Development and Characterization

of A d d i t i o n a l M i c r o s a t e l l i t e
D N A M a r k e r s for Grape
JOHN E. BOWERS ~, GERALD S. DANGL 2, and CAROLE P. MEREDITH 3.
Twenty-two new grape microsatellite markers were developed from CT-repeat regions cloned from Vitis
vinifera Pinot noir and Cabernet Sauvignon. These loci were amplified in from 51 to 347 cultivars of V. vinifera.
Twelve of the markers are polymorphic and informative in V. vinifera. Five are monomorphic in V. vinifera and
the remaining five are polymorphic but less useful because they have only two alleles or more than two bands
are amplified per individual. The number of alleles detected in the twelve informative markers ranged from 4 to
19, with heterozygosity values ranging from 0.42 to 0.90. Primer sequences and allele frequencies in the
cultivars tested are reported for these markers. Revised allele frequencies are also presented for three
previously reported microsatellite markers. Genotypes for the 12 informative new markers are presented for
seven suggested reference cultivars.
KEY WORDS: grape, Vitis, simple-sequence-repeat, SSR, microsatellite, DNA-polymorphism, DNA-typing,
variety identification

Microsatellite markers (also called simple sequence USDA National Clonal Germplasm Repository in Davis
repeat or SSR markers) are now widely used in grape- and the INRA collection at Domaine de Vassal near
vine genetic research for identifying cultivars [6], inves- Montpellier, France. Genomic DNA was isolated as pre-
tigating the parentage of cultivars [3], genome mapping viously reported [1] except that in most cases the proto-
[8] and genetically characterizing germplasm [5]. To col was performed at approximately 1 / 2 0 th scale to re-
date, 27 grapevine microsatellite markers have been duce it to a volume suitable for microcentrifuge tubes.
described in published reports from Thomas and Scott A m p l i f i c a t i o n : Genomic DNA was diluted to ap-
[10], Bowers et al. [2], and Sefc et al. [9]. We report here proximately 2.5 ng/pL in water. Four pL of this DNA
the development of 22 additional markers, 12 of which dilution was added to 1.6 ~tL of NTPs (2.5 mM each
are polymorphic and useful in Vitis vinifera and 10 NTP), 2 ~tL 10x PC5Buffer II (Perkin-Elmer), 0.5 unit
others which have value for mapping and gremplasm AmpliTaq Gold (Perkin-Elmer), 20 pmoles each primer,
characterization. MgC12 to a final concentration of 2.0 mM, and water to a
Materials and Methods volume of 20 ~L. The reactions were covered with one
drop of mineral oil and spun briefly in a microcentrifuge
Cloning and sequencing: Simple sequence repeat to mix the reaction and ensure coverage by the mineral
regions containing CT dinucleotide repeats were cloned oil. Amplification was performed with a Perkin-Elmer
and sequenced by t h r e e methods. For m a r k e r s 480 thermal cycler and consisted of 2 minutes at 94°C,
VVMD12, VVMD30, and VVMD37, cloning and se- followed by 40 cycles of (30 seconds of 92°C, 30 seconds
quencing were as previously described [2] starting with of 56°C and 2 minutes of 72°C). Cycling was followed by
genomic DNA from V. vinifera Pinot noir. For markers a 7-minute soak at 72°C.
VVMD31, VVMD32, VVMD34, VVMD35, and VVMD36,
a genomic library from Pinot noir was enriched accord- Amplification was confirmed by running 5 pL of the
ing to the protocol of Ostrander et al. [7]. The remaining PCR reaction product on 2% agarose gels and failed
markers were cloned from genomic DNA of V. vinifera reactions were repeated. Thirty ~L of denaturing dye
Cabernet Sauvignon according to the method described solution (95% formamide, 0.5% bromophenol blue, 0.5%
in Knapik et al. [4]. Primers were designed with Primer xylene cyanol, 10 mM NaOH) was added to the remain-
0.5 [S. E. Lincoln, Whitehead Institute, Cambridge, ing 15 ~tL of the PCR reaction. In some cases the prod-
Massachusetts]. ucts from two or more PCR primer pairs could be com-
bined and run on the same acrylamide gel, providing
Plant material: Young leaves and shoot tips were that the expected products were separated by at least 20
collected from actively growing vines of Vitis vinifera bp. In these cases equal volumes of each reaction were
cultivars at the University of California at Davis, the mixed and 3 ~tL of the mixture was loaded on the gel.
Reactions were heated briefly at 90°C, and 3 ~tL of this
1,2,3Departmentof Viticulture and Enology, University of California, Davis, CA 95616-8947, USA. mixture was electrophoresed in a 42-cm sequencing gel
*Corresponding author [e-mail <cpmeredith@ucdavis.edu>]. (6% acrylamide, 7 M urea, Promega gel apparatus). Gels
Acknowledgements:We acknowledge the contributions of Rita Vignani, who participated in were preheated for at least one hour, loaded and run at
some of the cloning, and Warren Lamboy, who sequenced several of the clones. We thank
Howard Jacob, Ela Knapik and Alec Goodman for their assistance to JEB while he worked in
80 W until the xylene cyanol dye reached the bottom of
Jacobs' laboratory at Massachusetts General Hospital. the gel. The gels were silver stained according to the
Manuscript submitted for publication 2 March 1999; revised 19 July 1999. protocols and reagents provided with the Promega Sil-
Copyright © 1999 by the American Society for Enology and Viticulture. All rights reserved. ver Sequencing Kit (Promega).
243

