| |

Received: 16 April 2018    Revised: 18 September 2018    Accepted: 30 October 2018

DOI: 10.1111/anu.12865

ORIGINAL ARTICLE

Taurine alone or in combination with fish protein hydrolysate

affects growth performance, taurine transport and metabolism
in juvenile turbot (Scophthalmus maximus L.)

Yuliang Wei1 | Mengqing Liang1,2  | Houguo Xu1 | Keke Zheng1

1
Yellow Sea Fisheries Research
Institute, Chinese Academy of Fishery Abstract
Sciences, Qingdao, China The study was conducted to investigate the effects of taurine (Tau) alone or in com‐
2
Laboratory for Marine Fisheries Science
bination with fish protein hydrolysate (FPH) on growth performance, the expression
and Food Production Processes, Qingdao
National Laboratory for Marine Science and of Tau transporter (TauT) and metabolic profile in juvenile turbot. FM, FPH0, FPH0+T,
Technology, Qingdao, China
FPH10 and FPH10+T diets, respectively, contained 300, 150, 150, 80, and 80 g/kg
Correspondence fishmeal. FPH10 and FPH10+T diets contained 62 g/kg FPH. FPH0+T and FPH10+T
Mengqing Liang, Yellow Sea Fisheries
diets were, respectively, prepared by supplementing the FPH0 and FPH10 diet for‐
Research Institute, Chinese Academy of
Fishery Sciences, Qingdao, China. mulations with 8 g/kg Tau. Specific growth rate was the highest in FM group and the
Email: liangmq@ysfri.ac.cn
lowest in FPH10 group. TauT mRNA levels in fish fed Tau supplemented diets were
Funding information significantly lower than that in Tau unsupplemented diets. NMR‐based metabolomics
The Grant from Modern Agro‐industry
analysis showed that Tau contents in liver of FPH0+T and FPH10+T were significantly
Technology Research System, Grant/
Award Number: CARS-47-G15; National higher than that of FM, FPH0 and FPH10. In muscle, Tau contents were significantly
Natural Science Foundation of China, Grant/
decreased in the FPH10+T versus FPH0 and the FPH10+T versus FPH10 compari‐
Award Number: 31672663 and 31340076;
Central Public‐interest Scientific Institution sons. In conclusion, 62 g/kg FPH to replace fishmeal may not affect Tau synthesis,
Basal Research Fund, CAFS, Grant/Award
transport and metabolism. However, Tau supplemented alone or in combination with
Number: 2017GH08; Modern Agro‐industry
Technology Research System, Grant/Award a certain level of FPH could reduce the requirement for Tau synthesis and transport
Number: CARS-47-G15
and increased Tau levels in muscle and liver.

KEYWORDS
fish protein hydrolysate, growth performance, NMR‐based metabolomics, taurine, taurine
transporter, turbot

1 | I NTRO D U C TI O N
Fishmeal continues to be used as major protein source in aquafeeds
for both carnivorous and omnivorous fish species. Numerous stud‐
ies have been carried out to try to reduce dependence on fishmeal
(FAO, 2012). Plant proteins are considered to be the main fishmeal
substitutes in aquafeeds (Olsen & Hasan, 2012). However, plant pro‐
tein sources generally have several nutritional drawbacks compared
to fishmeal, such as the presence of antinutritional factors and un‐
balanced amino acid composition (Gatlin et al., 2007). In addition,
some nutrients may be mainly found in marine protein sources such
as fishmeal, but are almost non‐existent in plant proteins. For ex‐
ample, taurine (Tau) is rich in fishmeal and other marine protein
sources, while is deficient in plant proteins (Yamamoto, Akimoto,
Kishi, Unuma, & Akiyama, 1998). Many marine and some freshwa‐
ter fish require exogenous dietary Tau due to the limited ability of
Tau synthesis (El‐Sayed, 2014). Previous studies have established
that appropriate levels of Tau supplementation can improve growth
performance and feed utilization due to many important physiolog‐
ical functions, such as antioxidation, osmotic regulation, visual and

This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium,
provided the original work is properly cited.
© 2018 The Authors. Aquaculture Nutrition Published by John Wiley & Sons Ltd

