Monoterpenoid biosynthesis in Saccharomyces cerevisiae

Marilyne Oswald, Marc Fischer, Nicole Dirninger & Francis Karst

UMR Santé de la Vigne et Qualité du Vin, Université Louis Pasteur Strasbourg, Institut National de la Recherche Agronomique, Colmar, France

Correspondence: Francis Karst, UMR Santé Abstract

de la Vigne et Qualité du Vin, Université Louis
Pasteur Strasbourg, Institut National de la
Plant monoterpenoids belong to a large family of plant secondary metabolites with
Recherche Agronomique, 28, rue de valuable applications in cosmetics and medicine. Their usual low levels and difficult
Herrlisheim, BP 20507, 68021 Colmar Cedex, purification justify the need for alternative fermentative processes for large-scale
France. Tel.: 133 3 89 22 49 00; fax: 133 3 production. Geranyl diphosphate is the universal precursor of monoterpenoids. In
89 22 49 89; e-mail: karst@colmar.inra.fr yeast it occurs exclusively as an intermediate of farnesyl diphosphate synthesis. In the
present study we investigated the potential use of Saccharomyces cerevisiae as an
Received 26 July 2006; revised 12 September alternative engineering tool. The expression of geraniol synthase of Ocimum basilicum
2006; accepted 21 September 2006.
in yeast allowed a strong and specific excretion of geraniol to the growth medium, in
First published online 9 November 2007.
contrast to mutants defective in farnesyl diphosphate synthase which excreted geraniol
DOI:10.1111/j.1567-1364.2006.00172.x
and linalool in similar amounts. A further increase of geraniol synthesis was obtained
using yeast mutants defective in farnesyl diphosphate synthase. We also showed that
Editor: Guenther Daum geraniol synthase expression affects the general ergosterol pathway, but in a manner
dependent on the genetic background of the strain.
Keywords
monoterpenoids; Saccharomyces cerevisiae ;
geranyl diphosphate; farnesyl diphosphate
synthase; geraniol synthase; ergosterol
biosynthesis.
isopentenyl diphosphate (IPP). However, the low level of
Introduction production attained was attributed to the limiting availabil-
Terpenoids are a large family of metabolites and have been ity of IPP and DMAPP in E. coli. Installation of the yeast
the subject of numerous studies, especially as plant metabo- mevalonate pathway in the bacteria allowed a 20-fold
lites. Among them, monoterpenes and their corresponding increase in terpenoid production (Martin et al., 2003).
alcohols share useful properties, such as fragrances in Yeast is an alternative eukaryotic model, widely used in
essential oils and perfumes or variety aroma in wines. Some peptide production and metabolic engineering. It also has
others exhibit antimicrobial (Pattnaik et al., 1997) or cancer the ability to produce isoprenoids, as described by Szczebara
chemopreventive properties (Zheng et al., 1992; Hohl 1996; et al. (2003), with the biosynthesis of hydrocortisone from
Carnesecchi et al., 2001) or can be used for insect control the sterol pathway. The most basic requirement for mono-
(Lee et al., 1997). Geranyl diphosphate (GPP) is the pre- terpenoid production in yeast is the in vivo availability of
cursor of monoterpenes as well as of a number of secondary GPP. No specific cellular function for GPP has been de-
plant metabolites, such as antimitotic alkaloids (Burlat et al., scribed in yeast, besides being an intermediate compound of
2004). The relatively small number of terpenoids available farnesyl diphosphate (FPP) synthesis (Fig. 1). FPP is the
commercially has prompted considerable interest in devel- precursor of key products such as sterols, dolichols and
opment of microbial fermentative processes as an alternative geranylgeranyl diphosphate (Szkopinska et al., 1997) and
approach for industrial-scale production of these metabo- therefore it contributes to membrane structure, cell-wall
lites (Chotani et al., 2000). However, such production synthesis, protein prenylation or ubiquinone synthesis. FPP
requires modifying microbial internal metabolism in order is a basic product of the yeast cell, but its cellular relevance
to shift production towards the desired terpenoid. makes it widely present among eukaryotic and prokaryotic
Terpenoid production has been investigated in the pro- cells. The tight binding of GPP to the farnesyl diphosphate
karyote Escherichia coli. Carter et al. (2003) have evaluated synthase (FPPS) catalytic site might explain why generally in
the ability of E. coli cells to produce carvone. For this animals and microorganisms no GPP is released and made
purpose, E. coli was transformed with plasmids carrying available for the biosynthesis of C10 byproducts. However,
cDNAs encoding the four enzymes required for carvone yeast mutants excreting geraniol and linalool have been
synthesis from dimethylallyl diphosphate (DMAPP) and characterized previously (Chambon et al., 1990, 1991). It

FEMS Yeast Res 7 (2007) 413–421

c2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
414 M. Oswald et al.

simvastatin was kindly supplied by Merck, and citronellol

OPP
(98%), eugenol (4 99%), m-cresol (4 99%) and methylene
chloride puriss (4 99.9%) were purchased from Fluka.
DMAPP Methanol (LiChrosolv quality) and n-pentane (4 99%)
OH
4
were purchased from Merck.
1
OPP 2 Geraniol