A m . J. E n o l . V i t i c . , V o l . 50, No. 3, 1999

~ 244 m B O W E R S et aL

Table 1. Characteristics of 12 microsatellite markers Table 2. Characteristics of 10 microsatellite markers

that are polymorphic in V. vinifera. of less utility in V. vinifera.

Gene No. of Number Allele

No. of Allele size % hetero- diversity cultivars of size range
Locus alleles range (bp) zygosity value analyzed Locus alleles (bp) Comments
Polymorphic but less useful
VVMD14 10 222-250 0.84 0.80 99
VVMD20 7 167-218 More than 2 bands per individual
VVMD17 6 212-236 0.75 0.71 102
VVMD23 2 177-178 Only 2 alleles
VVMD21 6 243-266 0.54 0.53 347
VVM D29 7 190-215 More than 2 bands per individual
VVMD24 7 208-219 0.74 0.71 347
VVMD30 9 100-124 More than 2 bands per individual
VVMD25 11 243-275 0.84 0.78 347
VVMD37 9 220-256 More than 2 bands per individual
VVMD26 8 249-265 0.67 0.63 347
VVMD27 11 173-194 0.89 0.82 347 Monomorphic in 51 vinifera cultivars
VVM D28 15 221-279 0.90 0.89 347 VVMD12 1 nd
VVMD31 11 196-224 0.81 0.77 347 VVMD13 1 218
VVMD32 11 239-273 0.82 0.80 347 VVMD15 1 154
VVMD34 4 224-248 0.42 0.40 347 VVMD19 1 196
VVM D36 19 244-315 0.81 0.81 346 VVMD35 1 265

nd= not determined

Table 3. Primer sequences for 12 microsatellite markers that are polymorphic in V. vinifera.