396  |  wileyonlinelibrary.com/journal/anu

© 2018 John Wiley & Sons Ltd Aquaculture Nutrition. 2019;25:396–405.
WEI et al.
neural development and maintaining hepatic function (Salze & Davis,
2015). Thus, Tau has been considered as an essential nutrient for
many aquaculture species, including Japanese flounder (Paralichthys
olivaceus) (Han et al., 2014), Nile tilapia (Oreochromis niloticus) (Al‐
Feky, El‐Sayed, & Ezzat, 2016) and Senegalese sole (Solea senegalen-
sis) (Pinto et al., 2010).
Fish protein hydrolysate (FPH), which is generated from fish
by‐product, mainly contains a mixture of small peptides and free
amino acids (Chalamaiah, Hemalatha, & Jyothirmayi, 2012). In
aquafeeds, appropriate levels of FPH, especially small molecular
weight compounds obtained by ultrafiltered step, had a positive
effect on fish growth and feed utilization (Aksnes, Hope, Jönsson,
Björnsson, & Albrektsen, 2006; Wei, Liang, Mu, Zheng, & Xu,
2016; Zheng, Liang, Yao, Wang, & Chang, 2012). As various FPH
contained high levels of Tau, Tau is considered to be an important
small molecular weight compound in FPH, which can improve fish
growth (Kousoulaki et al., 2009; Liaset & Espe, 2008). However,
(Kousoulaki et al., 2012) reported that there was no significant
positive correlation between dietary Tau and growth when Atlantic
salmon (Salmo salar L.) were fed diets containing soluble fish pro‐
tein. Neither was a positive effect observed on the growth of those
fish when crystalline Tau and fish press cake (water‐soluble protein
was separated from the cooked herring) were added to a very low
fishmeal diet. Additionally, our previous study found that apparent
digestibility coefficient (ADC) of Tau in turbot (Scophthalmus max-
imus L.) fed diets containing FPH was lower than that in fish fed a
diet with no FPH (Wei, Liang, Zheng, & Wang, 2014), which implied
that there was another possibility that FPH may decrease the utili‐
zation of Tau. Obviously, the effect of Tau from FPH on fish growth
is still not clear due to different authors presenting inconsistent
results. Additionally, dietary Tau in the above studies mainly came
from marine protein sources, such as fishmeal and FPH, rather than
exogenous Tau supplementation. For some carnivorous fish, di‐
etary Tau content may be insufficient, even in fishmeal‐based diet
(Khaoian, Nguyen, Ogita, Fukada, & Masumoto, 2014). Intracellular
Tau in tissues is mainly regulated by Tau biosynthetic enzymes and
Tau transporter (TauT) (Tappaz, 2004). Previous studies found that
Tau was an essential nutrient for turbot due to a low capacity to
synthesize Tau (Wang et al., 2014). Based on the above, it is nec‐
essary to study whether Tau transport of turbot was affected by
supplementing exogenous Tau in FPH diet.
Metabolomics is used to assess metabolic responses to nutri‐
tional deficiencies or excesses and provides understanding of un‐
derlying metabolic mechanisms in farmed animal (Alfaro & Young,
2018). 1H nuclear magnetic resonance spectroscopy (1H NMR) is an
ideal approach for untargeted and targeted metabolite profiling (Wu,
Southam, Hines, & Viant, 2008). NMR‐based metabolomics makes it
possible to find unexpected metabolic changes in fish tissues due to
nutritional interventions. Thus, this approach gives us a chance to
explore the metabolite profiles of Tau in order to complement anal‐
ysis of molecular responses.
The aim of the present study was to investigate the effect of
Tau alone or in combination with FPH on growth performance,
|
      397
cysteine dioxygenase (CDO) activity, the expression of TauT and
metabolite profiles of Tau in juvenile turbot fed plant protein‐
based diets.
2 | M ATE R I A L S A N D M E TH O DS
2.1 | Diet preparation
FPH was produced from by‐products of Pollock (Theragra chalco-
gramma) by enzymatic treatment and then refined by filtration with
a 1,000 Da filter (Zheng et al., 2012). Five diets were formulated
to contain 510 g/kg crude protein and 110 g/kg lipid. Higher fish‐
meal diet (FM diet) was used as the control diet containing 300 g/
kg f­ishmeal. Lower fishmeal diet (FPH0 diet) contained 150 g/kg
fishmeal. Based on previous studies on the optimal dietary require‐
ments of FPH in turbot diets, FPH10 diet was formulated to replace
70 g/kg of the fishmeal in the FPH0 diet with 62 g/kg FPH (Wei et
al., 2016). FPH0+T and FPH10+T diets were, respectively, prepared
by supplementing the FPH0 and FPH10 diet formulations with 8 g/
kg Tau (based on the Tau requirement of turbot) (Qi et al., 2012). The
formulation, Tau content and amino acid composition of experimen‐
tal diets are, respectively, shown in Tables 1 and 2.
2.2 | Fish and experimental conditions
The feeding trial was conducted at Yantai Tianyuan Aquatic Product
Co., Ltd. (Shandong, China). Juvenile turbot female half‐sib families
were fed a commercial feed containing 520 g/kg crude protein,
80 g/kg crude lipid for 2 weeks to acclimate to the culture system.
At the start of the trial, the fish were fasted for 24 h and weighed.
Twenty‐five juvenile turbot (4.16 ± 0.01 g) were stocked into each
of 20 cylindrical fibreglass tanks (water volume 120L) and randomly
assigned one of the five experimental diets for four replicate tanks
per dietary treatment. Sea water was taken from a depth of 50 m
below the sea surface and supplied to the tanks at a rate of 2 L/min,
with continuous aeration. During the whole experimental period,
water temperature ranged from 14 to 16℃, pH from 7.5 to 8.0, the
salinity was approximately 32‰, and dissolved oxygen was above
7 mg/L. Daylight followed natural changes (from July to September
2016) during the trial. During the 84 days of feeding period, fish
were hand‐fed to apparent satiation twice a day (06:30 and 16:30).
2.3 | Sample collection
At the start of the experiment, the initial sample of 15 fish was ran‐
domly collected and stored at −20℃ for the determination of whole
body composition. After the feeding trial, the fish were anaes‐
thetized with an overdose of tricaine methanesulphonate (1 g/L;
Argent, Redmond, WA, USA) before sampling. The fish in each tank
were individually weighed and counted after 24‐hr fasting. Three
fish from each tank were randomly sampled for analyses of whole‐
body chemical composition, and brain, eye and liver samples were
 |
398       WEI et al.

TA B L E 1   Formulation and chemical

Diets
composition of experimental diets
Ingredients (g/kg) FM FPH0+T FPH10+T FPH0 FPH10

Fishmeal 300 150 80 150 80

Soybean meal 160 240 240 240 240
Corn protein 80 120 120 120 120
Wheat gluten meal 120 180 180 180 180
Fish protein hydrolysatea 62 62
Wheatmeal 165 115 118 123 126
Fish oil 75 87 92 87 92
Soybean lecithin 10 10 10 10 10
Vitamin premixb 15 15 15 15 15
Mineral premixc 15 15 15 15 15
Choline chloride 20 20 20 20 20
CaH2PO 4 20 20 20 20 20
Vitamin C 5 5 5 5 5
L‐lysine 8 8 8 8 8
D/L‐methionine 4 4 4 4 4
L‐arginine 3 3 3 3 3
Taurine 8 8
Proximate analysis by dry diets
Taurine 2.8 8.9 9.0 1.6 1.7
Dry matter 891.8 896.9 899.4 893.6 896.9
Crude protein 515.5 516.4 518.8 518.1 522.4
Crude lipid 110.1 106.1 108.0 105.6 107.5
Ash 91.6 73.3 71.1 72.4 70.0
a
Molecular weight distribution of fish protein hydrolysate (797.1 g/kg crude protein; 0.44 g/kg
crude lipid): 10,000–5,000 Da: <0.2; 5,000–2000 Da: <1.14; 2000–1,000 Da: 5.21; 1,000–500 Da:
21.34; 500–200 Da: 56.64; 200–100 Da: 3.66; <100 Da: 11.82.). bVitamin mixture (IU or mg/kg
diet): vitamin E (α‐tocopherol) 15,200 IU, biotin 158 mg, B12 4 mg, folic acid 2,200 mg, inositol
52,800 mg, niacin 29,500 mg, D‐pantothenic acid 141,000 mg, riboflavin 7,040 mg, thiamine
5,720 mg. cMineral mixture (mg or g/kg diet): KI, 0.8 mg; CoCl2·H2O (10 g/kg), 50 mg; CuSO 4.5H2O,
10 mg; FeSO 4·H2O, 80 mg; ZnSO 4·H2O, 50 mg; MnSO 4·H2O, 60 mg; MgSO 4.7H2O, 1,200 mg;
Ca(H2PO3)2· H2O, 3,000 mg; NaCl, 100 mg; NaF, 2 mg; Zoelite, 15.54 g.

frozen in liquid nitrogen for TauT relative expressions and CDO ac‐
tivity analyses. Liver, spleen, stomach, midgut, heart, head kidney,
gills, eye, skin, muscle and brain from four fish were collected for
analyses of tissue distribution of TauT expression. Then, four fish
from each tank were collected at 5 hr after refeeding. Whole liver
and muscle (the same position of back muscle) tissues were sampled
and frozen in liquid nitrogen for metabolomics analyses. All the sam‐
pled tissues were stored at −80℃ until subsequent analysis.
drying the samples to constant weight at 105℃. Crude protein
(N × 6.25) was determined by the Kjeldahl method (UDK142 au‐
tomatic distillation unit, VELP, Usmate, MB, Italy). Crude lipid
content was measured gravimetrically following petroleum
ether extraction using Soxhlet method (Foss Tecator, Hoganas,
Sweden). Ash was examined by incinerating in a muffle furnace
at 550℃ for 16 hr.

