Huryn 1

Anna Huryn
Adam Groth
BIT 410 (002)
4 April 2018
Screening of Putative Clones, Creation of Expression Vector, and Screening of Recombinant
Expression Vector
Introduction
In the below experiments, we will examine the screening methods used to determine
viable pENTR4:CaMPARI and pDEST15:CaMPARI clones and how these viable clones were
used to generate the expression vector used to induce CaMPARI protein production. These
processes are important in helping determine the success of cloning reactions so that desired
inserts can be ligated with an expression vector and transformed into mammalian cells to
produce a novel protein which will help monitor calcium signaling in cells.
Methods and Materials
Isolation and Purification of Putative pENTR4:CaMPARI  Clones
The desired clone, pENTR4:CaMPARI, was first isolated via alkaline lysis. Alkaline
lysis can be broken down into three basic steps: resuspension, lysis, and neutralization (1).
Resuspension was done using an overnight culture of bacteria containing the desired clone,
pENTR4:CaMPARI, and centrifuging it for one minute in a mini-centrifuge tube. Lysis is the
most difficult step as it is hard to separate plasmid DNA from chromosomal DNA. An alkaline
buffer (for this experiment PE buffer was used) was used as it takes advantage of the size
difference between plasmid and chromosomal DNA (2). Sodium dodecyl sulfate (SDS) was also
added as the two solutes raise the pH of the solution, denaturing both plasmid DNA and
chromosomal DNA, causing the hydrogen bond between base pairs to break. Because it is
larger, chromosomal DNA often completely disassociates, unable to reanneal during
neutralization (2). In contrast, plasmid DNA is smaller, and though separated during lysis, the
complementary strands stay relatively close to each other making it much more likely to reanneal
during neutralization. Neutralization was performed using Buffer N3 to lower the pH of the
solution back to neutral allowing the clonal DNA to reanneal (2).
After performing alkaline lysis, the isolated clone was purified by binding the DNA to a
membrane and washing away any impurities with a neutral buffer (2). This was done using a
 Huryn 2

silica membrane in a mini-spin-column provided by Qiagen. Nucleic acids, like DNA, bind to
this silica membrane while other compounds such as proteins, salts, and other chemical
contaminants pass through the membrane. Elutions with warmed EB buffer then released any
DNA still bound to the membrane (2). DNA must be purified for downstream processes as
residual compounds from previous experiments can hinder the success of desired results.
Assessment and Quantification of DNA via Spectrophotometry
The quality and quantity of the purified samples were tested via DNA quantification
using a NanoDrop spectrophotometer, which measures the light absorbance of a sample. DNA,
RNA, and proteins have a characteristic absorbance pattern; DNA and RNA have a maximum
absorbance of 260 nm while proteins have a maximum absorbance of 280 nm. These
absorbencies were used as an indicator of the purity of the sample, utilizing an absorbance ratio,
A260/A280, which is derived from the maximum absorbencies. A pure sample of DNA yields a
ratio of 1.8. A lower ratio suggests the presence of proteins, though it is more likely salt
impurities from the previous elutions. A higher ratio value suggests the presence of RNA, though
is more likely due to an alkaline elution during purification.
In addition to purity, the NanoDrop was used to measure the concentration of DNA
present in the sample. This is done using the Beer-Lambert law which states that amount of light
absorbed by a sample is directly proportional to the concentration of a sample (3).
Restriction Mapping
Restriction mapping is a screening method used to determine the presence and orientation
of an insert (4). Restriction mapping works under the assumption that when a sample of DNA is
cleaved at known restriction sites by specific restriction enzymes, a predictable product of a
certain size will be produced (this can then be analyzed via gel electrophoresis). In this lab,
restriction mapping was used to determine the presence of the CaMPARI insert in the putative
clone pENTR4:CaMPARI. EcoRV was selected as the restriction enzyme as there is a EcoRV
recognition site on the 3’ end of the CaMPARI gene and on the pENTR4 plasmid downstream of
the NotI restriction site. If inserted correctly, once digested, the pENTR4:CaMPARI clone
should produce two DNA fragments of .4 Kb and 3.2 Kb (4). In this lab, the restriction digest
was performed over six DNA samples—five experimental ligation products and one positive
control containing the known clone—using a master mix of 60 uL.
Sequencing
 Huryn 3