Locus + primer - primer

VVMD14 CATGAAAAAATCAACATAAAAGGGC TTGTTACCCAAACACTTCACTAATGC
VVMD17 TGACTCGCCAAAATCTGACG CACACATATCATCACCACACGG
VVMD21 GGTTGTCTATGGAGTTGATGTTGC GCTTCAGTAAAAAGGGATTGCG
VVMD24 GTGGATGATGGAGTAGTCACGC GATTTTAGGTTCATGTTGGTGAAGG
VVMD25 TTCCGTTAAAGCAAAAGAAAAAGG TTGGATTTGAAATTTATTGAGGGG
VVMD26 GAGACGACTGGTGACATTGAGC CCATCACCACCATTTCTACTGC
VVMD27 GTACCAGATCTGAATACATCCGTAAGT ACGGGTATAGAGCAAACGGTGT
VVMD28 AACAATTCAATGAAAAGAGAGAGAGAGA TCATCAATTTCGTATCTCTATTTGCTG
VVMD31 CAGTGGTTTTTCTTAAAGTTTCAAGG CTCTGTGAAAGAGGAAGAGACGC
VVMD32 TATGATTTTTTAGGGGGGTGAGG GGAAAGATGGGATGACTCGC
VVMD34 GGTACATCAGTACTTGAAATGGTTGC TTCTCCGTAGAAGCGTAAACAGC
VVMD36 TAAAATAATAATAGGGGGACACGGG GCAACTGTAAAGGTAAGACACAGTCC

Table 4. Primer sequences for 10 microsatellite markers of lesser utility in V. vinifera.

Locus + primer - primer

Polymorphic but less useful
VVMD20 AAAACACATATTCAAACCAACCCC AACACCCTCCCTCTCCTACTCC
VVMD23 ATGGTTCGATGGATGGATGG AAGTATGAAGCGAGTGCAGGC
VVMD29 CCTTTGAACTTTGAAGTCTATGAGTCTG AGCTAGAAACAGAACTCTCTCTCTCTC
VVMD30 CGAAAGAATTCCCAAAGGGC TCTAGGCACTCTTTTCGGTACTCC
VVMD37 GATCGCCTTGTAATCCAAAAGG GATCTGAACTAACCCAAGAAGAGAGC

Monomorphic in 51 vinifera cultivars

VVMD 12 CCTTcTGTATAGCAACCTcTGA TTCCCTcATATTTGAAcAGTCT
VVMD 13 ATGGTGAAAGAAG CAGAGAGG G GCATTGAAGATGACcGGTAGC
VVMD15 CTGCAGTGCACTcAAAGTTGG TGAAACACcAAGGGAAACCTC
VVMD19 TGAAATATCATcAATGCTCTCTCTCC GGTTGATATTGCTTCcTTTTCCC
VVMD35 GAGGAAGACTCCTCAcGTAGAAGG TCAAcAAAcATACcGAGGAACG

Am. J. Enol. Vitic., Vol. 50, No. 3, 1999

 MICROSATELLITE DNA MARKKERS w 245

Scoring: All gels were scored visually at least two
times on a light box. Allele sizes were initially deter-
mined by comparison to a sequencing reaction and in
subsequent analyses by comparison to reference culti-
vars. The data were entered into spreadsheets and the
gels were scanned on a flatbed scanner and stored as
digital images.
Statistics: Gene diversity values were calculated as
in Weir [11].
Results and Discussion
Twelve of the new microsatellite markers are poly-
morphic in V. vinifera and produce unambiguous re-
sults. As with other grape microsatellite markers, they
are highly heterozygous and very informative, with het-
erozygosity values up to 0.90 and allele numbers rang-
ing from 4 to 19 in V. vinifera (Table 1). Mendelian
inheritance of these alleles has been demonstrated in
parentage analysis [3] and in a segregating mapping
population [8]. Because the allele sizes of some of these
markers do not overlap, their amplification products
can be combined in a single polyacrylamide gel. Ex-
amples of possible duplex pairs are VVMD27 +
VVMD28 and VVMD31 + VVMD32. PCR primer se-
quences for these 12 loci are shown in Table 3.
Five of the markers are less useful in V. vinifera
because they have only 2 alleles (VVMD23) or produce
more than two bands per individual (Table 2). Neverthe-
less, these markers may be useful for genome mapping
in some populations (Riaz and Meredith, unpublished
results) and in studies of other Vitis species. Character-
istics and primer sequences for these markers are
shown in Tables 2 and 4.
Five additional markers are monomorphic in 51 cul-
tivars of V. vinifera and thus cannot be used for variety
identification in that species. They may, however, be
polymorphic in other Vitis species. Characteristics and
primer sequences for these markers are shown in Tables
2 and 4.
Allele frequencies for the 12 most useful markers
are shown in Table 5. In addition, because three previ-

Table 5. Allele frequencies for 12 polymorphic microsatellite markers.