2.4.2 | Amino acid and Tau determination

2.4 | Chemical analysis
2.4.1 | Proximate composition of whole
body and diets
The chemical composition of the diets and fish samples was
analysed using standard methods. Moisture was determined by
The samples were freeze‐dried with a vacuum freeze‐drier
(FDU‐1100, EYELA, Tokyo, Japan) and then hydrolysed in 6 N HCl
for 22–24 hr at 110℃. Amino acid and Tau composition of experi‐
mental diets were determined using an amino acid analyser (auto‐
matic amino acid analyser; Hitachi High‐Technologies Corporation,
Tokyo, Japan).
WEI et al. |
      399

TA B L E 2   Amino acid composition of

Diets
experimental diets (g/kg dietary dry
matter) Amino acids FM FPH0+T FPH10+T FPH0 FPH10

EAA
Threonine 15.9 14.0 14.6 15.4 15.2
Valine 19.0 19.0 19.9 19.3 19.1
Methionine 11.5 9.9 10.5 10.0 10.1
Isoleucine 17.8 17.5 17.8 18.0 17.2
Leucine 37.3 38.8 39.3 38.7 38.8
Phenylalanine 37.5 38.0 37.7 33.8 36.5
Lysine 30.8 27.1 26.6 25.9 26.0
Histidine 12.5 13.1 11.3 11.4 10.5
Arginine 21.5 21.5 21.5 21.6 21.2
NEAA
Aspartic acid 32.1 27.5 29.5 29.9 30.2
Serine 19.2 18.6 19.6 20.7 20.9
Glutamic acid 98.9 104.6 110.5 113.0 114.9
Glycine 20.2 17.0 17.3 18.2 18.0
Alanine 23.8 21.2 21.5 22.5 22.5
Cysteine 4.3 5.4 5.4 5.3 5.4
Tyrosine 15.8 15.9 16.5 17.7 15.5

Note. EAA: essential amino acids; NEAA: non‐essential amino acids.

Essential DNA Green Master (Roche Applied Science, Mannheim,

2.4.3 | CDO activity determination
Liver CDO activity was measured by the method of (Goto,
Matsumoto, & Takagi, 2001). Enzymatic assays were conducted
in a total volume of 1.0 ml containing 4 mM 2‐mercaptoethanol,
0.2 mM pyridoxal 5′‐phosphate, 1.0 mM cysteinesulfinate, 0.4–
1.0 mg protein of the crude enzyme solution and phosphate buffer
(100 mM, pH 7.2). Total protein concentration in liver tissue ho‐
mogenates was measured by the method of (Bradford, 1976) using
a protein assay kit (Nanjing Jiancheng Bioengineering Institute,
Jiangsu, China). Enzyme activity was defined as nmol Tau per min‐
ute per milligram of protein.
Germany). The primers (TauT‐F: 5′‐TTGTGCTGTTGATTCGT‐
GGTG‐3′ and TauT‐R: 5′‐AGGCAAATGGCATAGGAGAAG‐3′;
β‐actin‐F: 5′‐CCA‐AAGCCAACAGGGAGAA‐3′ and β‐actin‐R:
5′‐AGAGGCATACAGGGACAGCA‐CA‐3′, respectively) were de‐
signed based on the previously cloned sequence for TauT (GenBank
accession no: KT369001.1) and β‐actin (GenBank accession no:
AY008305) in Scophthalmus maximus L. Target gene expression
was normalized to β‐actin expression. The comparative CT method
(2‐ΔΔC T method) was used to analyse the relative expression levels
of TauT after verification that the primers were amplified with an
efficiency of approximately 100% (Livak & Schmittgen, 2001).

2.4.4 | Real‐time quantitative PCR analysis of 2.4.5 | 1H NMR‐based metabolomics analysis of

TauT expression
For analysis of tissue distribution of TauT expression, total
RNA was extracted from liver, spleen, stomach, midgut, heart,
head kidney, gills, eye, skin, muscle and brain. Then, brain and
eye samples from fish fed different diets were chosen for ana‐
lysing TauT gene expression based on TauT expression in differ‐
ent tissues of turbot in the present study. RNA was isolated using
RNAiso plus kit (Takara Bio Inc., Otsu, Shiga, Japan). Following
reverse transcription into cDNA with the Transcriptor First
Strand cDNA Synthesis Kit (Roche Applied Sciences, Mannheim,
Germany), real‐time PCR was performed on Master cycle rep
realplex (Eppendorf AG, Hamburg, Germany) using Fast Start
liver and muscle tissues
Fish liver and muscle samples were extracted using the solvent sys‐
tem of methanol/water/chloroform by a modification of the method
as previously reported (Wu et al., 2008). Metabolite extracts of liver
and muscle tissues were analysed on a Bruker AV 500 NMR spec‐
trometer performed at 500.18 MHz (at 298 K) as described previ‐
ously (Liu et al., 2011) (Evaluation version, Chenomx Inc., Edmonton,
Alberta, Canada). All the treatments consisted of 10 replicates from
liver and muscle, respectively.
The 1H NMR‐free induction decay signals were imported into
the Chenomx NMR Suite v.8.0 (Chenomx Inc., Edmonton, Canada).
The chemical shifts of NMR spectra were referenced to the TSP at
400       | WEI et al.

0.00 ppm. The spectral regions of water (4.7–4.9 ppm) and methanol
(3.355–3.365 ppm) in liver tissue as well as water (4.7–4.85 ppm) and
methanol (3.350–3.365 ppm) in muscle tissue were removed from all
spectra. The total spectral area of the remaining bins was normalized
and exported to excel file for partial least squares discriminant anal‐
ysis (PLS‐DA). Metabolites of liver and muscle tissues were identi‐
fied based on the tabulated chemical shifts (Fan, 1996) by using the
software, Chenomx.
2.5 | Statistical analysis
2.5.1 | One‐way analysis of variance
on variable importance in projection (VIP) values in PLS‐DA model.
Those variables with VIP value >1.0 were considered to have con‐
tributed significantly to the separation (Jia et al., 2013).
3 | R E S U LT S
3.1 | Growth performance and feed utilization
Survival rate (SR) was above 95% and not significantly affected by di‐
etary treatments (p > 0.05). Fish fed FM diet had significantly higher
SGR than that of FPH10+T, FPH0 and FPH10 diets (p < 0.05), but
no significant differences were observed compared to FPH0+T diet
(p > 0.05). Feed intake (FI) in fish fed FPH10 diet was significantly