After restriction mapping, a putative pENTR4:CaMPARI clone (experimental ligation

colony #1) was selected to be sequenced. The sample was sent to Eton labs and was sequenced
as per their protocol via Sanger sequencing method using the forward
primer ACCATGCTGCAGAACGAGCTTGC and the reverse primer
GGGCCCTATTCTATAGTGTCACCGCGGCCGC. The results were then analyzed using the
Finch TV program and NCBI Blast.7, checking for any anomalies or gaps in the sequence and
comparing the putative clone to the original sample.
Creation of Expression Vector via Clonase Reaction
The pENTR4:CaMPARI  clone is not conducive for protein expression as pENTR4 is not
an expression vector. An expression vector can be generated from this clone via a clonase
reaction. A clonase reaction harnesses recombinases, a type of protein that can mediate site-
specific recombination, allowing for genetic sequences to be transferred between vectors of
interest (5). In this lab gateway cloning, a type of clonase reaction, was used to transfer the
CaMPARI insert from its non-expressing vector, pENTR4, to its expression vector, pDEST15,
using recombinase LR Clonase II. The pENTR4:CaMPARI clone was first linearized by a
single-cutter enzyme SspI-HF. The linearized DNA was then treated with the LR clonase
mixture, transferring the CaMPARI insert from between the attL1 and attL2 recognition sites of
pENTR4 to between the attR1 and attR2 recognition sites of the expression vector pDEST15.
pDEST15’s insert ccdB, a toxicity gene, was transferred to pENTR4 during this recombination.
The resulting products are pENTR4:ccdB and pDEST15:CaMPARI which should be resistant to
kanamycin and ampicillin respectively (5).
Fluorescent Screening
Following the clonase reaction, the product was screened for potential clones using
fluorescent screening. If the clonase reaction was successful, the new clone should contain the
expression vector pDEST15 and the gene of interest CaMPARI. If inserted correctly, the
CaMPARI gene should produce the CaMPARI protein when plated on arabinose as this will
have driven the expression of T7 RNA polymerase as well as the expression of the CaMPARI
gene as it falls under the T7 promoter (6). The CaMPARI product will fluoresce when excited
by UV light, signifying a successful clone.
PCR Screening
 Huryn 4

Polymerase Chain Reaction or PCR, is an in-vitro method of DNA replication, allowing

for exponential amplification of a DNA sample (7). Yet in this lab, PCR was used as a screening
method to confirm the presence and orientation of the insert CaMPARI in the putative clone
pDEST15:CaMPARI. PCR follows three basic steps, which can then be repeated a certain
number of times (typically between 15-30 times) to yield the desired quantity of DNA. The first
step of PCR is denaturation, which for the first cycle was done at 95°C for ten minutes as the
DNA not only had to be denatured, separating the template DNA strand into a top, sense strand
and a bottom, antisense strand, but the bacterial cells containing the DNA had to be lysed. The
second step is annealing the forward and reverse primers to their designated strands. For the
purpose of screening, the primers flank a region of DNA with one primer on the upper strand and
one on the lower strand, both facing inwards towards each other. One primer must be annealed
to the insert sequence while the other must be annealed to the vector sequence (8). This was done
at 58°C for one minute, a temperature based on the composition of the provided primer. The
third step of PCR is extension, where the primers run in their designated direction along the
template strand, generating a new strand of DNA. If inserted correctly, the PCR product
produced should be about 986 bp long, which can be confirmed via gel electrophoresis. The
PCR products were also run with a positive and negative control, the positive control containing
the known insert in the correct orientation and the negative control lacking the insert. Extension
was performed at 72°C for one and a half minutes, about one minute per kilo base. These steps
were then repeated for another twenty-nine cycles.
Visualization of Restriction Mapping and PCR Screening via Gel Electrophoresis
The products from the restriction mapping and PCR screening were visualized using gel
electrophoresis to help visualize the size of DNA fragment present in the samples, as well as
their size and shape. Gel electrophoresis utilizes the negative charge of the phosphate backbone
of DNA, as this will cause the strands to be attracted to a positive charge (9). Using a Whatman
Horizon 58 gel apparatus, an electrical current of 120V was run through a 1% gel, pulling the
samples towards the positive anode located opposite of the wells containing the DNA samples
(9). As the DNA moved towards the positive anode, it was separated based on size and shape
due to the concentration of the agarose, which was of standard porosity. Larger DNA fragments
traveled slower, while smaller DNA fragments ran farther and faster.
 Huryn 5

