-coumaric acid in recombinant S. cerevisiae

E. coli TOP 10 was cultivated in Luria-Bertani (LB) medium [0.5% (w/v) yeast
extract, 1% (w/v) tryptone and 1% (w/v) NaCl], with or without 2% agar, at 37 ◦ C. E. To produce p-coumaric acid in S. cerevisiae W303-1A, plas-
coli transformants were selected in LB medium containing ampicillin (100 ␮g/mL). mids p425PAL and p423C4H containing the PAL and C4H genes,
214 S.-Y. Shin et al. / Enzyme and Microbial Technology 51 (2012) 211–216

Fig. 3. RT-PCR analysis to confirm the transcriptional expression of introduced

genes. Panel A indicates RT-PCR products from the host yeast. Panel B indicates
RT-PCR products from the transformant expressing PAL, C4H, 4CL1, and STS genes.
Transcripts were analyzed after 20, 40, and 60 h of fermentation and actin tran-
scripts were detected in both the host and the transformant yeasts as an endogenous
control.

and STS genes were introduced into S. cerevisiae W303-1A using

plasmids p425PAL, pESCTRP4CL1-STS, and p423C4H. The presence
and transcriptional activity of the four genes (PAL, C4H, 4CL1 and
STS) in the transformant were analyzed by reverse-transcription
RT-PCR using the corresponding primers (Table 1). The results of
RT-PCR confirmed the functional expression of all four genes in the
recombinant yeast as shown in Fig. 3. HPLC analysis showed peaks
corresponding to p-coumaric acid and resveratrol in the culture
medium. This result represented that resveratrol was synthesized
in the recombinant yeast (Fig. 4).
When the strain expressing PAL, C4H, 4CL1 and STS was cul-
tivated in a batch reactor, p-coumaric acid was produced after
20 h with the consumption of galactose, yielding 3.3 g/L dry cell

Fig. 2. Batch fermentation profiles of recombinant S. cerevisiae W303-1A strains

harboring p425PAL (A) and p425PAL + p423C4H (B) plasmids in YP medium contain-
ing 2% galactose. Filled circle denotes dry cell mass, open circle denotes galactose
concentration, filled triangle denotes ethanol concentration, open triangle denotes
cinnamic acid, open square denotes p-coumaric acid. All data in the figures are the
average of three independent measurements.

respectively, in the phenyl propanoid pathway were transformed

into the yeast strain. Batch fermentations were carried out in
YP medium containing 2% galactose at 30 ◦ C, after inoculation of
the transformants W303-1A containing single plasmid p425PAL
or dual plasmids p425PAL and p423C4H. During the cultivation
period, cinnamic acid was successfully synthesized in both extra-
cellular culture broth and intracellular fraction (Fig. 2A). The
W303-1A strain harboring p425PAL produced not only cinnamic
acid (≤0.9 mg/L) but also p-coumaric acid (7.7 mg/L), while the
two metabolites were not detected in the control strain harbor-
ing p425GAL. This result shows that PAL from R. toruloides converts
phenylalanine to cinnamic acid and tyrosine to p-coumaric acid.
When the C4H gene was coexpressed with the PAL gene using
both p425PAL and p423C4H plasmids (Fig. 2B), while cinnamic acid
was not detected in the transformants throughout the cultivation
period, the p-coumaric acid concentration increased to 10.5 mg/L
after 70 h of cultivation, which was 1.4-fold higher than the con-
centration obtained from the PAL-expressing strain. These results
indicate that the simultaneous expression of PAL and C4H yielded
a higher concentration of p-coumaric acid by converting cinnamic Fig. 4. HPLC analyses of resveratrol and p-coumaric acid produced by recombinant
S. cerevisiae W303-1A strains harboring the p425PAL, p423C4H, and pESCTRP4CL1-
acid into the product.
STS plasmids. Chromatogram A represents peaks obtained with authentic standards
of resveratrol and p-coumaric acid (p-coumaric acid, 4.9 min; resveratrol, 6.8 min).
3.2. Production of resveratrol from amino acids Chromatogram B represents peaks obtained with the sample produced by the host
yeast. Chromatogram C shows peaks obtained with the sample produced by recom-
binant S. cerevisiae W303-1A/p425PAL + p423C4H + pESCTRP4CL1-STS. The arrow
For the production of resveratrol directly from amino acids with- indicates the peak of authentic p-coumaric acid and the star indicates the peak of
out supplying p-coumaric acid as a precursor, the PAL, C4H, 4CL1, authentic resveratrol.
 S.-Y. Shin et al. / Enzyme and Microbial Technology 51 (2012) 211–216 215