The results of the growth, feed utilization and Tau contents of differ‐ higher than that of the FM diet (p < 0.05). Fish fed FM diet had signif‐

ent tissues are presented as mean ± SE of four replicate groups. Data icantly higher feed efficiency ratio (FER) and protein efficiency ratio

were checked for homogeneity of variances by Levene’s test. The (PER) than that of FPH10+T and FPH10 diets (p < 0.05), nor between

data of the growth, feed utilization, liver CDO activity, Tau contents FPH10 and FPH10+T treatments (p > 0.05). Protein productive value

of different tissues and relative expressions of TauT gene were ana‐ (PPV) in FM and FPH0+T treatments was significantly higher than

lysed using one‐way analysis of variance (One‐way ANOVA) test fol‐ that of fish fed FPH10+T and FPH10 diets (p < 0.05) (Table 3).

lowed by a Tukey’s multiple comparison test. The differences among

treatments were considered to be statistically significant at p ≤ 0.05.
The software SPSS 16.0 (SPSS Company, Chicago, IL, USA) for win‐
dows was used to compute statistical analyses.
2.5.2 | Multivariate statistical analysis
The data in the profile of liver and muscle metabolites were ana‐
lysed using PLS‐DA to obtain the corresponding score plots and
loading plots. Similarities and differences among the data sets were
shown in score plots and corresponding loading plots. The R2 in the
permutated plot described how well the data fit the derived model,
whereas Q2 described the predictive ability of the derived model and
2 2
provided a measure of the model quality. If the value of R or Q was
>0.5, the model was regarded as a reliable model. The variables re‐
sponsible for classification of the two groups were identified based
3.2 | Liver CDO activity
Significantly lower CDO activity was observed in fish fed Tau sup‐
plemented diets (FPH0+T and FPH10+T) compared with fish fed Tau
unsupplemented diets (FPH0 and FPH10) and the control diet (FM)
(p < 0.05). No significant difference was detected in liver CDO activ‐
ity among FM, FPH0 and FPH10 treatments and between FPH0+T
and FPH10+T treatments (p > 0.05) (Figure 1).
3.3 | Tau contents from eye and brain tissues
Fish fed Tau supplemented diets had higher Tau levels in eye and
brain tissues than that of control diet (FM diet). On the contrary,
Tau contents were lower in fish fed no added Tau diets (FPH0 and
FPH10) compared to fish fed FM diet (p < 0.05) (Table 4).

TA B L E 3   Growth performance and feed utilization of juvenile turbot fed different diets (mean ± SE)a

Diets

FM FPH0+T FPH10+T FPH0 FPH10

b
IBW (g) 4.17 ± 0.01 4.17 ± 0.01 4.16 ± 0.01 4.16 ± 0.01 4.16 ± 0.01
FBW (g)c 39.81 ± 1.71a 35.99 ± 1.66ab 30.71 ± 0.71bc 30.43 ± 0.91bc 28.23 ± 2.29c
SR (%)d 99.00 ± 1.00 99.00 ± 1.00 99.00 ± 1.00 100.00 99.00 ± 1.00
−1 e a ab bc bc
SGR (% day ) 2.68 ± 0.05 2.56 ± 0.05 2.38 ± 0.03 2.37 ± 0.04 2.27 ± 0.09c
−1 f b ab ab ab
FI (% day ) 1.28 ± 0.02 1.32 ± 0.02 1.35 ± 0.01 1.29 ± 0.02 1.36 ± 0.01a
FER g 1.51 ± 0.03a 1.43 ± 0.03ab 1.34 ± 0.01b 1.41 ± 0.04ab 1.29 ± 0.04b
h a ab bc abc
PER 2.61 ± 0.05 2.48 ± 0.06 2.32 ± 0.02 2.43 ± 0.06 2.22 ± 0.07c
PPV i 0.42 ± 0.01a 0.38 ± 0.01b 0.34 ± 0.00 c 0.36 ± 0.01bc 0.33 ± 0.01c
a b c
Values in the same row followed by different superscript letters are significantly different (p < 0.05). IBW; initial body weight. FBW; final body
weight. dSR; survival rate = 100 × (final fish number/initial fish number). eSGR; specific growth ratio = 100 × [ln (final weight) ‐ ln (initial weight)]/feed‐
ing days. fFI; feed intake = 100 × total feed intake/[feeding days × (final weight + initial weight)/2]. gFER; feed efficiency ratio = body weight gain/dry
feed intake. hPER; protein efficiency ratio = (final weight ‐ initial weight)/protein intake. iPPV; protein productive value = (final protein content ‐ initial
protein content)/protein intake.
WEI et al. |
      401

7.0

CDO activity (nmol–1 min–1 mg–1 protein)

6.0 a
a
a
5.0 b
b
4.0

3.0

2.0

1.0

0.0
FM FPH0+T FPH10+T FPH0 FPH10

F I G U R E 1   Cysteine dioxygenase (CDO, nmol/min/mg protein) activity in liver from juvenile turbot fed different diets. Data are presented
as mean ± SE (n = 4). Bars of with same letters are not significantly different by Tukey's test (p > 0.05)

TA B L E 4   Taurine contents (g/kg

FM FPH0+T FPH10+T FPH0 FPH10
dietary dry matter) (mean ± SE) from eye
bc ab a bc
and brain tissues of juvenile turbot fed Eye 15.1 ± 2.1 17.7 ± 0.4 21.2 ± 1.1 13.3 ± 0.6 12.0 ± 1.0 c
five experimental dietsa Brain 12.4 ± 0.4b 16.8 ± 0.4a 16.9 ± 0.4a 5.3 ± 0.4c 6.1 ± 0.4c
a
Values in the same row followed by different superscript letters are significantly different (p < 0.05).

20
a a
18
ab
16
TauT relative expression

14
12 abc abc
10 abc
8
6 bc bc
bc
4
F I G U R E 2   Taurine transporter (TauT) c
expression in different tissues of juvenile 2 c
turbot. Data are presented as mean ± SE 0
(n = 4). Bars of with same letters are not
significantly different by Tukey's test
(p > 0.05)

compared with that in fish fed the control diet and no added Tau
3.4 | Relative expressions of TauT gene
diets (Figure 3).
The relative expression levels of TauT mRNA were detected in liver,
spleen, stomach, midgut, heart, head kidney, gills, eye, skin, muscle
3.5 | 1H NMR metabolomics analysis of
and brain. The highest expression levels of TauT were found in brain
liver and muscle
and eye, and the lowest expression of TauT was detected in gill and
skin (Figure 2). PLS‐DA score plot, loading plot and VIP plot were used to obtain
The relative expression levels of TauT mRNA in the eye from a reliable model and identify significant metabolite variations in
fish fed FPH0 and FPH10 diets were significantly higher com‐ liver tissues between two groups. PLS‐DA models were conducted
pared with those fed FM, FPH0+T and FPH10+T diets (p < 0.05), on spectral data in liver tissues generated from the pairwise com‐
while there was no significant difference in TauT expression parison of all diets. A reliable and clear model was set up between
from eye tissue between FPH0 and FPH10 diets and among FM, FM and FPH0 groups (R2 = 0.698, Q2 = 0.574), between FM and
FPH0+T and FPH10+T diets (p > 0.05). For the brain, TauT mRNA FPH10+T groups (R2 = 0.814, Q2 = 0.768), between FPH0+T and
expression levels in fish fed supplemented Tau diets were lower FPH0 groups (R2 = 0.872, Q2 = 0.844), between FPH0+T and FPH10
 402       | WEI et al.