For the restriction mapping products, 5 μL of each digested sample was mixed with 1 μL
of DNA loading dye and loaded into the well. The samples were run against 10 uL of 1 Kb DNA
ladder. Lane 1 was loaded with the DNA ladder, lane 2 was left blank, lane 3 held the positive
control, lane 4 held the putative clone from experimental ligation colony #1, lane 5 held the
putative clone from experimental ligation colony #2, lane 6 held the putative clone from
experimental ligation colony #3, lane 7 held the putative clone from experimental ligation colony
#4, and lane 8 held the putative clone from experimental ligation colony #5.
For the PCR screening reaction, 5 μL of each sample were loaded into the well without
loading dye. The samples were run against 5 uL of 1 Kb DNA ladder. Lane 1 was loaded with
the DNA ladder, lane 2 held sample 4, lane 3 held sample 1, lane 4 held sample 2, lane 5 held
sample 3, lane 6 was left blank as it was pierced during loading, lane 7 held the positive control,
and lane 8 held negative control.
Results
A260/A280 ratios Concentration
Putative Clone #1 1.92 88.0 ng/uL
Putative Clone #2 1.75 22.7 ng/uL
Putative Clone #3 1.89 78.0 ng/uL
Putative Clone #4 1.88 66.7 ng/uL
Putative Clone #5 1.88 76.8 ng/uL
Positive Control 1.86 78.6 ng/uL
Table A. The above table shows the A260/A280 ratios and concentrations the purified putative pENTR4:CaMPARI
clone samples.
Table A. shows the concentrations and A260/A280 ratios from the purification of
putative pENTR4:CaMPARI clone samples via spectrophotometry using the NanoDrop. Putative
Clone #1 had A260/A280 ratio of 1.92 and a concentration of 88.0 ng/uL. Putative Clone #2 had
a A260/A280 ratio of 1.75 and a concentration of 22.7 ng/uL. Putative Clone #3 had a
A260/A280 ratio of 1.89 and a concentration of 78.0 ng/uL. Putative Clone #4 had a A260/A280
ratio of 1.88 and a concentration of 66.7 ng/uL. Putative Clone #5 had a A260/A280 ratio of 1.88
and a concentration of 76.8 ng/uL. The positive control had a A260/A280 ratio of 1.86 and a
concentration of 78.6 ng/uL.
 Huryn 6

Image A. Gel of restriction mapping of purified, putative pENTR4:CaMPARI clones after restriction digest, run
against a 1 Kb DNA ladder. Lane 1 held the 1 kb DNA ladder. Lane 2 was left empty. Lane 3 held the positive
control. Lane 4 held putative clone #1. Lane 5 held putative clone #2. Lane 6 held putative clone #3. Lane 7 held
putative clone #4. Lane 8 held putative clone #5.
Image a. shows the gel run for the restriction mapping of the purified, putative
pENTR4:CaMPARI clones after restriction digest. The samples were run against the control, a 1
Kb DNA ladder provided by NBE. The positive control produced two bands, one 3.2Kb in size
and one .4 Kb in size. Putative clone #1 produced two bands, one 3.2 Kb in size and one .4 Kb
in size. Putative clone #2 produced a single faint band, slightly larger than 3.2 Kb. Putative
clones #3 and #4 could not be read. Putative clone #5 produced two bands, one 3.2 Kb in size
and one .4 Kb in size.
Forward Primer Sequence Reverse Primer Sequence
Low Quality Reads 622, 698, 704, 718, 727, 729, 77, 599, 605, 613, 614, 626,
(Anomalies) 743 635, 644, 653, 678, 682, 683,
691
Range Analyzed 55bp - 750bp 60bp – 700bp
Signal Strengths by Base A: 433 T: 286 G: 277 C:315 A: 399 T: 496 G: 268 C:610
BLAST Results 100% Identity, 0 gaps 100% Identity, 0 gaps
Overlap of Sequences? none
Cloning Primers Found? yes
Table B. Results from sequencing of putative pENTR4:CaMPARI clone
 Huryn 7

Table B. shows the results from the BLAST analysis of the putative clone sequence of
pENTR4:CaMPARI. The forward primer was analyzed from 55bp-750bp with low quality reads
or anomalies at 622, 698, 704, 718, 727, 729, 743bp and signal strengths at A: 433 T: 286 G: 277
C:315. There were zero gaps identified with 100% identity to the original. The reverse primer
was analyzed from 60bp-70bp with low quality reads or anomalies at 77, 599, 605, 613, 614,
626, 635, 644, 653, 678, 682, 683, 691bp and signal strengths at A: 399 T: 496 G: 268 C:610.
There were zero gaps identified with 100% identity to the original. Neither sequence was
overlapped and both cloning primers were found.