Fig. 5. Batch fermentation profiles of the recombinant S. cerevisiae W303-1A strain

harboring the p425PAL, p423C4H, and pESCTRP4CL1-STS plasmids in YP medium
containing 2% galactose. Filled circle denotes dry cell mass, open circle denotes
galactose concentration, filled triangle denotes ethanol concentration, open square
denotes p-coumaric acid, filled square denotes resveratrol. All data in the figures are
the average of three independent measurements.

Fig. 6. Schematic representation of the replacement of the native ACC1 promoter

by homologous recombination in S. cerevisiae (A) and confirmation of promoter
replacement by PCR. Lane M denotes DNA marker, N.C denotes PCR product of
mass, 2.6 mg/L p-coumaric acid and 3.4 mg/L resveratrol as dis- parental strain, ACC1 denotes PCR product of S. cerevisiae W303-1A/ACC1 strain.
played in Fig. 5. This yeast strain produced more resveratrol in the
medium without p-coumaric acid than the previously described 3.4. Production of resveratrol by tyrosine supplementation
strains. Wang et al. [21] demonstrated resveratrol concentration
of 1.06 mg/L in the absence of tyrosine in recombinant S. cerevisiae To investigate the effect of tyrosine supplementation on resver-
containing PAL from Rhodobacter sphaeroides, 4CL1 from A. thaliana, atrol production, S. cerevisiae W303-1A/ACC1 containing p425PAL,
and STS from Vitis vinifera. Meanwhile, Trantas et al. [22] demon- p423C4H, and pESCTRP4CL-STS plasmids was cultured in YP
strated resveratrol concentration of 0.29 mg/L in S. cerevisiae YPH medium at different tyrosine concentrations (0–12 mM). The con-
499 harboring PAL from Poplar hybrid populus, C4H from Glycine centrations of p-coumaric acid produced increased with increasing
max, and STS from V. vinifera, in CM medium containing 10 mM tyrosine concentrations, reaching a maximum (13.6 mg/L) at
phenylalanine after 120 h of cultivation. 12 mM tyrosine (data not shown). This indicates that the tyrosine
pool in recombinant S. cerevisiae is limiting for the produc-
tion of p-coumaric acid in YP medium. The recombinant strain
3.3. Transcriptional activation of the ACC1 gene was cultivated with 12 mM tyrosine and the growth profiles
were analyzed as shown in Fig. 8. The maximum concentra-
In order to increase the pool of malonyl-CoA, which is used as a tions of resveratrol were 5.8 mg/L, 1.7-fold higher than that of
precursor of resveratrol, the expression level of the ACC1 transcript recombinant S. cerevisiae W303-1A harboring p425PAL, p423C4H
was elevated by replacement of the native promoter with the GAL and pESCTRP4CL-STS. When we performed the same cultivation
promoter. A plasmid was constructed for gene replacement that
had a fusion of KlURA3 and the GAL1 promoter inserted between
the 5 fragment of the ACC1 promoter and ACC1 ORF. This plasmid
was transformed into S. cerevisiae W303-1A and the colony gen-
erated by the transformation illustrated in Fig. 6A was selected by
growing on a YNB plate without uracil. Replacement of the ACC1
promoter was confirmed by PCR using ACC1-CK F and ACC1-CK R.
While no band was observed in the parental stain, the expected-
size PCR product was obtained in the S. cerevisiae W303-1A/ACC1
strain as shown in Fig. 6B.
The ACC1 transcript level in recombinant S. cerevisiae W303-
1A/ACC1 was compared with the parental strain using RT-PCR. A
2-fold increase in the transcriptional level of ACC1 was assayed in
the transformant compared to the control strain (data not shown).
Recombinant S. cerevisiae W303-1A/ACC1 harboring p425PAL,
p423C4H and pESCTRP4CL-STS plasmids cultivated in YP medium
containing 2% galactose (Fig. 7) was able to produce 4 mg/L
p-coumaric acid and 4.3 mg/L resveratrol. As anticipated, the tran-
scriptional activation of the ACC1 gene by the GAL1 promoter Fig. 7. Batch fermentation profiles of the recombinant S. cerevisiae W303-1A/ACC1