1.8 Eye
a a
1.6
TauT relative expression

1.4
1.2 b
b b
1.0
0.8
0.6
0.4
0.2
0.0
FM FPH0+T FPH10+T FPH0 FPH10
Diets

1.4 Brain
a
1.2 a
ab
TauT relative expression

1.0
ab
0.8
b
0.6

0.4 F I G U R E 3   Relative mRNA expression

of taurine transporter (TauT) in eye and
0.2 brain of turbot fed different diets. Data
are presented as mean ± SE from four
0.0 replicate tanks. Bars of with same letters
FM FPH0+T FPH10+T FPH0 FPH10 are not significantly different by Tukey's
Diets test (p > 0.05)

TA B L E 5   The significant metabolite variations in liver and muscle obtained by the pairwise comparison of dietsa

Taurine Alanine Choline Creatine Glycine Lactate TMAO

Liver
FM versus FPH10+T ↑ ↓ ↓
FM versus FPH0 ↓ ↓ ↑
FPH0+T versus FPH0 ↓ ↑ ↑
FPH0+T versus FPH10 ↓ ↑ ↑
FPH10+T versus FPH0 ↓ ↑ ↑
FPH10+T versus FPH10 ↓ ↑ ↑
Muscle
FM versus FPH0+T ↑ ↓ ↓ ↓ ↑
FM versus FPH10+T ↑ ↓ ↓ ↓ ↑
FM versus FPH0 ↓ ↓ ↓ ↓ ↓
FM versus FPH10 ↓ ↓ ↓ ↓ ↑
FPH0+T versus FPH0 ↓ ↑ ↑ ↓ ↓
FPH0+T versus FPH10 ↓ ↑ – ↓ ↑
FPH10+T versus FPH0 ↓ ↑ ↑ ↑ ↓
FPH10+T versus FPH10 ↓ ↑ ↑ ↓ ↓
FPH0 versus FPH10 – ↓ – ↓ ↑
FPH0+T versus FPH10+T – ↓ – ↓ ↑
a
Arrows indicate whether the respective metabolite is more abundant (↑) or less abundant (↓) in the second treatment in the comparison than in the
first in the organ of interest.
WEI et al.
groups (R2 = 0.818, Q2 = 0.767), between FPH10+T and FPH0 groups
2 2
(R  = 0.971, Q  = 0.965) and between FPH10+T and FPH10 groups
(R2 = 0.915, Q2 = 0.900). The NMR‐based metabolomics analysis of
liver showed an influence of the diets on some metabolites, that
is, Tau, alanine and choline (Table 5). Tau and choline levels had an
opposite trend in any two groups (FM versus FPH10+T, FM ver‐
sus FPH0, FPH0+T versus FPH0, FPH0+T versus FPH10, FPH10+T
versus FPH0, FPH10+T versus FPH10). The alanine content was
significantly increased in the FPH0+T versus FPH0, the FPH0+T
versusFPH10, the FPH10+T versus FPH0 and the FPH10+T versus
FPH10 comparisons and significantly decreased in the FM versus
FPH10+T and the FM versus FPH0 comparisons.
The data analyses and comparison of muscle tissues in any two
groups were analogous to those performed in liver tissues. A re‐
liable and clear model was set up between FM and FPH0 groups
(R2 = 0.716, Q2 = 0.578), between FM and FPH0+T groups (R2 = 0.989,
Q2 = 0.986), between FM and FPH10 groups (R2 = 0.958, Q2 = 0.946),
2 2
between FM and FPH10+T groups (R  = 0.977, Q  = 0.972), between
FPH0+T and FPH0 groups (R2 = 0.989, Q2 = 0.986), between FPH0+T
and FPH10 groups (R2 = 0.975, Q2 = 0.968), between FPH0+T and
FPH10+T groups (R2 = 0.969, Q2 = 0.962), between FPH0 and FPH10
2 2
groups (R  = 0.959, Q  = 0.947), between FPH10+T and FPH0 groups
(R2 = 0.981, Q2 = 0.977) and between FPH10+T and FPH10 groups
(R2 = 0.962, Q2 = 0.949). The NMR‐based metabolomics analysis of
muscle showed an effect of the diets on some metabolites, that is,
Tau, creatine, glycine, lactate and trimethylamine N‐oxide (TMAO)
(Table 5). The Tau level was significantly increased in the FM versus
FPH0+T and the FM versus FPH10+T comparisons and decreased
in the FM versus FPH0, the FM versus FPH10, the FPH0+T versus
FPH0, the FPH0+T versus FPH10, the FPH10+T versus FPH0 and the
FPH10+T versus FPH10 comparisons. For the FPH0 versus FPH10 and
the FPH0+T versus FPH10+T comparisons, the Tau and glycine levels
were not significantly different, while the creatine and lactate levels
were significantly decreased and the TMAO level was significantly
increased. The creatine level in fish fed supplemented Tau diets was
significantly higher than that of fish fed unsupplemented Tau diets.
4 | D I S CU S S I O N
Previous study found that optimal Tau supplementation in diets
improved turbot growth and feed utilization (Qi et al., 2012). In the
current study, supplementary Tau in the feed was based on the Tau
requirement of turbot reported by (Qi et al., 2012). Although ­fishmeal
content in FM diet was 150 g/kg higher than that in FPH0+T diet,
the SGR, the FER and the PER in FM diet were not significantly dif‐
ferent compared with that of FPH0+T treatment (Table 3). For the
two experimental diets, Tau concentration in FPH0+T diet (8.9 g/kg)
was 3.2‐fold higher compared with that of FM diet (2.8 g/kg). It was
speculated that Tau may be a positive effect on the growth and feed
utilization of juvenile turbot. However, it is puzzling that no signifi‐
cant difference was observed in growth between FPH0 and FPH0+T
treatments, even though the Tau level in FPH0+T diet supplemented
|
      403
with Tau was 5.6‐fold higher than that of FPH0 diet (1.6 g/kg), and
a similar trend had been observed between FPH10+T and FPH10
treatments. (El‐Sayed, 2014) reported that the response of fish to di‐
etary Tau is affected by fish size. A previous study on turbot showed
that 6.3 g turbot fed casein‐based diets required higher dietary Tau
(11.5 g/kg) for maximum growth, whereas larger fish (165.9 g) re‐
quired only 6.4 g/kg Tau (Qi et al., 2012). Thus, one possible reason
for inconsistent results is that 9 g/kg Tau in diets supplemented with
Tau may still not meet the optimal requirement of 4.3 g juvenile tur‐
bot for maximum growth and feed utilization in current experiment.
The other explanation is that a small amount of Tau may have been
synthesized to be used for the physiological needs of turbot fed diets
devoid of Tau (Wang et al., 2014). This may be supported by the fact
that CDO activity (the key enzyme of Tau biosynthesis) in liver from
juvenile turbot fed diet supplemented without Tau was significantly
higher than that in fish fed diet supplemented with Tau (Figure 1).
For FPH studies, it has previously been found that FPH had a
potential to replace part of fishmeal in aquafeed without a negative
effect on the growth performance of major cultured fish, including