Image B. Results from fluorescent screening of putative pDEST15:CaMPARI clones

Image B shows the results from the fluorescent screening of putative
pDEST15:CaMPARI clones. There were thirty colonies counted, all of which glowed under UV
light.
 Huryn 8

Image C. Gel of PCR screening of pDEST15:CaMPARI clones run against a 1 Kb DNA ladder. Lane 1 held the 1
kb DNA ladder. Lane 2 held sample 4. Lane 3 held sample 1. Lane 4 held sample 2. Lane 5 held sample 3. Lane 6
was pierced and not used. Lane 7 held the positive control. Lane 8 held the negative control.
Image C. shows the gel run for the of PCR screening of pDEST15:CaMPARI clones. The
samples were run against the control, a 1 Kb DNA ladder provided by NBE. The positive
control, located in Lane 7, produced a single band at about 986 Kb. The negative control in Lane
8 also produced a single, faint band located at about 986 Kb. Sample 1 produced a faint band at
986 Kb. All other samples produced a strong band at about 986 Kb. Lane 6 was not read
because it was pierced during loading.
Discussion
The purpose of the above experiments was to screen for viable pENTR4:CaMPARI and
pDEST15:CaMPARI clones so the desired insert, CaMPARI could be ligated with the
expression vector pDEST15 to induce protein expression. As seen in the results, these processes
were an overall success.
First, the quantity and quality of the purified, putative pENTR4:CaMPARI clones were
assessed by the Nanodrop spectrophotometer which measured the concentration and purity of the
samples as seen in Table A. All samples were relatively pure for the purpose of this lab with
high concentrations, although a perfectly pure sample would have had a A260/A280 ratio of 1.8.
Putative clone #2 had lowest concentration of 22.7 ng/uL and low absorbance ratio of 1.75. A
 Huryn 9

low absorbance ratio typically suggests RNA contamination, but in this lab it was most likely
due to leftover guanidine (which also absorbs light) from previous processes.
A gel was then run to visualize the restriction mapping product as seen in Image A. If
inserted correctly, once digested, the pENTR4:CaMPARI clone should produce two DNA
fragments of .4 Kb and 3.2 Kb, which is confirmed by the positive control seen in Lane 3. Lanes
6 and 7, holding putative clone #3 and #4, experienced a blur most likely due to an issue with the
gel causing an extra uptake of dye.  Lane 5, which was holding putative clone #2 experienced
only one faint band. Putative clone #2 came from the smallest experimental ligation colony and
smaller colonies do not reproduce as well, which is one possibility as to why only band showed
(the stuffer).   All other lanes showed expected results with two bands at about 3.2 kb and .4 kb
confirming the presence of CaMPARI.  
A putative clone was then selected and sequenced to assess for any mutations or
anomalies. From the BLAST results seen in Table B. the putative clone selected had no proven
mutations and carried the same sequence as the original clone as there was no overlap and the
forward and reverse primers could be found.
After creation of the expression vector, the putative clones had to be screened to ensure
the presence and correct orientation of CaMPARI in the pDEST15 plasmid. This was first done
with fluorescent screening seen in image B. There were thirty colonies counted, all of which
fluoresced, confirming the presence of the CaMPARI insert as CaMPARI proteins fluoresce
when excited by UV light.
Further screening was done of the putative pDEST15:CaMPARI clone using PCR.
These results were visualized in a gel seen in image C. Our results from the gel were as expected,
with a single band at about 986 bp confirming positive samples.  There were some discrepancies
though.  Lane 3, containing colony 1, did not produce a strong band suggesting a loading error or
a non-positive colony.  Lane 8, holding our negative control, produced a faint band at 986 bp,
when it should have produced one. This is most likely due to cross contamination from the gel as
Lane 6 was pierced during loading.   
References
1. NCSU Biotechnology Program. (Spring 2018). Plasmid DNA Purification and
Quantitation. BIT 410/510 Video Slides. 08 Feb 2018.
 Huryn 10

2. NCSU Biotechnology Program. (Spring 2018). Isolation and Purification of Entry

Vector. BIT 410/510 Lab Manual. 07 Feb 2018.
3. NCSU Biotechnology Program. (Spring 2018). DNA Quantitation by
Spectrophotometry. BIT 410/510 Lab Manual. 07 Feb 2018.
4. NCSU Biotechnology Program. (Spring 2018). Restriction Mapping. BIT 410/510 Lab
Manual. 03 April 2018.
5. NCSU Biotechnology Program. (Spring 2018). Clonase Reaction. BIT 410/510 Lab
Manual. 05 April 2018.
6. NCSU Biotechnology Program. (Spring 2018). Fluorescent Screening. BIT 410/510
Lab Manual. 05 April 2018.
7. NCSU Biotechnology Program. (Spring 2018). Introduction to PCR. BIT 410/510
Video Slides. 28 Feb 2018.
8. NCSU Biotechnology Program. (Spring 2018). PCR Screening. BIT 410/510 Lab
Manual. 05 April 2018.
9. NCSU Biotechnology Program. (Spring 2018). Visualization of DNA by Agarose Gel
Electrophoresis. BIT 410/510 Lab Manual. 07 Feb 2018.