IPP Strains and plasmids

OH
OPP
GPP 3
Linalool
1
OPP
IPP
OPP
FPP
Sterols, dolichol, ubiquinone...
Fig. 1. Biosynthesis pathway of geraniol and linalool from primary
precursors dimethylallyl diphosphate (DMAPP) and isopentenyl dipho-
sphate (IPP). The indicated enzymes are: 1, farnesyl diphosphate
synthase (FPPS); 2, geraniol synthase (GES); 3, linalool synthase (LIS); 4,
geranyl diphosphate synthase (GPPS).
has been shown that they carry a specific mutation in the
ERG20 gene encoding FPPS (Blanchard & Karst, 1993). The
enzyme activity involved in GPP dephosphorylation has not
yet been identified. However, Faulkner et al. (1999) showed
that the LPP1 and DPP1 genes encoding diacylglycerol
phosphate phosphatases accept isoprenoid pyrophosphates
as substrates in vitro.
In aromatic plants, specific terpene synthases using GPP
as substrate have been isolated (Fig. 1), such as linalool
synthase (LIS) (Dudareva et al., 1996) and more recently
geraniol synthase (GES) (Iijima et al., 2004).
With the objective of specific monoterpenol production in
yeast, we overexpressed Clarkia breweri LIS and Ocimum
basilicum (sweet basil) GES in wild-type (WT) and mutant
strains to evaluate monoterpenol production levels in strains
with normal or defective FPP biosynthesis. The impact of
this production on the sterol pathway was also analysed.
Materials and methods
Chemicals
Linalool (97%) and geraniol (98%) were obtained from
Sigma, amorolfine was a gift from Hoffmann-La Roche,
The Saccharomyces cerevisiae strains, vectors and their origin
are listed in Table 1. Strain FY1679-28C was derived from
S. cerevisiae S288C (Thierry et al., 1995). Both CC25 and
5247 were derived from FL100 (ATCC 28383) (Chambon
et al., 1990; Soustre et al., 1996). MO56 and MO57 were
obtained from diploid strain Y21258 (EUROSCARF) bear-
ing a chromosomal ERG20 gene disruption respectively
complemented by a plasmid carrying the ERG20 or erg20-2
gene. Strains YCM30, YCM33, YCM45, YCM51 and YCM62,
isogenic to FL100, were kindly provided by Dr C. Marcireau
(Sanofi-Aventis, Vitry sur Seine, France).
Plasmid pMAGT was constructed by integrating the NotI-
PvuII fragment (yEGFP3 coding sequence with CYC1 termi-
nator but without ATG) from pGB7 (Sagot et al., 1999) in
the pNEV-N replicative vector (Sauer & Stolz, 1994), NotI-
SmaI-digested. The URA3 marker was disrupted by TRP1 by
homologous recombination.
GES-green fluorescent protein (GFP) and LIS-GFP
fusions were obtained as follows. Primers recGESfw (5 0 -
GAAAGAAAAAAAATATACCCCAGCGGCCGCATGCCTC
TAAGTTCAACTCC-3 0 ), recGESrv (5 0 -CCTGCAGCCCG
GGGGATCCACTAGTTTGAGTGAAGAAGAGGGCATC-3 0 )
and recLISfw (5 0 -GAAAGAAAAAAAATATACCCCAGCG
GCCGCATGCAGCTCATAACAAATTT-3 0 ), recLISrv (5 0 -
ATCCCTGCAGCCCGGGGGATCCACTAGTACTGAAACA-
TAGTTTGATGT-3 0 ) were designed to amplify the GES and
LIS coding sequences (including ATG but without stop
codon), respectively. Both PCR products, bordered by the
homologous sequences of the end of PMA1prom and the
start of yGFP3, were mixed with a pMAGT NotI opened
vector and used to transform FY1679-28C. Trp1 colonies
were selected, then fluorescent clones were isolated and the
integration was checked by sequencing.
To construct the pBS and pKS plasmids, WT and mutant
strains were used to amplify the ERG20 and erg20-2 genes
with the following primers: fwERG20 (5 0 -AAGGCTCGA-
GATGGCTTCAGAAAAAGAAATTAGG-3 0 ) and rvERG20
(5 0 -AAGGACGCGTCTATTTGCTTCTCTTGTAAACTTT
GT-3 0 ). Both PCR products were subcloned in pGEM-T
plasmid (Promega). These intermediate constructions were
digested with NotI and the ERG20 and erg20-2 genes were
inserted at the NotI site of pNEV-N to yield pBS and pKS,
respectively.
Strains MO56 and MO57 were obtained by transforma-
tion of Y21258 (Mat a/Mata, his 3D1/his 3D1, leu 2D0/leu

c 2006 Federation of European Microbiological Societies FEMS Yeast Res 7 (2007) 413–421
Published by Blackwell Publishing Ltd. All rights reserved
Monoterpenoid biosynthesis in Saccharomyces cerevisiae 415

Table 1. Yeast strains and plasmids

Strains and plasmids Characteristics Source
Strains
FY1679-28C MATa, ura3-52, trp1D63, leu2D1, his3D200 Thierry et al. (1995)
5247 MATa, ura 3-1, trp1-1 Soustre et al. (1996)
CC25 MATa, ura 3-1, trp1-1, erg 20-2, erg 12-2 Delourme et al. (1994)
MO56 MATa, his3D1, leu2D, ura3D0, trp1D63, erg20::kanMX4, [pBS] This study
MO57 MATa, his3D1, leu2D, ura3D0, trp1D63, erg20::kanMX4, [pKS] This study
YCM30 MATa, ura 3-1, trp1-1, pdr1D Marcireau C.
YCM33 MATa, ura 3-1, trp1-1, pdr5D Marcireau C.
YCM62 MATa, ura 3-1, trp1-1, snq2D Marcireau C.
YCM45 MATa, ura 3-1, trp1-1, pdr1D, pdr5D Marcireau C.
YCM51 MATa, ura 3-1, trp1-1, pdr1D, pdr5D, snq2D Marcireau C.
Plasmids
pNEV- N PMA1 expression cassette in 2 m-based vector, URA3 marker Sauer & Stolz (1994)
pMAGT pNEV-N, yEGFP3-CYC1term, TRP1 marker This study
pBS ERG20 in pNEV-N This study
pKS erg20-2 in pNEV-N This study
pMO5 GES-GFP in pMAGT This study
pMO6 LIS-GFP in pMAGT This study