turbot (Wei et al., 2016), Japanese flounder (Zheng et al., 2012),
Atlantic salmon (Bell et al., 2016), rainbow trout (Oncorhynchus my-
kiss) (Aksnes et al., 2006) and olive flounder (Khosravi et al., 2015).
In present experiment, similar results were found that there were
no significant differences in fish growth between FPH0 and FPH10
groups and between FPH0+T and FPH10+T groups when fishmeal
was replaced by FPH (Table 3). Both taurine and FPH were water‐
soluble and therefore highly prone to nutrient leaching from the
diets when suspended in water. Nutrient leaching often occurred
in aquatic animals of slow‐feeding, for example, shrimp. However,
the feeding of turbot was on the surface of the water, and experi‐
mental diets could be swallowed quickly (a few seconds) when the
diets were put into the water. Thus, we believed that the influence of
taurine and FPH leaching on the experimental results may not need
to be considered in the current study. Previous studies reported
that FPH could increase feed intake in carnivorous fish species, for
example, Atlantic salmon (Refstie, Olli, & Standal, 2004). However,
for turbot, our and other previous studies found that FPH may not
improve feed intake (Oliva‐Teles, Cerqueira, & Gonçalves, 1999);
(Wei et al., 2016). Similarly, feed intake in the current study was no
significant differences between FPH0+T and FPH10+T treatments
and between FPH0 and FPH10 treatments. Kousoulaki et al. (2012)
found that there was no significant correlation between the growth
of fish and the content of Tau in diets containing FPH. In that study,
dietary Tau only came from marine ingredients such as fishmeal and
FPH. In our study, the growth of fish fed diets containing FPH was
seemingly not related to dietary Tau whether added indirectly via
ingredients or mainly supplied by exogenous crystalline Tau. It was
suggested that the growth result may not indicate the effect of FPH
on the utilization of Tau in turbot to some extent.
Intracellular Tau metabolism is mainly regulated by Tau biosyn‐
thetic enzymes and Tau transporter (Tappaz, 2004). Turbot may have
a low capacity to synthesize Tau (Wang et al., 2014). Thus, we spec‐
ulated that FPH in diets may affect Tau digestive ability by regulating
 |
404       WEI et al.
Tau transport (Wei, Liang, Mai, Zheng, & Xu, 2017a). Han, Patters,
Jones, Zelikovic, & Chesney, (2006) reported that a long‐term adap‐
tive response of Tau transport was regulated by TauT at the level of
mRNA transcription, and a short‐term adaptive response of Tau trans‐
port might occur at the level of protein translation. Therefore, it was
necessary to investigate the effect of Tau alone or in combination with
FPH on the TauT mRNA expression after the long‐term feeding trial.
TauT mRNA expression in different tissues of turbot showed
that TauT mRNA levels were particularly high in brain and eye
(Figure 2). Similar results were observed in tilapia, Atlantic salmon
and Senegalese sole (Pinto et al., 2012; Takeuchi, Toyohara,
Kinoshita, & Sakaguchi, 2001; Zarate & Bradley, 2007). Thus, brain
and eye tissues were chosen as representative tissues for investigat‐
ing TauT gene expression. Wang, He, Mai, Xu, & Zhou (2017) found
that TauT mRNA levels in isolated muscle cells of turbot were dose‐
dependent decreasing when Tau concentration was below 88.75 μM.
In the current study, TauT mRNA levels of juvenile turbot fed Tau
supplemented diets were significantly lower than that of no added
Tau treatment, which was consistent with previous results of Atlantic
salmon (Zarate & Bradley, 2007). It suggested that turbot may main‐
tain its Tau homoeostasis like Atlantic salmon by reducing the quan‐
tity of Tau transporter required in fish when exogenous Tau is added
to feed. In addition, increased Tau concentration of brain and eye tis‐
sues was observed in fish fed diets with Tau supplementation, which
may demonstrate that TauT expression could be linked to the Tau
content in these tissues. In addition, Liaset, Julshamn, & Espe (2003)
reported that FPH contained high levels of β‐alanine in aqueous frac‐
tion and ultramembrane filtered fraction. Tau is also a β‐amino acid,
and its transport was competitively inhibited by Tau analogues (such
as β‐alanine) (Gondo, Satsu, Ishimoto, Iwamoto, & Shimizu, 2012).
However, in current experiment, partial fishmeal replaced with FPH
in diets had no significant effect on TauT mRNA level, which indi‐
cated that 62 g/kg of FPH in diets may not be high enough to affect
Tau transport of juvenile turbot. It still needed to further investigate
whether high levels of FPH had a negative effect on Tau transport.
Metabolite changes in tissues were consistent with fish growth
response to dietary composition (Abro, Moazzami, Lindberg, & Lundh,
2014). In the current experiment, by using NMR‐based metabolomics,
we found that Tau levels in liver for fish fed FPH0+T and FPH10+T
diets were significantly higher than that in fish fed FM, FPH0 and
FPH10 diets (Table 5). It indicated that exogenous Tau added to the
feed could be transported to the liver of turbot. In addition, compared
with the liver, metabolites from muscle are more sensitive with the
changes in nutrient composition in feed (Wei et al., 2017a; Wei, Liang,
Mai, Zheng, & Xu, 2017b). The changes in Tau contents in muscle
were closely related to Tau contents in feed, which was higher in diets
supplemented with Tau. For FPH, Tau contents of the muscle in the
FPH0 versus FPH10 and the FPH0+T versus FPH10+T comparisons
were not significantly changed, which suggested that 62 g/kg of FPH
in diets may have no significant effect on Tau metabolism in muscle.
In conclusion, the activity of CDO, the TauT gene expression
and Tau metabolism were not affected when dietary fishmeal was