VVMD14 VVMD17 VVM D21 VVM D24 VVM D25 VVM D26
Allele Frequency Allele Frequency Allele Frequency Allele Frequency Allele Frequency Allele Frequency
222 0.31 212 0.15 243 0.15 208 0.02 243 0.23 249 0.50
227 0.03 220 0.46 249 0.66 210 0.45 245 0.25 251 0.33
228 0.06 221 0.13 254 0.02 212 0.02 247 <0.01 253 0.02
230 0.01 222 0.21 256 0.10 214 0.27 249 <0.01 255 0.11
232 0.13 224 0.06 258 0.03 216 0.06 253 0.23 257 0.01
234 0.20 236 <0.01 266 0.04 218 0.09 259 0.22 262 <0.01
235 0.05 219 0.09 261 <0.01 263 0.02
240 0.01 263 <0.01 265 <0.01
241 0.20 267 0.04
250 0.01 271 0.02
275 <0.01

VVMD27 VVMD28 VVMD31 VVMD32 VVMD34 VVMD36

Allele Frequency Allele Frequency Allele Frequency Allele Frequency Allele Frequency Allele Frequency
173 <0.01 221 0.06 196 0.01 239 <0.01 224 0.05 244 0.O4
175 0.03 231 0.12 198 <0.01 241 0.30 240 0.76 248 0.01
179 0.22 237 0.17 204 0.13 245 <0.01 242 0.08 250 0.01
181 0.16 239 0.12 206 0.03 249 <0.01 248 0.11 252 0.01
183 0.03 247 0.11 210 0.14 251 0.10 254 0.24
185 0.17 249 0.10 212 0.38 253 0.12 258 <0.01
187 <0.01 251 0.07 214 0.09 257 0.10 264 0.31
189 0.25 257 0.01 216 0.21 259 0.02 266 0.03
191 0.05 261 0.15 218 <0.01 263 0.06 268 0.01
192 <0.01 263 0.03 220 <0.01 265 0.03 270 0.04
194 0.10 267 0.01 224 0.01 273 0.26 272 0.04
269 <0.01 276 0.16
271 0.05 280 <0.01
275 <0.01 282 <0.01
279 <0.01 288 0.02
293 <0.01
295 0.06
297 0.02
315 <0.01

Am. J. Enol. Vitic., Vol. 50, No. 3, 1999

[~ 246 m BOWERS et al.