2D0, lys 2D0/LYS 2, MET 15/met 15D0, ura 3D0/ura 3D0,
erg20 : : kan MX4/ERG20) with pBS and pKS, sporulation
and selection of haploid strains that were able to grow in the
presence of G418 at 200 mg mL1. Trp auxotropy was intro-
duced by crossing with FY1679-28C.
membrane was incubated for 2 h with alkaline phospha-
tase-conjugated goat antimouse IgG (Sigma) diluted
1 : 5000. Bound antibodies were detected by incubation of
the membrane in Fast Blue RR salt, 0.6 mM a-naphtyl
phosphate, 0.1 M Tris-HCl, pH 8.6.

Culture conditions Monoterpenoid analysis

Yeast cells were grown in a shaking incubator at 30 1C in
500-mL Erlenmeyer flasks containing 150 mL of liquid
minimum medium [1.7 g L1 Yeast Nitrogen Base (YNB,
Difco), 5 g L1 ammonium sulphate] supplemented with 1%
glucose as carbon source. Auxotrophic requirements were
supplied as required at 50 mg mL1.
Western blot analysis
Proteins were extracted from 50 mL yeast culture in expo-
nential growth phase. Cell pellets (5000 g, 5 min) were
crushed in 200 mL Tris-HCl 0.5 M, pH 6.8, by vortexing for
5 min with glass beads. Cell debris was eliminated by
centrifugation (12 000 g, 15 min) and protein concentration
was measured with the Bio-Rad ‘Protein Assay’ reagent
(Bradford). Laemmli was added to solubilize the proteins
and this preparation was boiled for 5 min. Proteins (40 mg)
were separated by electrophoresis on 10% sodium dodecyl
sulfate (SDS)-polyacrylamide gels and electrotransferred
onto nitrocellulose membrane. After transfer, the membrane
was soaked in 1  TBS buffer (Tris 100 mM, NaCl 140 mM,
pH 7.8) with 2% Tween 20 for 1 h. The nitrocellulose
membrane was then incubated for 2 h with mouse mono-
clonal anti-GFP antibodies (Roche) diluted 1 : 3000 in TBS
buffer. After several washings in the same buffer, the
The cells from a stationary phase culture were harvested by
centrifugation (5000 g for 5 min). The medium was adjusted
to pH 8.5 with KOH and eugenol (40 mg) was added to
evaluate extraction efficiency. The mixture (40 mL) was
passed trough a Bond Elut C18 (5 g) SPE cartridge (Varian)
conditioned with methanol (3  10 mL) and water
(3  10 mL). After washing with water (10 mL), terpenols
were eluted with methylene chloride (10 mL). The sample
was dried with anhydrous Na2SO4, concentrated to about
500 mL under a nitrogen stream, m-cresol (20 mg) was added
as internal standard and the sample was stored at  20 1C
prior to GC-MS analysis.
Extraction of intracellular monoterpenoids was per-
formed on the yeast pellet obtained after centrifugation.
Cells were crushed with glass beads in 1 mL of water and
after addition of eugenol (40 mg) the mixture was extracted
three times with n-pentane. Organic solvent extracts were
treated as described above.
Terpenol identification
Terpenol extracts were analysed by capillary GC-MS using a
Varian 3300 chromatograph equipped with on-column
injector coupled to an HP 5970 mass-selective detector in
electron ionization mode at 70 eV. Mass spectra were

FEMS Yeast Res 7 (2007) 413–421

c 2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
416
recorded by means of HP ChemStation version A.03.00 and
compared with those of reference compounds also used for
quantification. Separation of 1 mL of extract was carried out
on a 60-m, 0.32-mm ID, 0.5-mm DB-Wax (J&W Scientific)
capillary column using helium as carrier gas at a constant
pressure of 9 psi, 620 mbar. Separation conditions were:
initial injector temperature of 70 1C for 30 s, then increased
to 220 1C at 160 1C min1; oven temperature was pro-
grammed without initial hold time at a rate of 2.7 min1,
from 67 to 235 1C (hold for 5 min).
Total amounts of linalool, citronellol and geraniol were
determined using linear calibration curves with an R2 value
4 0.98 over the concentration range from 0 to 200 mg mL1.
Sterol analysis
Sterol extraction after saponification of lyophilized cells and
analysis were performed as previously described (Marcireau
et al., 1990). D-5,7 sterols (ergosterol and ergosta-5,7-
dienol) were quantified by measuring the UV absorbance at
281.5 nm (Servouse & Karst 1986). Sterol composition was
determined by GC (Trace GC, Thermo Electron equipped
with a on-column injector and a flame ionization detector)
under the following conditions (capillary column SPB5
Supelco 15 m, 0.32-mm ID, 0.25-mm film thickness, carrier
gas helium, 1.3 mL min1): 60 1C for 1 min, 30 1C min1 to
220 1C, 3 1C min1 to 290 1C, hold for 5 min. Cholesterol
was used as internal standard.
Confocal microscopy
Exponential phase yeast cells were grown in minimum
medium. Fluorescent cells were examined by confocal laser
scanning microscopy using a Zeiss LSM 510 equipped with a
Plan-Apochromat  63 oil objective. Data were processed
using LSM 5 IMAGE BROWSER software (Zeiss).
Results
Expression of GES and LIS in yeast
The ORFs of the two cDNAs were cloned in yeast replicative
vectors under the control of the strong yeast PMA1 promo-
ter and as a GFP fusion. Yeast strains FY1679-28C and 5247
were transformed with these plasmids. The latter carries a
gain-of-function pdr1-8 allele associated with multidrug
resistance to prevent possible monoterpenol toxicity. Wes-
tern blots of yeast cell extracts assayed with anti-GFP
antibodies showed that GES-GFP was strongly expressed in
WT and mutant strains in contrast to LIS-GFP which was
only barely detected (Fig. 2a). Confocal microscopy con-
firmed these results and showed that GES-GFP was mainly
localized in cytosol. LIS-GFP was detected in only about