replaced by 62 g/kg of FPH. However, Tau supplemented alone or
combined with a certain level of FPH can reduce TauT gene expres‐
sion and CDO activity and increased Tau level in muscle and liver to
maintain the homoeostasis of Tau in turbot.
AC K N OW L E D G E M E N T S
This research was supported by National Natural Science Foundation
of China (31672663, 31340076), and China Agriculture Research
System (CARS‐47‐G15).
ORCID
Mengqing Liang  https://orcid.org/0000-0002-3241-414X
REFERENCES
Abro, R., Moazzami, A. A., Lindberg, J. E., & Lundh, T. (2014). Metabolic
insights in Arctic charr (Salvelinus alpinus) fed with zygomycetes and
fish meal diets as assessed in liver using nuclear magnetic resonance
(NMR) spectroscopy. International Aquatic Research, 6, 1–11. https://
doi.org/10.1007/s40071-014-0063-9
Aksnes, A., Hope, B., Jönsson, E., Björnsson, B. T., & Albrektsen, S.
(2006). Size‐fractionated fish hydrolysate as feed ingredient for
rainbow trout (Oncorhynchus mykiss) fed high plant protein diets. I:
Growth, growth regulation and feed utilization. Aquaculture, 261,
305–317. https://doi.org/10.1016/j.aquaculture.2006.07.025
Alfaro, A. C., & Young, T. (2018). Showcasing metabolomic applications in
aquaculture: A review. Reviews in Aquaculture, 10, 135–152.
Al‐Feky, S. S. A., El‐Sayed, A. F., & Ezzat, A. A. (2016). Dietary taurine en‐
hances growth and feed utilization in larval Nile tilapia (Oreochromis niloti-
cus) fed soybean meal‐based diets. Aquaculture Nutrition, 22, 457–464.
Bell, J. G., Strachan, F., Roy, W. J., Matthew, C., McDonald, P., Barrows, F. T.,
& Sprague, M. (2016). Evaluation of barley protein concentrate and fish
protein concentrate, made from trimmings, as sustainable ingredients in
Atlantic salmon (Salmo salar L.) feeds. Aquaculture Nutrition, 22, 326–334.
Bradford, M. M. (1976). A rapid and sensitive method for the quantitation
of micro‐gram quantities of protein using the principle of protein‐dye
binding. Analytical Biochemistry, 72, 248–254.
Chalamaiah, M., Hemalatha, R., & Jyothirmayi, T. (2012). Fish protein
hydrolysates: Proximate composition, amino acid composition, an‐
tioxidant activities and applications: A review. Food Chemistry, 135,
3020–3038. https://doi.org/10.1016/j.foodchem.2012.06.100
El‐Sayed, A. F. M. (2014). Is dietary taurine supplementation benefi‐
cial for farmed fish and shrimp a comprehensive review. Reviews in
Aquaculture, 6, 241–255. https://doi.org/10.1111/raq.12042
Fan, T. W. M. (1996). Metabolite profiling by one‐and two‐dimen‐
sional NMR analysis of complex mixtures. Progress in Nuclear
Magnetic Resonance Spectroscopy, 28, 161–219. https://doi.
org/10.1016/0079-6565(95)01017-3
Food and Agriculture Organization of the United Nations (FAO) (2012)
The state of world fisheries and aquaculture 2012. Rome, Italy: FAO, pp.
176–178.
Gatlin, D. M. III, Barrows, F., Bellis, D., Brown, P., Campen, J., Dabrowski,
K., … Wilson, R. F. (2007). Expanding the utilization of sustainable plant
products in aquafeeds: A review. Aquaculture Research, 38, 551–579.
Gondo, Y., Satsu, H., Ishimoto, Y., Iwamoto, T., & Shimizu, M. (2012). Effect
of taurine on mRNA expression of thioredoxin interacting protein in
Caco‐2 cells. Biochemical and Biophysical Research Communications,
426, 433–437. https://doi.org/10.1016/j.bbrc.2012.08.116
Goto, T., Matsumoto, T., & Takagi, S. (2001). Distribution of the hepatic
cysteamine dioxygenase activities in fish. Fisheries Science, 67, 1187–
1189. https://doi.org/10.1046/j.1444-2906.2001.00381.x
WEI et al.
Han, X., Patters, A. B., Jones, D. P., Zelikovic, I., & Chesney, R. W. (2006).
The taurine transporter: Mechanisms of regulation. Acta Physiologica,
187, 61–73. https://doi.org/10.1111/j.1748-1716.2006.01573.x
Han, Y., Koshio, S., Jiang, Z., Ren, T., Ishikawa, M., Yokoyama, S., &
Gao, J. (2014). Interactive effects of dietary taurine and glutamine
on growth performance, blood parameters and oxidative status of
Japanese flounder Paralichthys olivaceus. Aquaculture, 434, 348–354.
https://doi.org/10.1016/j.aquaculture.2014.08.036
Jia, H., Feng, Y., Liu, Y., Chang, X., Chen, L., Zhang, H., … Zou, Z., (2013).
Integration of 1H NMR and UPLC‐Q‐TOF/MS fora comprehensive
urinary metabonomics study on a rat model of depression induced
by chronic unpredictable mild stress. PLoS ONE, 8, e63624.
Khaoian, P., Nguyen, H. P., Ogita, Y., Fukada, H., & Masumoto, T. (2014).
Taurine supplementation and palm oil substitution in low‐fish meal
diets for young yellowtail Seriola quinqueradiata. Aquaculture, 420,
219–224. https://doi.org/10.1016/j.aquaculture.2013.11.012
Khosravi, S., Bui, H. T. D., Rahimnejad, S., Herault, M., Fournier, V., Kim,
S. S., … Lee, K. J. (2015). Dietary supplementation of marine protein
hydrolysates in fish‐meal based diets for red sea bream (Pagrus major)
and olive flounder (Paralichthys olivaceus). Aquaculture, 435, 371–376.
Kousoulaki, K., Albrektsen, S., Langmyhr, E., Olsen, H. J., Campbell, P., &
Aksnes, A. (2009). The water soluble fraction in fish meal (stick water)
stimulates growth in Atlantic salmon (Salmo salar L.) given high plant
protein diets. Aquaculture, 289, 74–83. https://doi.org/10.1016/j.
aquaculture.2008.12.034
Kousoulaki, K., Olsen, H. J., Albrektsen, S., Langmyhr, E., Mjøs, S. A.,
Campbell, P., & Aksnes, A. (2012). High growth rates in Atlantic
salmon (Salmo salar L.) fed 7.5% fish meal in the diet. Micro‐, ultra‐
and nano‐filtration of stickwater and effects of different fractions
and compounds on pellet quality and fish performance. Aquaculture,
338, 134–146. https://doi.org/10.1016/j.aquaculture.2012.01.017
Liaset, B., & Espe, M. (2008). Nutritional composition of soluble and in‐
soluble fractions obtained by enzymatic hydrolysis of fish‐raw ma‐