resulted in a 1.3-fold increase in the resveratrol concentration. strain harboring the p425PAL, p423C4H, and pESCTRP4CL1-STS plasmids in YP
medium containing 2% galactose. Filled circle denotes dry cell mass, open circle
However, the final dry cell mass was slightly lower (3.0 g/L) than
denotes galactose concentration, filled triangle denotes ethanol concentration, open
that of the control strain, possibly due to changes in metabolic square denotes p-coumaric acid, filled square denotes resveratrol. All data in the
balance in the recombinant strain. figures are the average of three independent measurements.
216 S.-Y. Shin et al. / Enzyme and Microbial Technology 51 (2012) 211–216
Fig. 8. Batch fermentation profiles of the recombinant S. cerevisiae W303-1A/ACC1
strain harboring the p425PAL, p423C4H, and pESCTRP4CL1-STS plasmids in YP
medium containing 2% galactose and 12 mM tyrosine. Filled circle denotes dry cell
mass, open circle denotes galactose concentration, filled triangle denotes ethanol
concentration, open square denotes p-coumaric acid, filled square denotes resvera-
trol. All data in the figures are the average of three independent measurements.
experiment using the parental strain, S. cerevisiae W303-1A har-
boring p425PAL, p423C4H and pESCTRP4CL-STS, supplementing
12 mM tyrosine in the medium resulted in the same effect, increas-
ing the resveratrol concentration up to 5.0 mg/L (data not shown). It
is interesting to note that resveratrol concentration did not increase
in proportion to the amount of tyrosine added, possibly due to the
consumption of tyrosine as a substrate.
Conversion yield that resveratrol produced from p-coumaric
acid seemed to be low in the recombinant yeast strain because
p-coumaric acid still remained unused even at the in later fermen-
tation. Further optimization of the fermentation conditions and
the use of tailor-made enzymes are required in order to improve
resveratrol concentrations.
Previous studies [23,24] have shown that STS from A. hypogaea
used in this study mainly produced resveratrol from p-coumaric
acid, but two pyrone by-products such as bis-noryangonin (BNY)
(14%) and 4-coumaroyltriacetic acid lactose (CTAL) (9.9%) were
also detected by TLC analysis. These two pyrones are regarded as
intermediates of incomplete reactions, released after two or three
condensations with malonyl-CoA, respectively, and hence the for-
mation of these by-products resulted in low conversion yield from
p-coumaric acid. The use of a highly specific STS enzyme would
increase resveratrol concentration further. In addition, applications
of protein engineering such as translational fusion technology by
coupling PAL, C4H, 4CL1, and STS genes would be effective in increas-
ing resveratrol concentration. In fact, Zhang et al. [25] performed
the similar study by expressing a fusion enzyme of 4CL1 and STS
in S. cerevisiae and found that resveratrol production increased in
the fusion-expressing strain by up to 15 fold compared with the
coexpression strain.
Acknowledgments
This research was supported by a grant from Marine Biotechnol-
ogy Program funded by Ministry of Land, Transport and Maritime
Affairs of Korean Governmentand Korea Research Council of
Fundamental Science & Technology (KRCF)Grant, and in part by
Ministry for Food, Agriculture, Forestry and Fisheries, Korea.
References
[1] Wang Y, Catana F, Yang Y, Roderick R, van Breemen RB. An LC–MS method for
analyzing total resveratrol in grape juice, cranberry juice, and in wine. Journal
of Agricultural and Food Chemistry 2002;50:431–5.
[2] Burns J, Yokota T, Ashihara H, Lean ME, Crozier A. Plant foods and herbal
sources of resveratrol. Journal of Agricultural and Food Chemistry 2002;50:
3337–40.
[3] Jeandet P, Douillet-Breuil AC, Bessis R, Debord S, Sbaghi M, Adrian M. Phytoalex-
ins from the Vitaceae: biosynthesis, phytoalexin gene expression in transgenic
plants, antifungal activity, and metabolism. Journal of Agricultural and Food