c 2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
M. Oswald et al.
(a)
kDa
MW 1 2 3 4*
116
66
(b) 1 2
Fig. 2. Western blot analysis and localization of the GES-GFP and LIS-
GFP fusion proteins expressed in Saccharomyces cerevisiae. (a) Total
proteins (40 mg) extracted from FY1679-28C [pMO5] (lane 1), CC25
[pMO5] (lane 2), FY1679-28C [pMO6] (lane 3) and CC25 [pMO6] (lane 4)
were hybridized with anti-GFP monoclonal antibodies. (b) Subcellular
localization of the GES-GFP (1) and LIS-GFP (2) fusion proteins by
confocal microscopy. Cells (FY1679-28C) presented were chosen from
the most representative fluorescent cells. For strain CC25 [pMO6], only
about 10% of the cells were fluorescent and had the fluorescence
pattern shown.
10% of the cells, where it was present in small amounts
mainly in aggregated structures in the cytosol (Fig. 2b).
Monoterpenol production in WT yeast
Table 2 shows the level of geraniol and linalool excreted in
minimal medium by stationary growth phase cells. As
expected, no detectable terpenoid excretion was observed
for the two WT yeasts used as controls. By contrast,
expression of GES-GFP clearly gave rise to a significant
release of monoterpenoids. Strains 5247 and FY1679-28C
released about 500 mg L1 monoterpenoid alcohols in cul-
ture medium, corresponding to about 1 mg mg1 cell dry
weight. Geraniol and linalool were the major compounds
and only trace amounts of other terpenoids could be
detected by GC-MS.
These results clearly show that WT yeast cells contain free
GPP that can be used as a substrate by appropriate enzymes,
such as GES. The lack of monoterpenoid alcohol formation
in WT yeasts is therefore clearly linked to the absence of such
activity, and not to the lack of GPP availability.
By contrast, in strains expressing LIS, no terpenoid
formation could be detected. It is very likely that this was
caused both by the low amount of protein synthesized in
yeast and by the presence of the enzyme in aggregated
structures, as shown in (Fig. 2a and b). Consequently, for
FEMS Yeast Res 7 (2007) 413–421
Monoterpenoid biosynthesis in Saccharomyces cerevisiae 417

Table 2. Monoterpenoids produced by various WT strains bearing a plasmid expressing the GES gene. Terpenoids were extracted from minimal
medium at stationary growth phase. Data are mean values of three independent experiments
1 
Strain Geraniol [mg L1 OD1
600 nm mg (mg dry weight) ] Linalool [mg L1 OD1
600 nm mg L
1
(mg dry weight)1] Ratio (geraniol/linalool)
5247
/pMAGT ND ND ND ND –
/pMO5 559  145w 1.1  0.3 43  41 0.09  0.02 13/1
FY1679-28C
/pMAGT ND ND ND ND –
/pMO5 447  94 0.91  0.2 29  10 0.06  0.02 15/1

ND, not detected.

Assuming 490 mg cell dry weight L1 OD1
600 nm.
w
 confidence interval.

the remainder of the study we focused only on the effect Table 3. Monoterpenoids produced by WT and FPPS-defective yeast
of GES. strains bearing plasmids expressing the GES, ERG20 or erg20-2 genes.
Terpenoids were extracted from minimal medium at stationary growth
phase. Data are mean values of three independent experiments
Expression of GES in FPPS-defective yeasts Geraniol Linalool Ratio
In haploid yeast, FPPS is encoded by a single gene copy of Strain (mg L1 OD1
600 nm) (mg L
1
OD1
600 nm) (geraniol/linalool)

the essential ERG20 gene. Temperature-sensitive yeast mu- CC25

tant strains defective in FPPS have been isolated. They /pMAGT 70  17 47  12 3/2
/pMO5 920  256 60  39 15/1
exhibit an additional characteristic feature – the ability to
FY1679-28C
excrete geraniol and linalool (Chambon et al., 1991), as with
/pBS ND ND –
the WT yeast strains bearing GES described in our study. It /pBS, pMO5 447  159 17  33 26/1
has been shown that this property was directly linked to a /pKS ND ND –
K197 to E substitution (erg20-2) in FPPS (Blanchard & Karst, /pKS, pMO5 476  167 22  21 22/1
1993). Indeed, overexpression of the erg20-2 gene in a strain MO56
deleted for its chromosomal ERG20 copy led to geraniol /pMAGT ND ND –
/pMO5 797  69 96  143 19/1
excretion (Blanchard & Karst, 1993). The measurement of
MO57
FPPS activity in vitro showed that for E197 FPPS the reaction
/pMAGT 23  2 46  10 1/2
products were 25% FPP and 75% GPP instead of 75% FPP /pMO5 989  371 7  13 140/1
and 25% GPP for the WT enzyme. Therefore, the excess of
GPP produced by the defective FPPS is probably depho- ND, not detected.