terials. Process Biochemistry, 43, 42–48. https://doi.org/10.1016/j.
procbio.2007.10.007
Liaset, B., Julshamn, K., & Espe, M. (2003). Chemical composition and the‐
oretical nutritional evaluation of the produced fractions from enzymic
hydrolysis of salmon frames with Protamex™. Process Biochemistry,
38, 1747–1759. https://doi.org/10.1016/S0032-9592(02)00251-0
Liu, X., Zhang, L., You, L., Yu, J., Zhao, J., Li, L., … Wu, H. (2011). Differential
toxicological effects induced by mercury in gills from three pedigrees
of Manila clam Ruditapes philippinarum by NMR‐based metabolom‐
ics. Ecotoxicology, 20, 177–186.
Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expres‐
sion data using real‐time quantitative PCR and the 2−ΔΔCT method.
Methods, 25, 402–408. https://doi.org/10.1006/meth.2001.1262
Oliva‐Teles, A., Cerqueira, A. L., & Gonçalves, P. (1999). The utilization
of diets containing high levels of fish protein hydrolysate by turbot
(Scophthalamus maximus) juveniles. Aquaculture, 179, 195–201.
Olsen, R. L., & Hasan, M. R. (2012). A limited supply of fishmeal: Impact on
future increases in global aquaculture production. Trends in Food Science
& Technology, 27, 120–128. https://doi.org/10.1016/j.tifs.2012.06.003
Pinto, W., Figueira, L., Ribeiro, L., Yúfera, M., Dinis, M. T., & Aragão, C.
(2010). Dietary taurine supplementation enhances metamorphosis
and growth potential of Solea senegalensis larvae. Aquaculture, 309,
159–164. https://doi.org/10.1016/j.aquaculture.2010.08.031
Pinto, W., Rønnestad, I., Jordal, A. E. O., Gomes, A. S., Dinis, M. T., & Aragão,
C. (2012). Cloning, tissue and ontogenetic expression of the taurine
transporter in the flatfish Senegalese sole (Solea senegalensis). Amino
Acids, 42, 1317–1327. https://doi.org/10.1007/s00726-010-0826-6
Qi, G., Ai, Q., Mai, K., Xu, W., Liufu, Z., Yun, B., & Zhou, H. (2012). Effects
of dietary taurine supplementation to a casein‐based diet on growth
performance and taurine distribution in two sizes of juvenile turbot
(Scophthalmus maximus L.). Aquaculture, 358–359, 122–128. https://
doi.org/10.1016/j.aquaculture.2012.06.018
|
      405
Refstie, S., Olli, J. J., & Standal, H. (2004). Feed intake, growth, and pro‐
tein utilization by post‐smolt Atlantic salmon (Salmo salar) in response
to graded levels of fish protein hydrolysate in the diet. Aquaculture,
239, 331–349.
Salze, G. P., & Davis, D. A. (2015). Taurine: A critical nutrient for future
fish feeds. Aquaculture, 437, 215–229. https://doi.org/10.1016/j.
aquaculture.2014.12.006
Takeuchi, K., Toyohara, H., Kinoshita, M., & Sakaguchi, M. (2001).
Ubiquitous increase in taurine transporter mRNA in tissues of tila‐
pia (Oreochromis mossambicus) during high‐salinity adaptation. Fish
Physiology and Biochemistry, 23, 173–182.
Tappaz, M. L. (2004). Taurine biosynthetic enzymes and taurine transporter:
Molecular identification and regulations. Neurochemical Research, 29,
83–96. https://doi.org/10.1023/B:NERE.0000010436.44223.f8
Wang, Q., He, G., Wang, X., Mai, K., Xu, W., & Zhou, H. (2014). Dietary
sulfur amino acid modulations of taurine biosynthesis in juve‐
nile turbot (Psetta maxima). Aquaculture, 422, 141–145. https://doi.
org/10.1016/j.aquaculture.2013.12.014
Wang, X., He, G., Mai, K., Xu, W., & Zhou, H. (2017). Molecular clon‐
ing and characterization of taurine transporter from turbot (Psetta
maxima) and its expression analysis regulated by taurine in vitro.
Aquaculture Research, 48, 1724–1734.
Wei, Y., Liang, M., Mai, K., Zheng, K., & Xu, H. (2017a). 1H NMR‐based
metabolomics studies on the effect of size‐fractionated fish protein
hydrolysate, fish meal and plant protein in diet for juvenile turbot
(Scophthalmus maximus L.). Aquaculture Nutrition, 23, 523–536.
Wei, Y., Liang, M., Mai, K., Zheng, K., & Xu, H. (2017b). The effect of ultra‐
filtered fish protein hydrolysate levels on the liver and muscle meta‐
bolic profile of juvenile turbot (Scophthalmus maximus L.) by 1H NMR‐
based metabolomics studies. Aquaculture Research, 48, 3515–3527.
Wei, Y., Liang, M., Mu, Y., Zheng, K., & Xu, H. (2016). The effect of ultra‐
filtered fish protein hydrolysate level on growth performance, pro‐
tein digestibility and mRNA expression of PepT1 in juvenile turbot
(Scophthalmus maximus L.). Aquaculture Nutrition, 22, 1006–1017.
Wei, Y., Liang, M., Zheng, K., & Wang, X. (2014). The effects of fish pro‐
tein hydrolysate on the digestibility of juvenile turbot (Scophthalmus
maximus L.). Acta Hydrobiologica Sinica, 38, 910–920. (In Chinese with
English abstract).
Wu, H., Southam, A. D., Hines, A., & Viant, M. R. (2008). High‐through‐
put tissue extraction protocol for NMR‐and MS‐based metabolom‐
ics. Analytical Biochemistry, 372, 204–212. https://doi.org/10.1016/j.
ab.2007.10.002
Yamamoto, T., Akimoto, A., Kishi, S., Unuma, T., & Akiyama, T. (1998).
Apparent and true availabilities of amino acids from several protein
sources for fingerling rainbow trout, common carp and red sea bream.
Fisheries Science, 64, 448–458. https://doi.org/10.2331/fishsci.64.448
Zarate, J. M., & Bradley, T. M. (2007). Molecular cloning and characteriza‐
tion of the taurine transporter of Atlantic salmon. Aquaculture, 273,
209–217. https://doi.org/10.1016/j.aquaculture.2007.10.002
Zheng, K., Liang, M., Yao, H., Wang, J., & Chang, Q. (2012). Effect of dietary
fish protein hydrolysate on growth, feed utilization and IGF‐I levels
of Japanese flounder (Paralichthys olivaceus). Aquaculture Nutrition,
18, 297–303. https://doi.org/10.1111/j.1365-2095.2011.00896.x
How to cite this article: Wei Y, Liang M, Xu H, Zheng K.
Taurine alone or in combination with fish protein hydrolysate
affects growth performance, taurine transport and metabolism
in juvenile turbot (Scophthalmus maximus L.). Aquacult Nutr.
2019;25:396–405. https://doi.org/10.1111/anu.12865