Chemistry 2002;50:2731–41.
[4] Petrovski G, Gurusamy N, Das DK. Resveratrol in cardiovascular health and
disease. Annals of the New York Academy of Sciences 2011;1215:22–33.
[5] Bhat KPL, Kosmeder 2nd JW, Pezzuto JM. Biological effects of resveratrol.
Antioxidants and Redox Signalling 2001;3:1041–64.
[6] Sun AY, Wang Q, Simonyi A, Sun GY. Resveratrol as a therapeutic agent for
neurodegenerative diseases. Molecular Neurobiology 2010;41:375–83.
[7] Baxter RA. Anti-aging properties of resveratrol: review and report of a potent
new antioxidant skin care formulation. Journal of Cosmetic Dermatology
2008;7:2–7.
[8] Hsieh TC, Wu JM. Resveratrol: biological and pharmaceutical properties as
anticancer molecule. BioFactors 2010;36:360–9.
[9] King RE, Bomser JA, Min DB. Bioactivity of resveratrol. Comprehensive Reviews
in Food Science and Food Safety 2006;5:65–70.
[10] Limem I, Guedon E, Hehn A, Bourgaud F, Chekir Ghedira L, Engasser J-M,
et al. Production of phenylpropanoid compounds by recombinant microor-
ganisms expressing plant-specific biosynthesis genes. Process Biochemistry
2008;43:463–79.
[11] Vogt T. Phenylpropanoid biosynthesis. Molecular Plant 2010;3:2–20.
[12] Ferrer JL, Austin MB, Stewart Jr C, Noel JP. Structure and function of enzymes
involved in the biosynthesis of phenylpropanoids. Plant Physiology and Bio-
chemistry 2008;46:356–70.
[13] Rosler J, Krekel F, Amrhein N, Schmid J. Maize phenylalanine ammonia-lyase
has tyrosine ammonia-lyase activity. Plant Physiology 1997;113:175–9.
[14] Tong L. Acetyl-coenzyme A carboxylase: crucial metabolic enzyme and
attractive target for drug discovery. Cellular and Molecular Life Sciences
2005;62:1784–803.
[15] Becker JV, Armstrong GO, van der Merwe MJ, Lambrechts MG, Vivier MA,
Pretorius IS. Metabolic engineering of Saccharomyces cerevisiae for the synthe-
sis of the wine-related antioxidant resveratrol. FEMS Yeast Research 2003;4:
79–85.
[16] Beekwilder J, Wolswinkel R, Jonker H, Hall R, de Vos CH, Bovy A. Production of
resveratrol in recombinant microorganisms. Applied and Environment Micro-
biology 2006;72:5670–2.
[17] Shin SY, Han NS, Park YC, Kim MD, Seo JH. Production of resveratrol
from p-coumaric acid in recombinant Saccharomyces cerevisiae expressing
4-coumarate:coenzyme A ligase and stilbene synthase genes. Enzyme and
Microbial Technology 2011;48:48–53.
[18] Jiang H, Wood KV, Morgan JA. Metabolic engineering of the phenylpropanoid
pathway in Saccharomyces cerevisiae. Applied and Environment Microbiology
2005;71:2962–9.
[19] Wattanachaisaereekul S, Lantz AE, Nielsen ML, Nielsen J. Production of the
polyketide 6-MSA in yeast engineered for increased malonyl-CoA supply.
Metabolic Engineering 2008;10:246–54.
[20] Reid RJ, Sunjevaric I, Keddache M, Rothstein R. Efficient PCR-based gene disrup-
tion in Saccharomyces strains using intergenic primers. Yeast 2002;19:319–28.
[21] Wang Y, Halls C, Zhang J, Matsuno M, Zhang Y, Yu O. Stepwise increase of resver-
atrol biosynthesis in yeast Saccharomyces cerevisiae by metabolic engineering.
Metabolic Engineering 2011.
[22] Trantas E, Panopoulos N, Ververidis F. Metabolic engineering of the complete
pathway leading to heterologous biosynthesis of various flavonoids and stil-
benoids in Saccharomyces cerevisiae. Metabolic Engineering 2009;11:355–66.
[23] Morita H, Noguchi H, Schroder J, Abe I. Novel polyketides synthesized
with a higher plant stilbene synthase. European Journal of Biochemistry
2001;268:3759–66.
[24] Yamaguchi T, Kurosaki F, Suh DY, Sankawa U, Nishioka M, Akiyama T, et al.
Cross-reaction of chalcone synthase and stilbene synthase overexpressed in
Escherichia coli. FEBS Letters 1999;460:457–61.
[25] Zhang Y, Li SZ, Li J, Pan X, Cahoon RE, Jaworski JG, et al. Using unnatural pro-
tein fusions to engineer resveratrol biosynthesis in yeast and mammalian cells.
Journal of the American Chemical Society 2006;128:13030–1.