sphorylated and excreted. However, the mechanism of

dephosphorylation has yet to be identified.
GES was then expressed in mutant strain CC25 bearing an
erg20-2 mutation in order to test if GPP dephosphorylation
is a limiting factor in geraniol formation. Table 3 (rows 1
and 2) shows a 10-fold increase of geraniol production in
the strain expressing GES-GFP, which confirms that GPP
dephosphorylation is indeed a limiting step in terpenoid
formation in yeast.
To increase terpenoid formation further, we overex-
pressed WT and E197 FPPS, in WT and ERG20-deleted
strains. WT FY1679-28C did not excrete terpenoids, regard-
less of the source of FPPS overexpressed (Table 3, rows 3 and
5). Coexpression of GES allowed excretion of monoterpe-
noids (Table 3, rows 4 and 6), but at a level not increased
compared with the WT strain (Table 2). By contrast, in
ERG20-deleted strains, overexpression of the ERG20 or
erg20-2 genes resulted in a roughly twofold increase in
terpenoid formation when GES was simultaneously ex-
pressed (Table 3, rows 8 and 10). It is noteworthy that FPPS
functions as a dimeric enzyme which can use either IPP and
DMAPP, or IPP and GPP as substrates. In our study, FPPS
can function either as a homodimer (Erg20p/Erg20p or
Erg20-2p/Erg20-2p) or as an heterodimer (Erg20p/Erg20-
2p). The Erg20-2p/Erg20-2p homodimer releases an in-
creased amount of GPP, whereas both Erg20p/Erg20p
homodimer and Erg20p/Erg20-2p heterodimer do not in-
crease the available GPP pool that is used for FPP synthesis.
Some of the observed differences could therefore be due to
the ratio of Erg20-2p/Erg20-2p homodimers vs. Erg20p/
Erg20p and Erg20p/Erg20-2p dimers.
However, the terpenoid level for ERG20-deleted strains
was similar to CC25 expressing GES-GFP. Thus, FPPS
activity is not the limiting factor in geraniol formation.
One possible explanation is that terpenoid synthesis may be
limited by the availability of IPP and DMAPP. In addition it

FEMS Yeast Res 7 (2007) 413–421

c2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
418
cannot be excluded that the GES activity is limiting, despite
a high level of protein observed in yeast.
Role of ATP binding cassette transporters on
geraniol excretion
Monoterpenoids are generally reported to be cytotoxic
compounds and have been used as antifungal drugs since
ancient times. A common mechanism underlying yeast
resistance to toxic compounds is the amplification of extru-
sion proteins belonging to the ATP binding cassette (ABC)
superfamily. It was of interest to ascertain whether these
transporters are also involved in geraniol excretion and/or
resistance. Indeed, the 25% higher amount of monoterpe-
nols produced in strain 5247 compared with FY1679-28C
(Table 2) could be linked to the pdr1-8 gain-of-function
allele known to direct a high level of resistance to cyclohex-
imide, oligomycine, ketoconazole or 4-NQO (Carvajal et al.,
1997). We investigated the effect of PDR1, PDR5 and SNQ2
gene deletions on strain sensitivity to exogenously added
geraniol. Pdr5p and Snq2p are well-known yeast ABC
transporters, whereas Pdr1p is a transcription activating
factor for PDR5, SNQ2 and YOR1. The results (Fig. 3)
showed that strains YCM62 bearing an SNQ2 deletion and
YCM45 and YCM51 carrying both PDR5 and PDR1 dele-
tions presented the highest sensitivity to exogenous supplied
geraniol. However, it is of note that the inhibitory concen-
tration was about 200 mg L1, which is more than 200-fold
higher that the concentrations obtained in growth medium
of strains carrying GES. Nevertheless, we determined mono-
terpenoid production in strains disrupted for PDR1, PDR5
and SNQ2. The results obtained (Table 4) were similar to
Strains Control Cycloheximide 10 µg mL−1
5247
YCM30
YCM33
YCM62
YCM45
YCM51
Geraniol 200 µg mL−1 Geraniol 250 µg mL−1
Fig. 3. Effect of inactivation of PDR1, PDR5 and SNQ2 genes on geraniol
sensitivity. Cells were serially diluted and 107–105 cells were sequentially
spotted on YNB supplemented with uracil and tryptophan. Results were
obtained after 60 h of incubation at 28 1C. Geraniol was added from a
20 mg mL1 ethanol stock solution.