Literature Cited
Table 6. Revised allele frequencies for three 1. Bowers, J. E., E. B. Bandman, and C. P. Meredith. DNA fingerprint
previously reported microsatellite markers [2]. characterization of some wine grape cultivars. Am. J. Enol. Vitic. 44:266-
274 (1993).
VVMD5 VVMD6 VVMD7 2. Bowers, J. E., G. S. Dangl, et aL Isolation and characterization of
Allele Freq. Allele Freq. Allele Freq. new polymorphic simple sequence repeat loci in grape (Vitis vinifera L.).
Genome 39:628-633 (1996).
222 0.01 194 0.14 233 0.02
224 <0.01 205 0.17 239 0.35 3. Bowers, J. E., and C. P. Meredith. The parentage of a classic wine
226 0.26 211 0.17 243 0.12 grape, Cabernet Sauvignon. Nature Genetics 16:84-87 (1997).
228 0.13 212 0.26 247 0.13 4. Knapik, E. W., A. Goodman, et aL A reference cross DNA panel for
230 <0.01 214 0.26 249 0.22 zebrafish (Danio rerio) anchored with simple sequence length polymor-
phisms. Development 123:451-460 (1996).
232 0.12 251 0.01
234 0.10 253 0.04 5. Lamboy, W. F., and C. G. Alpha. Using simple sequence repeats
(SSRs) for DNA fingerprinting germplasm accessions of grape (Vitis L.)
236 0.10 255 0.01 species. J. Am. Soc. Hortic. Sci. 123:182-188 (1998).
238 0.16 257 0.07
6. Meredith, C. P., J. E. Bowers, et aL The identity and parentage of
240 0.10 261 0.01 the variety known in California as Petite Sirah. Am. J. Enol. Vitic.
246 0.02 263 0.04 (50:236-242 (1999).
7. Ostrander, E. A., P. M. Jong, et aL Construction of small-insert
ously published microsatellite m a r k e r s [2] have now genomic DNA libraries highly enriched for microsatellite repeat se-
quences. Proc. Natl. Acad. Sci. USA 89:3419-3423. (1992).
been analyzed in a significantly larger n u m b e r of geno-
types, revised allele frequencies for these m a r k e r s are 8. Riaz, S., and C. P. Meredith. A developing linkage map of Vitis
vinifera. International Symposium on the Plant and Animal Genome VII,
shown in Table 6. No evidence for null alleles at any of 17-21 January 1999, San Diego California. (abstract) (1999).
these loci has been found in numerous inheritance stud-
9. Sefc, K. M., F. Regner, et aL Identification of microsatellite se-
ies [Bowers and Meredith, unpublished results]. quences in Vitis riparia and their application for genotyping of different
Different laboratories sometimes obtain slightly dif- Vitis species. Genome 42:367-373 (1999).
ferent allele sizes for a single microsatellite m a r k e r be- 10. Thomas, M. R., and N. S. Scott. Microsatellite repeats in grapevine
cause of differences in methodology. Such differences reveal DNA polymorphisms when analysed as sequence-tagged sites
(STSs). Theor. Appl. Genet. 86:985-990 (1993).
can be reconciled by the inclusion of several common
cultivars as s t a n d a r d references for comparison. We 11. Weir, B. Genetic Data Analysis I1. Sinauer and Associates,
Sunderland, Massachusetts (1996).
suggest seven widely grown and genetically diverse cul-
tivars of V. vinifera to be used for this purpose and
provide their allele sizes for 12 m a r k e r s in Table 7.

Table 7. Allele sizes (bp) at 12 microsatellite loci for some suggested reference cultivars of V. vinifera.

C u Itivar VVMD14 VVMD17 VVM D21 VVM D24 VVM D25 VVM D26
Cabernet Sauvignon 222 228 221 222 249 258 210 219 243 253 249 251
Chardonnay 222 234 220 222 249 249 210 218 243 259 249 255
Merlot 228 241 220 221 243 249 210 214 243 253 249 253
Pinot noir 222 241 212 220 249 249 216 218 243 253 249 255
Riesling 232 234 220 221 249 249 210 218 253 259 251 251
Sangiovese 232 235 212 221 243 249 210 216 245 245 249 249
Thompson Seedless 228 240 220 222 249 256 210 219 243 253 249 251
Cultivar VVMD27 VVMD28 VVMD31 VVM D32 VVM D34 VVM D36
Cabernet Sauvignon 175 189 237 239 206 210 241 241 240 248 254 264
Chardonnay 181 189 221 231 214 216 241 273 240 240 254 276
Merlot 189 191 231 237 212 216 241 241 240 240 254 254
Pinot noir 185 189 221 239 216 216 241 273 240 240 254 254
Riesling 181 189 231 237 204 214 253 273 240 240 254 264
Sangiovese 179 185 237 247 212 212 253 257 240 240 264 264
Thompson Seedless 181 194 221 247 212 212 251 251 240 248 250 268

Am. J. Enol. Vitic., Vol. 50, No. 3, 1999