c 2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
M. Oswald et al.
Table 4. Effect of pleiotropic drug transporters Pdr5p and Snq2p on
terpenoid excretion by yeast expressing GES. Data are mean values of
two independent experiments
Geraniol Linalool Ratio
Strain (mg L1 OD1
600 nm) (mg L1 OD1
600 nm) (geraniol/linalool)
YCM30 632  37 120  37 5:1
YCM33 517  58 35  12 15 : 1
YCM62 407  57 68  23 6:1
YCM45 570  20 19  9 30 : 1
YCM51 676  37 32  11 21 : 1
those obtained for WT strains. We also investigated geraniol
and linalool intracellular contents for 5247 and PDR mu-
tants carrying GES, but the amounts were below the resolu-
tion of the GC-MS system (data not shown). It is therefore
likely that the monoterpenols produced intracellularly are
excreted by single diffusion.
Effect of GES expression on ergosterol level
The ergosterol content of WT yeast is about 10 mg mg1 cell
dry weight. GES expression allowed about 1–2 mg mg1 cell
dry weight monoterpenoid production in addition to sterols
(Table 3). It could not be ruled out that in spite of a low
isoprenoid precursor loss, GPP metabolization in GES-GFP-
expressing cells could affect ergosterol biosynthesis. There-
fore, we checked the effect of GES-GFP on the sterol path-
way. Table 5 shows that in strain 5247 the level of ergosterol
decreased by c. 30% when GES was expressed. This was
associated with a dramatic change in the overall sterol
composition as ergosterol precursors such as ergosta-5,7
and lanosterol disappeared, probably as a consequence of
inhibition upstream from squalene synthesis. By contrast, in
strain FY 1679-28C the ergosterol level remained unchanged
and the sterol composition was only slightly modified. The
different behaviour of these two strains may be linked to
distinct genetic backgrounds (FL100- or S288C-derived
strains). Indeed, the ergosterol content and the sterol
composition of the control strains (Table 5, rows 1 and 3)
are not the same, which could explain a different response to
GPP formation.
To analyse further the effect of terpenoid production on
the sterol pathway we checked two inhibitors of sterol
biosynthesis in strain 5247, the FL100 derivative, which
showed an effect of GES-GFP expression on sterol composi-
tion. Simvastatin inhibited hydroxymethylglutaryl co-
enzyme A (HMG-CoA) reductase upstream of GPP synth-
esis and, as expected, strongly blocked both ergosterol and
terpenoid formation (Fig. 4). Amorolfine, an inhibitor of
sterol D8 ! D7-isomerase, acts downstream in the pathway.
At 0.3 mM in the growth medium, ergosterol formation was
strongly inhibited but no effect on terpenoid formation was
observed (data not shown). This last result showed that
FEMS Yeast Res 7 (2007) 413–421
Monoterpenoid biosynthesis in Saccharomyces cerevisiae 419

Table 5. Influence of GES over-expression on the sterol level in WT yeast. Sterols were extracted from lyophilized cells after growth in minimum
medium. Data are mean values of two independent experiments
Percentage of individual sterolsw
D-5,7 sterols
Strain [mg (mg dry weight)1] Squalene Zymosterol Ergosterol Ergosta-5,7 Lanosterol
5247
/pMAGT 7.2  1.1 1 14 62 17 7
/pMO5 4.7  0.7 ND 9 90 ND ND
FY1679-28C
/pMAGT 4.3  0.3 13 4 50 5 25
/pMO5 3.9  0.6 11 3 64 3 18
D-5,7 sterol content expressed as mg (mg dry weight)1 is determined by UV spectrum analysis.
w
Individual sterols (mean values) are determined by GC and expressed as a percentage of the total sterols.

Table 6. Effect of pH on GPP stability

Total terpenoid content 5.7 sterol level
Incubation Geraniol a-Terpineol Linalool
700 7
A pH 6 ND ND ND
µg terpenoids L−1 OD600−1

µg 5.7 sterols (mg DW)−1

600 6 pH 4 18% 5% 77%

B pH 6 100% ND ND
500 5
pH 4 42% ND 58%
400 4
ND, not detected.
300 3 Panel A: GPP (20 mg) was incubated for 36 h at 30 1C at pH 4 and 6 in
citrate/HCl buffer. After extraction by methylene chloride the organic
200 2
phase was analysed by GC-MS.
100 1 Panel B: the remaining aqueous phase was adjusted at pH 10 and
incubated in the presence of bovine alkaline phosphatase (110 U) for
0 0 15 h at 20 1C. Terpenoids were extracted and analysed as described
0 0.5 2
above.
µg mL−1 simvastatin

Fig. 4. Effect of simvastatin on terpenoid and sterol levels in strain 5247

[pMO5]. Cells were cultivated in minimal medium at 30 1C. Levels of 5–7
DPP1 gene expression is induced by Zn21 starvation (Han
sterols were determined by measuring the UV absorbance at 281.5 nm. et al., 2001). It was therefore of interest to see if Dpp1p is
also implicated in dephosphorylation of GPP in strains
geraniol formation cannot be further increased by blocking defective in FPPS such as CC25. DPP1 was overexpressed in
the synthesis of ergosterol, the end-product of the sterol WT and MO57 strains in place of GES. No significant
pathway in yeast. increase in terpenoid formation was observed. Zn21 starva-
tion was equally inefficient (data not shown). These results
strongly suggest that proteins other than Lpp1p and Dpp1p
Endogenous isoprenoid phosphatases in yeast
are involved in vivo in monoterpenoid formation.
Strains defective in FPPS such as CC25 exhibited a ratio of It is also noteworthy that allylic isoprenoid diphosphates
geraniol/linalool of about 3 : 2 (Table 3). GES expression are known to be unstable at acidic pH (Rittersdorf &
strongly and specifically increased geraniol level as the Cramer, 1967) and isomerization can be linked to a physi-
geraniol/linalool ratio increased to at least 15 : 1. This result cochemical process. In yeast, the low vacuolar pH (4–5)
is in good agreement with a specific synthesis of geraniol by environment generated by vacuolar H1 pumping ATPase is
GES; no farnesol or other sesquiterpenic alcohols could be essential for a number of cellular processes (Rashid et al.,
detected in our experiments. 2004). We observed that GPP incubated in vitro at pH 4 at
The natural formation of geraniol and linalool in strains 30 1C decomposes into 80% linalool, 19% geraniol and 1%
exhibiting a defect in FPP synthesis is of interest as it may be a-terpineol (Table 6). It is therefore possible that in strain
linked to an endogenous enzyme activity. Faulkner et al. CC25 the GPP dephosphorylation and isomerization took
(1999) reported that the LPP1 and DPP1 genes encode place in the vacuole. By contrast, in strains expressing GES-
diacylglycerol phosphate phosphatases with isoprenoid di- GFP in cytoplasm the GPP dephosphorylation catalysed by
phosphate phosphatase activity in vitro. Moreover, it was GES may have occurred in the cytoplasm at neutral pH, thus
shown that Dpp1p exhibits the highest activity and that mainly providing geraniol.

FEMS Yeast Res 7 (2007) 413–421

c2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
420
Discussion
To determine the availability of GPP for terpenoid produc-
tion in yeast, we expressed GES from Ocimum basilicum and
LIS from Clarkia breweri in fusion with GFP under control
of the strong PMA1 promoter.
No linalool or terpenoid formation was detected in vivo
with LIS, which could be linked to both a low level of
fluorescent cells and aggregated protein structures in the
cytosol.
By contrast, the expression of GES allowed strong mono-
terpenol excretion in the growth medium (500 mg L1). In
contrast to results for previously described mutants defec-
tive in FPPS, which excreted linalool and geraniol in
similar amounts, expression of GES leads to a specific
excretion of geraniol. This specificity of geraniol biosynth-
esis in GES-GFP-expressing cells was not further investi-
gated. It is possible that in FPPS-defective mutants, GPP is
concentrated in the vacuole at acidic pH where it is
spontaneously transformed into geraniol and linalool; on
the other hand, in strains expressing GES-GFP, localized in
cytoplasm at neutral pH, GPP is specifically metabolized to
geraniol.
The absence of an effect of amorolfine, a specific inhibitor
of ergosterol biosynthesis, on terpenoid formation shows
that ergosterol starvation does not up-regulate the sterol
pathway upstream in strain 5247, an FL100 derivative. We
showed, however, that GES expression in strain 5247 clearly
affects sterol biosynthesis. It is especially noteworthy that
this GES effect on sterol biosynthesis was not observed for
strain FY1679, an S288C derivative. The exact nature of the
difference of reaction between both strains remains un-
known. It may either be linked to a loss of GPP, no longer
available for ergosterol biosynthesis, or to a feedback effect
of geraniol produced by GES.
The potential role of known ABC multidrug transporters
in cell detoxication from geraniol was also investigated.
PDR1, PDR5 and SNQ2 are apparently not involved in
geraniol excretion, which could indicate that monoterpe-
noids diffuse freely from the cell, as has been shown for
short-chain alcohols.
The main finding from the present study is that in yeast,
GPP is not simply an intermediate metabolite of FPP
synthesis remaining tightly bound to the enzyme. Our data
indicate the presence of an intracellular pool of free GPP,
which opens the possibility of using yeast as an efficient and
flexible engineering tool for the production of monoter-
pene-derived compounds.
It is noteworthy that monoterpenoids were obtained in
our study in both WT and FPPS-defective mutant strains.
Moreover, the maximal level of geraniol was obtained in
FPPS-defective strains, confirming that in WT yeast, the
absence of monoterpenoid formation is linked to the


c 2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
M. Oswald et al.
absence of GES or a similar enzyme activity and not only to
the high specificity of FPPS for its GPP substrate.
This observation leads us to speculate that high enzyme
activity of specific terpene synthases in aromatic plants
could in a similar way shift part of the metabolic flux toward
monoterpenoid production.
Acknowledgements
We are grateful to Prof. Eran Pichersky and Dr Yoko Iijima
(University of Michigan, Ann Arbor, MI) for the kind gift of
GES and LIS cDNAs. We acknowledge Prof. Marc Bonneu
(University of Bordeaux II, France) for the pBG7 plasmid.
We thank Dr Jérôme Mutterer (IBMP CNRS, Strasbourg,
France) for assistance in confocal microscopy and Prof.
Thomas Bach (IBMP CNRS, Strasbourg, France) for help
in editing this manuscript. We thank Dr Christophe Marcir-
eau (Sanofi-Aventis, Vitry sur Seine, France) for the YCM
yeast strains carrying deletions in PDR genes. We thank the
excellent technical assistance of G. Riveill and P. Claudel
for terpenoid analysis and S. Meyer for pBS and pKS
constructions.
References
Blanchard L & Karst F (1993) Characterization of a lysine-to-
glutamic acid mutation in a conservative sequence of farnesyl
diphosphate synthase from Saccharomyces cerevisiae. Gene 125:
185–189.
Burlat V, Oudin A, Courtois M, Rideau M & St-Pierre B (2004)
Co-expression of three MEP pathway genes and geraniol 10-
hydroxylase in internal phloem parenchyma of Catharanthus
roseus implicates multicellular translocation of intermediates
during the biosynthesis of monoterpene indole alkaloids and
isoprenoid-derived primary metabolites. Plant J 38: 131–141.
Carnesecchi S, Schneider Y, Ceraline J, Duranton B, Gosse F,
Seiler N & Raul F (2001) Geraniol, a component of plant
essential oils, inhibits growth and polyamine biosynthesis in
human colon cancer cells. J Pharmacol Exp Ther 298: 197–200.
Carter OA, Peters RJ & Croteau R (2003) Monoterpene
biosynthesis pathway construction in Escherichia coli.
Phytochemistry 64: 425–433.
Carvajal E, Van den Hazel HB, Cybularz-Kolaczkowska A, Balzi E
& Goffeau A (1997) Molecular and phenotypic
characterization of yeast PDR1 mutants that show hyperactive
transcription of various ABC multidrug transporter genes. Mol
Gen Genet 256: 406–415.
Chambon C, Ladeveze V, Oulmouden A, Servouse M & Karst F
(1990) Isolation and properties of yeast mutants affected in
farnesyl diphosphate synthetase. Curr Genet 18: 41–46.
Chambon C, Ladeveze V, Servouse M, Blanchard L, Javelot C,
Vladescu B & Karst F (1991) Sterol pathway in yeast.
Identification and properties of mutant strains defective in
FEMS Yeast Res 7 (2007) 413–421
Monoterpenoid biosynthesis in Saccharomyces cerevisiae
mevalonate diphosphate decarboxylase and farnesyl
diphosphate synthetase. Lipids 26: 633–636.
Chotani G, Dodge T, Hsu A, Kumar M, LaDuca R, Trimbur D,
Weyler W & Sanford K (2000) The commercial production of
chemicals using pathway engineering. Biochim Biophys Acta
1543: 434–455.
Delourme D, Lacroute F & Karst F (1994) Cloning of an
Arabidopsis thaliana cDNA coding for farnesyl diphosphate
synthase by functional complementation in yeast. Plant Mol
Biol 26: 1867–1873.
Dudareva N, Cseke L, Blanc VM & Pichersky E (1996) Evolution
of floral scent in Clarkia: novel patterns of S-linalool synthase
gene expression in the C. breweri flower. Plant Cell 8:
1137–1148.
Faulkner A, Chen X, Rush J, Horazdovsky B, Waechter CJ,
Carman GM & Sternweis PC (1999) The LPP1 and DPP1 gene
products account for most of the isoprenoid phosphate
phosphatase activities in Saccharomyces cerevisiae. J Biol Chem
274: 14831–14837.
Han GS, Johnston CN, Chen X, Athenstaedt K, Daum G &
Carman GM (2001) Regulation of the Saccharomyces cerevisiae
DPP1-encoded diacylglycerol pyrophosphate phosphatase by
zinc. J Biol Chem 276: 10126–10133.
Hohl RJ (1996) Monoterpenes as regulators of malignant cell
proliferation. Adv Exp Med Biol 401: 137–146.
Iijima Y, Gang DR, Fridman E, Lewinsohn E & Pichersky E (2004)
Characterization of geraniol synthase from the peltate glands
of sweet basil. Plant Physiol 134: 370–379.
Lee S, Tsao R, Peterson C & Coats JR (1997) Insecticidal activity
of monoterpenoids to western corn rootworm (Coleoptera:
Chrysomelidae), twospotted spider mite (Acari:
Tetranychidae), and house fly (Diptera: Muscidae). J Econ
Entomol 90: 883–892.
Marcireau C, Guilloton M & Karst F (1990) In vivo effects of
fenpropimorph on the yeast Saccharomyces cerevisiae and
determination of the molecular basis of the antifungal
property. Antimicrob Agents Chemother 34: 989–993.
Martin VJ, Pitera DJ, Withers ST, Newman JD & Keasling JD
(2003) Engineering a mevalonate pathway in Escherichia
FEMS Yeast Res 7 (2007) 413–421
421
coli for production of terpenoids. Nat Biotechnol 21:
796–802.
Pattnaik S, Subramanyam VR, Bapaji M & Kole CR (1997)
Antibacterial and antifungal activity of aromatic constituents
of essential oils. Microbios 89: 39–46.
Rachid A, Brett CL, Mukherjee S & Rajini R (2004) Inhibition of
sodium/proton exchange by a Rab-GTPase-activating protein
regulates endosomal traffic in yeast. J Biol Chem 279:
4498–4506.
Rittersdorf W & Cramer F (1967) Die hydrolyse von 2,3
dihydroterpenylphosphaten und pyrophosphaten. Tetrahedron
23: 3023–3088.
Sagot I, Bonneu M, Balguerie A & Aigle M (1999) Imaging
fluorescence resonance energy transfer between two green
fluorescent proteins in living yeast. FEBS Lett 447: 53–57.
Sauer N & Stolz J (1994) SUC1 and SUC2: two sucrose
transporters from Arabidopsis thaliana; expression and
characterization in baker’s yeast and identification of the
histidine-tagged protein. Plant J 6: 67–77.
Servouse M & Karst F (1986) Regulation of early enzymes of
ergosterol biosynthesis in Saccharomyces cerevisiae. Biochem
J 240: 541–547.
Soustre I, Letourneux Y & Karst F (1996) Characterization of the
Saccharomyces cerevisiae RTA1 gene involved in 7-
aminocholesterol resistance. Curr Genet 30: 121–125.
Szczebara FM, Chandelier C, Villeret C et al. (2003) Total
biosynthesis of hydrocortisone from a simple carbon source in
yeast. Nat Biotechnol 21: 143–149.
Szkopinska A, Grabinska K, Delourme D, Karst F, Rytka J &
Palamarczyk G (1997) Polyprenol formation in the yeast
Saccharomyces cerevisiae: effect of farnesyl diphosphate
synthase overexpression. J Lipid Res 38: 962–968.
Thierry A, Gaillon L, Galibert F & Dujon B (1995) Construction
of a complete genomic library of Saccharomyces cerevisiae and
physical mapping of chromosome XI at 3.7 kb resolution. Yeast
11: 121–135.
Zheng GQ, Kenney PM & Lam LK (1992) Anethofuran, carvone,
and limonene: potential cancer chemopreventive agents from
dill weed oil and caraway oil. Planta Med 58: 338–341.


c 2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved