Article

pubs.acs.org/JPCB

DNA Elasticity from Short DNA to Nucleosomal DNA

Ashok Garai,† Suman Saurabh,† Yves Lansac,‡ and Prabal K. Maiti*,†
†
Centre for Condensed Matter Theory, Department of Physics, Indian Institute of Science, Bangalore 560012, India
‡
GREMAN, Université François Rabelais, CNRS UMR 7347, 37200 Tours, France
*
S Supporting Information

ABSTRACT: Active biological processes like transcription,

replication, recombination, DNA repair, and DNA packaging
See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

encounter bent DNA. Machineries associated with these

processes interact with the DNA at short length (<100 base
pair) scale. Thus, the study of elasticity of DNA at such length
Downloaded via KENT STATE UNIV on November 24, 2020 at 21:46:08 (UTC).

scale is very important. We use fully atomistic molecular

dynamics (MD) simulations along with various theoretical
methods to determine elastic properties of dsDNA of different
lengths and base sequences. We also study DNA elasticity in
nucleosome core particle (NCP) both in the presence and the
absence of salt. We determine stretch modulus and persistence
length of short dsDNA and nucleosomal DNA from contour
length distribution and bend angle distribution, respectively. For
short dsDNA, we find that stretch modulus increases with ionic
strength while persistence length decreases. Calculated values of stretch modulus and persistence length for DNA are in
quantitative agreement with available experimental data. The trend is opposite for NCP DNA. We find that the presence of
histone core makes the DNA stiffer and thus making the persistence length 3−4 times higher than the bare DNA. Similarly, we
also find an increase in the stretch modulus for the NCP DNA. Our study for the first time reports the elastic properties of DNA
when it is wrapped around the histone core in NCP. We further show that the WLC model is inadequate to describe DNA
elasticity at short length scale. Our results provide a deeper understanding of DNA mechanics and the methods are applicable to
most protein−DNA complexes.

■ INTRODUCTION
A micrometer-sized human cell nucleus houses dsDNA, which
is nearly 1.8 m in length, forcing the DNA to bend and stretch
sharply at a length scale of 10 base pairs (bp).1,2 The bending of
a charged biopolymer like DNA is facilitated by oppositely
charged histone proteins that form a spherical core on which
DNA is wrapped, forming a superhelix.3−8 A complex of 147 bp
long dsDNA wound over a core formed by histone proteins is
known as a nucleosome core particle (NCP).3,9 The
nucleosomal DNA is subjected to base-pair level elastic
manipulations in processes like transcription.10,11 To under-
stand these cellular processes, and the sharp elastic distortions
that the DNA has to undergo therein,9,12−16 we need to
systematically evaluate the elastic properties related to DNA
stretching and bending at a 10 bp length scale. Intrastrand and
interstrand interactions are believed to be responsible for the
DNA elasticity. However, a clear understanding about the
origin of DNA stiffness is still lacking.17 Apart from that, we
also need to have a good understanding as to how the elastic
properties of DNA change when it goes from a free state to a
state where it forms a complex with proteins.9,13,14,18 DNA
binding to histones relate to its flexibility and may cause several
degenerative disorders such as myotonic dystrophy, fragile X
syndrome, and Huntington’s disease with an increase in its
flexibility.19−21 The elastic properties of long size DNAs are
well described by theoretical model like the wormlike chain
model (WLC),22−24 which assumes a harmonic form for
deformation energies. This model predicts a persistence length
of ∼50 nm for dsDNA.25−27 Recent experimental observations
show that although it describes the elastic properties of long
DNA very well, the WLC model fails drastically for short DNA
fragments.2,28−40 Wiggins et al.30 performed atomic force
microscopy (AFM) measurements on short DNA fragments
and found a large angle bending probability almost 30 times
more than what was predicted by the WLC model. They
proposed a linear energy function for bending of short DNA as
opposed to the quadratic function assumed by the WLC model.
This model is known as the linear subelastic chain model
(LSEC). Yuan et al.,2 determined persistence lengths of DNA
fragments of length ranging from 15 to 89 bp, using end-to-end
length (R) distribution and radius of gyration (RG) obtained by
fluorescence resonance energy transfer (FRET) and small angle
X-ray scattering (SAXS), respectively. They found a persistence
length of around 20 nm, which is much lower than what is
Special Issue: Biman Bagchi Festschrift
Received: March 29, 2015
Revised: July 2, 2015
Published: July 2, 2015

© 2015 American Chemical Society 11146 DOI: 10.1021/acs.jpcb.5b03006

J. Phys. Chem. B 2015, 119, 11146−11156
The Journal of Physical Chemistry B
Table 1. Base Sequences of Different ds-DNAs Used in Our Simulations
DNA length base sequences
12 d(CGCGAATTCGCG)2
24 d(CGCGATTGCCTAACGGACAGGCAT)2
38 d(GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG)2
56 d(CGCGATTGCCTAACGGACAGGCATAGACGTCTATGCCTGTCCGTTAGGCAATCGCG) 2
predicted by the WLC model. In another SAXS study, Mathew-
Fenn et al.40 demonstrated the cooperativity in DNA stretching
below a length of two helical turns and demonstrated that DNA
is much softer than predicted by the elastic rod model. In a
sequel to this work, Becker and Everaers41 pointed out that the
observed cooperativity was a result of experimental error and
elastic rod model is appropriate for the description of DNA
stretching as it is noncooperative. Mazur, using MD simulations
of 25bp DNA, found that the WLC model is applicable down
to one helical turn of DNA and through an extensive
comparison concluded that the WLC model agrees far better
than LSEC model with the DNA bending trends obtained from
MD simulations.31 These results are in disagreement with the
findings of Wiggins et al.30 Recently, Mazur and Maaloum38,39
performed AFM experiment in solution to study the flexibility
of DNA at shorter length scales down to one helical turn. They
observed that beyond 7 nm (two helical turns) filexibility of
DNA can be well captured by the WLC model. Apart from
these, many DNA-cyclization experiments show that the
tendency of DNA looping is far larger than that predicted by
the WLC model.28,29,33 In light of all these experiments, the
accuracy of predictions made by the WLC model, for short
DNA fragments, becomes questionable. Formation of bubbles
and kinks due to thermal fluctuations can also influence DNA
elastic properties at short length scales. Ranjith et al. reported
distribution functions and loop formation probabilities in the
presence of equilibrium bubbles for short DNA.42 In another
study, using the generalized discrete WLC model Ranjith et
al.43 showed that the bending of such short DNA, where
fluctuations are very important, may arise from thermally
induced local defects. Apart from widely used WLC model,
normal-mode analysis44 and conformational energy analysis45
have been used to determine elastic properties of DNA.
Recently, Noy and Golestanian,34 using MD simulations,
essential dynamics analysis, and other theoretical approaches,
showed that end effects are predominant in the length scale
dependence of DNA stretch modulus. They demonstrated that
the value of a measured elastic property would depend on how
it is defined. Thus, providing a better way of interpreting
experimental results. Bomble and Case studied the elastic
properties of linear (60−150 bps) and circular ds-DNA (94
bps) using elastic rod theory along with normal-mode analysis
in implicit solvent and calculated the effects of salt
concentration as well as DNA sequence on its flexibility.44
They observed a reasonable agreement with the experimental
results. Their results help validate the use of all atom force
fields in describing DNA at long length scales. However, they
did not study elastic properties of the shorter DNA below 60
bp. Ruscio and Onufriev performed MD simulation in implicit
solvent to study nucleosomal DNA flexibility.46 They calculated
the free energy difference between conformations with different
degrees of bending and concluded that cost for bending of
NCP DNA is smaller than that predicted from the macroscopic
elastic theory. Their observation is in qualitative agreement
with the cyclization experiments.29 These studies, in addition to
11147
Article
AT (%) GC (%)
33.3 66.7
41.67 58.33
34.21 65.79
42.86 57.14
being detailed, were able to produce results that match
experiments. Earlier we reported the stretch modulus for
short ds-DNA as well as various DNA nanostructures using
equilibrium simulations as well as steered molecular dynam-
ics.47−51 In the present study, we use all atom MD simulations
in explicit solvent to calculate various elastic properties, like the
stretch modulus, bending modulus, and persistence length for
short ds-DNAs of different lengths ranging from 12 to 56 bp at
different salt concentrations. We use different theoretical
formulations and compare and contrast their results. In
addition to calculating the elastic properties of free DNA, we
also perform calculations for nucleosomal DNA with an aim to
establish, in detail, the difference between free DNA and DNA
in complex with proteins with regard to their elastic properties.
Such a study is very important because of the fact that DNA−
protein complexes are biologically ubiquitous and the behavior
of a DNA molecule in the presence of a protein can be very
different from its free-state behavior. Hence, a deeper
understanding of a process like transcription demands a deeper
understanding of DNA elastic properties in the presence of
binding proteins. At each stage of our calculation, we compare
our results with the predictions of the elastic rod model and
establish that the model is not applicable to short DNA
fragments with a length scale of importance in various cellular
processes.
The organization of the paper is as follows: In the Methods
first we give details of our all atom MD simulation. Then we
discuss different methodologies used for calculating elastic
properties of ds-DNA. Using these methodologies, we next
calculate persistence length, bending modulus, and stretch
modulus of various short ds-DNA and NCP DNA. We report
them in the Results and Discussion. Then we focus on their salt
dependence. We provide all these details in the results section.
We finally summarize and conclude our results and
observations in the Conclusion.
■ METHODS
Four short B-DNAs of finite length, 12, 24, 38, and 56 bps (see
Table 1 for base sequences) were built using the NAB module
of AMBER12.52,53 Figure 1a shows a 24 bp double stranded
(ds) B-DNA used in the simulation. ff99bsc055 with parmbsc0
correction56 was used to describe inter- and intramolecular
interaction involving DNA molecules. Henceforth, this
combination of force fields will be referred to as ff99bsc0.
This force field for B-DNA has been shown to produce stable
DNA conformation over microsecond long MD simulations.57
The DNA molecules were solvated in TIP3P model of water58
using xleap, with a minimum water layer of 10 Å in all three
directions. For the NCP simulation the following protocol was
used: the NCP crystal structure corresponding to PDB ID
1KX554 was used as the starting structure (Figure 1b). ff99bsc0
with parmbsc0 correction was used to describe the DNA, and
ff99SB was used to describe the interactions involving protein.
For the NCP simulation without histone tails, the H3, H4,
H2A, and H2B N-terminals were clipped at ARG-40, ASN-25,
DOI: 10.1021/acs.jpcb.5b03006
J. Phys. Chem. B 2015, 119, 11146−11156
The Journal of Physical Chemistry B Article

temperature coupling constant of 1 ps. The visualization of the

results was done with the VMD.63
We calculate the helix axis, six helical parameters of the DNA
that relate successive base pair planes: three angles (twist, roll,
and tilt) and three distances (shift, slide, and rise) using the
Curves+ algorithm.64 Using these parameters, we calculate end-
to-end distance, local tangents, and contour length. We next
determine contour length distribution, end-to-end length
distribution, bending angle distribution, and their respective
variances.
Calculation of Persistence Length. Bend Angle Dis-
tribution. Let ri be the position vector of the ith base pair of the
ds-DNA; then the end to end length of a DNA can be defined
as R = |(ri+n − ri)|. If ẑi is the unit vector along the local
direction at i, the deformation of ds-DNA can be represented
by the bending angle θ = cos−1(ẑi. ẑi+n) . Probability distribution
of small fluctuations in θ can be approximated by a Gaussian
and is given by37

βκ − 2βκL θ 2
P(θ ) = e 0
2πL0 (1)
Figure 1. (a) 24 bp ds B-DNA constructed using NAB, (b) NCP
crystal structure corresponding to PDB id 1KX554 with 147 bp ds-
DNA (blue) wound over histone protein core (brown).

PRO-26, and TYR-34, respectively. The NCP was solvated with

a water layer of 20 Å in all three directions. The solvated
systems were then neutralized by adding an appropriate
number of Na+ ions, which were described using Joung and
Chetham parameter set.59 For example, 144 Na+ ions were
added to neutralize NCP. For the 150 mM system 408 Na+ and
Cl− ions were added whereas 601 Na+ and Cl− ions were added
to attain a salt concentration of 250 mM. For the NCP
simulation without histone tails, 228 Na+ were added for
neutralization, whereas 240 Na+ and Cl− ions were added to
attain a salt concentration of 150 mM. These systems were
energy minimized for 1000 steps using steepest descent
minimization followed by 2000 steps of conjugate gradient
minimization. During the minimization all atoms of the DNA
were held fixed in their starting conformation using a harmonic
Figure 2. (a) DNA with its central axis traced using Curves+. Unit
constraint with a force constant of 500 (kcal/mol)/Å2. This vector ẑi represents the local tangent to the DNA axis and h represents
allowed water molecules to reorganize and eliminate unfavor- rise. (b) R represents end-to-end distance of the DNA.
able contacts with DNA. After this, 5000 steps of conjugate
gradient minimization were performed, decreasing the force
constant from 20 (kcal/mol)/Å2 to 0, with a reduction of 5
(kcal/mol)/Å2 every 1000 steps. After minimization, the where κ is the bending modulus, L0 = ∑ihi is the contour length
systems were heated from 0 to 300 K within 40 ps while the (Figure 2) and the persistence length lp = βκ. Note that eq 1 is
DNA was held fixed using harmonic constraints with a force valid for sufficiently small L0 and θ.31 For small θ, eq 1 yields37
constant of 20 (kcal/mol)/Å2. SHAKE constraints60 were
applied on all bonds involving hydrogen with a tolerance of lp ⎛ βκ ⎞
0.0005. Temperature regulation was achieved using the ln P(θ ) = − (1 − cos θ ) + 0.5 ln⎜ ⎟
L0 ⎝ 2πL0 ⎠ (2)
Berendsen weak coupling61 method with a temperature
coupling constant of 0.5 ps. Electrostatic interactions are eq 2 indicates that a plot of ln P(θ) vs (1 − cos θ) would give
treated with the Ewald method62 as implemented in PME rise to a descending straight line and from the slope one can
formulation for which we use a real space cutoff of 9 Å with L-J estimate the persistence length lp of ds-DNA.31 A recent
interactions truncated at the same distance. Following heating, study65 on the bend angle distribution (P(θ)) of a semiflexible
500 ps long NPT simulation was performed using the polymer of short and intermediate length within the WLC
Berendsen barostat using 0.5 ps pressure relaxation time. model provides the closed general analytic formula for P(θ) and
Finally 300 ns long NVT simulation was performed using a is given by
11148 DOI: 10.1021/acs.jpcb.5b03006
J. Phys. Chem. B 2015, 119, 11146−11156
The Journal of Physical Chemistry B
⎛ l θ2 ⎞
N
θ sin(θ ) exp⎜⎜ − ⎟
p
P(θ ) = ⎟ (rise, shift, slide). Instantaneous fluctuations of these six base
L0 ⎝ L0 ⎠
2 (3)
where N is a constant. Fitting the data of bend angle
distribution with the expression given by eq 3, one can also
extract the value of lp. Note the persistence length obtained by
this method is different from the one that we report in eq 2.
Thus, we identify it as lsp.
End-to-End Distance Distribution. One can also determine
persistence length of DNA using the mean square end-to-end
distance obtained from the WLC model24
⎡ lp ⎧ ⎛ L ⎞⎫ ⎤ right most term of eq 7 reduces to AT>A , where the
⟨R2⟩ = 2lpL0⎢1 − ⎨1 − exp⎜⎜ − 0 ⎟⎟⎬⎥
⎪ ⎪
⎢ elements of A and its transpose AT are Δζi. Following Olson
⎝ lp ⎠⎭⎥⎦
⎪ ⎪
⎣ L0 ⎩
(4)
Calculation of Stretch Modulus. Contour Length
Distribution. Assume in equilibrium ds-DNA has time averaged
length L0 and instantaneous length L. It turns out that L is the
sum of all the consecutive base pair heights (rise). We call it the
contour length of the ds-DNA. The linear elastic rod model
assumes that a perturbation along its length gives rise to a
restoring force F that increases linearly with the instantaneous
fluctuation (L − L0)/L0: F = −γG(L − L0)/L0, where γG is the
stretch modulus of the ds-DNA. Integrating the force and
distance we obtain the free energy change due to this restoring
force as E(L) = γG(L − L0)2/2L0. Combining the expression of
E(L) with the Boltzmann’s formula, we obtain the probability
of ds-dNA having a length L as
βγG βγG
− (L − L0)2
P(L) = e 2L 0
2πL0 (5)
where β = 1/kBT (kB is the Boltzmann constant, and T is the
temperature). Thus, the probability distribution is Gaussian
with mean length L0 and variance L0/(βγG). From the variance
one can extract the stretch modulus of ds-DNA. In a similar
fashion end-to-end distance distribution can be determined,
which is again Gaussian. Similarly, from the variance of the
distribution one can extract the stretch modulus (γetel
G ) of ds-
DNA. Note, end-to-end distance includes the effect of DNA
bending and can be very different from the contour length
when there is bending of the helix axis.
Macroscopic Elastic Theory. According to macroscopic
elastic theory for a uniform rod with cross sectional area ( and
stretch modulus γ, Young’s modulus is given by Y = γ/( ,
whereas bending modulus κ of the rod varies with Y and
moment of inertia I as κ = IY; thus persistence length becomes
lp = βIY. For a cylindrical molecule of radius r, ( = πr2 and I =
πr4/4; therefore,26
4lp
γWLC =
βr 2 (6)
By substituting the value of lp, we obtain the value of γ. Note,
the origin of the calculation of γ comes from the WLC model.
From now onward we call this γ as γWLC.
Conformational Energy Analysis. Helical parameters (both
angular and translational parameters) of ds-DNA can describe
the DNA deformations and displacements of base pairs along
and across the helical axis, respectively.45 To quantify such
deformations of ds-DNA, we follow a method described by
Olson et al.,45 which essentially consists of harmonic energy
functions associated with the following six base pair step
11149
Article
parameters: three angles (roll, tilt, twist) and three distances
pair step parameters from their equilibrium values (ζ0i ) are
given by Δζi = ζi − ζ0i , i = 1, 6. For any conformational change
the energy associated with the base pair step is assumed to be
harmonic and is given by
6 6
1
, = ,0 + ∑ ∑ ωijΔζiΔζj
2 (7)
i=1 j=1
where , 0 is the minimum energy and ωij represents elastic
constants. Let elastic matrix > consist of all ωij and then the
et al.45 and Noy et al.34 we write
> = 3kBT (⟨ΔζiΔζj⟩)−1 = 3kBT Θ−1 (8)
where 3 , kB, T, and Θ are the ds-DNA length, Boltzmann
constant, temperature, and the covariance matrix consisting of
six base-pair step parameters, respectively. For our calculation
we consider four base-pair step parameters (roll, tilt, twist, and
stretch), and thus Θ becomes a 4 × 4 covariance matrix. We
evaluate elastic constants from the diagonal terms of the elastic
matrix > . We calculate stretch responses of the ds-DNA by
substituting 3 with contour length (γcl) as well as end-to-end
length (γetel).
■ RESULTS AND DISCUSSION
To test whether the structure of DNA stabilizes well under the
mean field ion distribution and whether the MD trajectory data
that we use for analysis provide adequate description of the
DNA structure, we determine the DNA−Na+ radial distribution
function as a function of time, which is shown in Figure S1 in
the Supporting Information. Distribution stabilizes at around
50 ns of MD and shows no significant change thereafter. We
also plot RMSDs of the short DNAs with respect to its initial
minimized structure in Figure S2 of Supporting Information to
demonstrate the stable DNA trajectory over 300 ns long
simulation. For the analysis of short DNA we take data from
the last 200 ns of the 300 ns long MD trajectory. We calculate
various elastic properties of the full length short ds-DNAs
(FLSD) and termini excluded short ds-DNAs (TESD).
Similarly, we calculate the elastic properties of full length
NCP DNA (FLND) and short (we exclude five end bps from
both sides) NCP DNA (SND). In the main text we report the
results of various FLSDs and FLND. Results related to TESD
and SND are given in the Supporting Information.
Persistence Length of Bare DNA: Effect of Salt
Concentration and DNA Length. We determine distribu-
tions of the bending angle from our MD data for different
lengths of ds-DNA and at different monovalent salt
concentrations. We plot the log of bending angle distribution
as a function of (1 − cos θ) and fit it with eq 2. Figure 3 shows
such a plot for 12bp and 24bp FLSD. Similar plots for other
FLSD and TESD are shown in Figures S3−S5 in the
Supporting Information. From the fitting we determine the
persistence length (lp) of ds-DNA for different lengths at
different salt concentrations. Figure 4 shows a comparison of
our results with experiments for FLSD. Calculated values of the
persistence length are listed in Table SI (for FLSD) and Table
SIII (for TESD) in the Supporting Information. We observe
that the persistence length of ds-DNA depends strongly on salt
DOI: 10.1021/acs.jpcb.5b03006
J. Phys. Chem. B 2015, 119, 11146−11156
The Journal of Physical Chemistry B
Figure 3. Probability distributions of bend angles for 12 bp and 24 bp
ds-DNA at various salt concentrations. Discrete data points (red) are
obtained from our MD simulations. Persistence lengths (lp) for
respective ds-DNA are calculated by fitting the slope with eq 2 and are
shown by a straight line (blue). The correlation coefficient (r) values
obtained from the respective fittings are given in Table SVI of
Supporting Information.
Figure 4. Dependence of persistence length on monovalent salt
concentration for various short ds-DNA and comparison with the
experimental results.26
concentration as well as on ds-DNA length. Our results show
good quantitative agreement with the experimental results.26
With an increase in salt concentration, the persistence length of
various short ds-DNA (12bp, 24bp, 38bp, and 56bp) decreases.
This is because of the screening of the electrostatic repulsion of
the phosphate groups along the backbone at higher salt
concentrations. With an increase in salt concentration, ions
neutralize the negatively charged phosphate backbone and thus
make it easier for the DNA to bend. The inverse dependence of
persistence length with the monovalent salt concentration is
consistent with the standard charged cylinder model.66,67 It
views electrostatic interaction as a small perturbation over the
11150
Article
elastic energy function of the WLC model. We have also
calculated lp using eq 3 and from the distribution of end-to-end
distance given by eq 4. The persistence lengths obtained using
eqs 2 and 4 at zero salt follow a very similar trend with DNA
length, as shown in Figure 5. We observe that the values of
Figure 5. Dependence of persistence length on various lengths of
DNA with no salt condition. Persistence length are calculated using
eqs 2−4 separately and are compared.
persistence length obtained using eqs 2 and 4 at zero salt vary
with the DNA length following identical trend as depicted in
Figure 5. Though we do not observe any particular trend for
variation of persistence length as a function of salt
concentration obtained using eqs 2 and 3, the values calculated
using eq 4 show a trend similar to that observed for zero salt,
presented in Figure 5.
Stretch Modulus of Bare DNA: Effect of Salt
Concentration. Using our MD data, we next determine the
contour length distribution (P(L)) for ds-DNA of various
lengths at different salt concentrations. In Figure 6 we plot the
Figure 6. Contour length distribution for 12 bp and 24bp FLSD at
different salt concentrations. Discrete data points are obtained from
our MD simulations, and the solid lines are obtained by fitting with
using eq 5.
contour length distribution P(L) for 12 bp and 24 bp ds-DNA
at different salt concentrations. P(L) for other systems is given
in Figures S7, and S8 of Supporting Information. We use eq 5
to fit P(L), as shown in Figure 6. From these fittings we
calculate the respective stretch modulus (γG) values. We plot
and compare them with experimental data26 in Figure 7 and
Figure S9 of the Supporting Information. The values of γG are
listed in Table SI (for FLSD) and Table SIII (for TESD) in the
Supporting Information. We find that, for 12 bp ds-DNA, γG
increases with salt concentration, which is consistent with
experimental observations.26 However, this trend is not very
obvious for other short DNA cases. For 56bp ds-DNA we find
that γG decreases with increasing salt concentration.
The presence of local base pair melting and its decrease with
increasing salt concentration were invoked by Bustamante et
DOI: 10.1021/acs.jpcb.5b03006
J. Phys. Chem. B 2015, 119, 11146−11156
The Journal of Physical Chemistry B
Figure 7. Dependence of stretch modulus (γG) on monovalent salt
concentration for various ds-DNA and compared with the
experimental results.26
al.26 to explain increase of stretch modulus as a function of salt
concentration. We perform analysis for locating possible local
melting on the basis of hydrogen bond analysis (Figures S10−
S13, Supporting Information). We calculate the mean fraction
of hydrogen bonds for each base pair for all the FLSDs. Apart
from the terminal base pairs, all base pairs maintain hydrogen
bonds throughout the duration of simulation. Therefore, the H-
bond analysis for our case does not provide a clear signature of
local melting. The trend that we observe originates probably
from some other source. In the absence of local melting, the
screening of intrastrand electrostatic repulsion between
phosphate groups could be the reason for the trend that we
see for the stretch modulus. This was also discussed previously
in DNA stretching experiments,68 based on the theoretical
work by Prodgornik.69 Screening of repulsion between
phosphates makes DNA harder to stretch, as repulsion would
favor stretching. It is worth mentioning here that Bomble and
Case44 also observed an increasing trend for stretch modulus as
a function of salt concentration with no trace of any local
melting. We observe an increase in stretch modulus with salt
concentration for all FLSDs except 56 bp. Possibly for longer
DNA, the bending contribution to contour length increases. As
the effect of DNA bending is not included in eq 5, it may
provide an unphysical trend for γG for 56 bp ds-DNA.
Comparison between Macroscopic Elastic Theory and
Linear Elastic Rod Model. With the above results, we now
ask a basic question: can short ds-DNA be treated as an
isotropic rigid rod? To answer this question, we now use the
result of macroscopic elastic theory eq 6 for calculating γWLC by
using radius of ds-DNA r = 1 nm and respective lp values.
Equation 6 makes it clear that the macroscopic elastic theory
predicts the persistence length and the stretch modulus to vary
proportionally. Substituting persistence length values obtained
using the WLC formalism into eq 6 gives us stretch moduli
decreasing with increasing salt concentration. The values of
γWLC can be made equal to γG if we scale r appropriately,
smaller for a higher salt concentration. This is in sharp variance
with the time-resolved fluorescence polarization anisotropy
experiment of intercalated ethidium where the radius of 48bp
DNA decreased just by 3 Å when the monovalent salt
concentration increased from 20 to 100 mM,70 which is not
sufficient to bridge the difference in stretch moduli obtained
from the two methods. Similar results were obtained by Bomble
and Case44 for short DNA. However, they showed that the
elastic rod model works well for describing the elastic
properties of long DNA fragments (>100bp). Macroscopic
elastic theory overlooks the detailed base-pair level phenomena
as well as ignores the microscopic effect of DNA backbone
11151
Article
geometry and the screening effect at the base pair level, which
could be important for short DNA fragments.
Stretch Modulus from Conformational Energy Anal-
ysis. Using conformational energy analysis described above we
next calculate the stretch modulus of various ds-DNA by using
respective values of contour lengths and end-to-end lengths.
We plot γcl both for FLSD and for TESD in Figure 8, and in
Figure 8. Dependence of stretch modulus (γcl, using eq 8) on salt
concentration for various ds-DNA.
Figure S14 of the Supporting Information. Values of γetel are
shown in the Table SII and Table SIV in the Supporting
Information. We list the values in Table SII (FLSD) and Table
SIV (TESD) in the Supporting Information. We find γcl is
always larger than γetel. This is due to the fact that for our
systems contour length is always larger than the end-to-end
length. Note by definition end-to-end length captures the effect
of DNA bending. We further observe different values of stretch
modulus for the same ds-DNA when we compare γG and γcl.
Values of γcl are larger than the values of γG except for a few
cases. From our analysis we find that the calculation of stretch
modulus (γG) using the linear elastic rod model gives close
agreement with available experimental results.71−75
Persistence Length of NCP DNA: Effect of Salt
Concentration. All the methodologies used to determine
elastic properties of short ds-DNA were applied on the
nucleosomal DNA. The dependence of ln(P(θ)) on (1 −
cos θ) is shown in Figure 9, with Figure 10 showing the
dependence of persistence lengths obtained from bend angle
distributions on the salt concentration. The persistence length
increases with salt concentration, which is opposite to the trend
observed for short DNA. It is known that nucleosomal DNA
binds with the histone core at 14 different sites along the DNA
sequence. At these sites, arginine residues (10 belonging to the
histone core and 4 belonging to the histone tails) are inserted
into the DNA grooves, facilitating DNA bending.76 This makes
the nucleosomal DNA strongly constrained, leading to the
possibility of abrupt sharp bends. The sharp bends, known as
kinks, would lead to a deviation of the DNA contour from a
perfectly helical shape. The lower the number of these sharp
bends, the higher will be the persistence length. The persistence
length will also be affected by the histone tails. They are
strongly positively charged and hence can affect the structure of
the nucleosomal DNA superhelix electrostatically leading to
kinks. At low salt concentrations the histone tails stay collapsed
on the nucleosomal DNA. At higher salt concentrations,
screening of the DNA−tail attraction makes the tails freely
suspended in the surrounding solvent. From the twist angle
analysis (not shown) we observe that the value of twist angle
(>40° 3) increases at several places along the DNA with an
increase in salt concentration, which indicates that existing
DOI: 10.1021/acs.jpcb.5b03006
J. Phys. Chem. B 2015, 119, 11146−11156
The Journal of Physical Chemistry B Article

Figure 11. Contour length distribution for FLND with tails (left) and
without tails (right) at different salt concentrations. Discrete data
points are obtained from our MD simulations, and the solid lines are
obtained by fitting using eq 5.

Figure 9. Probability distribution of bend angles of FLND for single

NCP with tails and without tails at different salt concentrations.
Discrete data points (red) are obtained from our MD simulation.
Persistence lengths (lp) for respective ds-DNA are calculated by fitting
the slope with eq 2 and are shown by a straight line (blue). The
correlation coefficient (r) values obtained from the respective fittings
are given in the Table SVI of Supporting Information.
Figure 12. Stretch modulus (γG) for FLND as a function of salt
concentration for two cases: NCP with tails (filled data points) and
NCP without tails (empty data points).

of the Supporting Information. Using conformational analysis,

we calculate γcl and γetel for NCP for both cases with and
without tails. The values are plotted in Figure S21 (for FLND)
and Figure S22 (for SND) in the Supporting Information. Note
that values of γcl are larger than γG for FLND. Such differences
between the values of γcl and γG might be because we follow
two different techniques for calculating them. However, the
Figure 10. Persistence length for FLND as a function of salt
concentration for two cases: NCP with tails (filled data points) and
trend of stretch modulus with salt concentration remains the
NCP without tails (empty data points). same except for a few cases and the orders of magnitude for γcl
are similar to that obtained by Noy et al.34
Bending Modulus: Comparison between Bare DNA
kinks in NCP DNA get diminished. This may render NCP and NCP DNA. We next calculate and plot end-to-end distance
DNA stiffer in the presence of salt. The increase of persistence distributions for different bare DNAs and NCP DNA, which are
length of nucleosomal DNA with salt concentration originates shown in Figure S23 of the Supporting Information. We also
from a weaker electrostatic interaction between histone tails calculate bending modulus (κ) of different ds-DNA and plot
and DNA at higher salt concentrations. To test this hypothesis, them in Figure 13 (for FLSDs and FLND) and Figure S24 in
we also do simulation of the NCP removing all the histone tails. the Supporting Information. We observe that for short ds-DNA
In this case, we should expect an increase in the persistence
length, with the increase being more prominent at lower salt
concentrations. This is precisely what we observe in our
calculations. The trend is shown in Figure 10. The persistence
length in the absence of tails shows only a slight increase with
an increase in salt concentration. At a concentration of 150 mM
the persistence length is almost similar to the case when tails
are present.
Stretch Modulus of NCP DNA: Effect of Salt
Concentration. We next determine the contour length
distribution for FLND with and without tails at different salt
concentrations. We use eq 5 to fit them and then calculate γG
values, which are shown in Figure 11 and Figure S18 of the
Supporting Information. We plot different γG values in Figure Figure 13. Dependence of bending modulus (κ) at different salt
12 and compare them with γWLC in Figure S19 and Figure S20 concentration for various FLSDs and FLND.

11152 DOI: 10.1021/acs.jpcb.5b03006

J. Phys. Chem. B 2015, 119, 11146−11156
The Journal of Physical Chemistry B
κ decreases with increasing salt concentration whereas this
scenario is opposite for NCP DNA.
Hegner et al.77 used optical tweezers to stretch the DNA−
RecA complex and derived the elastic properties of the complex
from the force−extension curves. They found a 6−12-fold
increase in the longitudinal stretch modulus of DNA, when in
complex with RecA. The persistence length also showed a
significant increase. Yan and Marko78 performed a theoretical
study of the effect of DNA-binding proteins on DNA’s elastic
properties. Their study led to the conclusion that protein
binding to DNA leads to a decrease in its persistence length.
Mogurampelly et al.37 studied the compaction of DNA by
positively charged dendrimer. They found that bending rigidity
and persistence length of the DNA decreased in the presence of
dendrimer with the stretch modulus remaining the same. Our
calculations show significant differences in the elastic properties
of NCP DNA as compared to those of bare DNA. We find that,
at the physiological salt concentration of 150 mM, the
persistence length of FLND is 3 times the value for 56 bp
FLSD. Bending modulus (κ) and stretch modulus (γG) also
show a 3-fold and 7-fold increase, respectively.
Note that, to the best of our knowledge for the first time, we
systematically determine stretch modulus, persistence length,
and bending modulus of the nucleosomal DNA. We observe an
opposite trend of various elastic properties when we compare
the values for short ds-DNA and nucleosomal DNA in different
salt concentrations. The trend reminds us that nucleosomal
DNA, which is longer than the short ds-DNA, follows
macroscopic elastic theory.
Comparison of Force Fields: AMBER vs CHARMM. To
test the effect of choice of force field79 on the DNA elastic
properties, we use two well-known families of force fields for
nucleic acids namely AMBER80,81 and CHARMM.82,83 We use
two different force fields (CHARMM36 and ff99bsc0)
independently to run explicit solvent MD simulation for
studying elastic properties of 24bp ds-DNA. In the Methods,
we have already given the details of simulation using ff99bsc0.
For simulation using CHARMM 36 we use same protocol.
For the CHARMM simulation also we calculated RMSD
with respect to the initial minimized structure as a function of
time and compared with RMSD obtained using ff99bsc0. This
RMSD comparison is shown in Figure S25 in the Supporting
Information. We observe that RMSD obtained with the
CHARMM force field is smaller than that obtained with the
AMBER force field. However, both yield a stable B-DNA
structure with a small rmsd difference. A comparative study for
P(L), and P(θ) between 24 bp FLSD and TESD is shown in
Figure 14. P(R) is shown in Figure S26 (Supporting
Information). Table 2 summarizes and compares values of
stretch modulus, persistence length, and bending modulus
obtained from the analysis of our MD data using two different
force fields for 24bp FLSD. Table SVI in the Supporting
Information provides the TESD’s elastic properties of 24bp ds-
DNA using CHARMM 36 force field and compares with the
results obtained from the ff99bsc0 force field. We find that for
all the cases lp, κ, γWLC, γcl, and γetel values obtained using
CHARMM 36 force field are smaller than that determined from
the ff99bsc0 force field. On the contrary, γG values for 24bp ds-
DNA obtained using the CHARMM 36 force field is larger than
that obtained from the ff99bsc0 force field. Despite the fact that
the values obtained from two different force fields are different,
they are similar in orders of magnitude. However, both the
11153
Article
Figure 14. Contour length distribution (left panel), and bending angle
distribution (right panel) are plotted for two different force fields
CHARMM and AMBER for 24 ds-DNA including termini (upper
row) and excluding termini (lower row).
force fields are very useful for determining the elastic properties
of ds-DNA.
■
CONCLUSION
In this manuscript, following different methods, we have
investigated elastic properties of short ds-DNA as well as of
nucleosomal DNA at various salt concentrations. Our results
indicate that short ds-DNAs are more flexible in comparison to
the large ds-DNA and agree qualitatively as well as
quantitatively with the earlier observations.26,30,40,44,68 How-
ever, the trends that we observe for short DNA are different
from those obtained in earlier experimental studies,2 which
showed elastic properties to be length independent, whereas we
have found persistence length (lp), stretch modulus (γ), and
bending rigidity (κ) change with the length of the ds-DNA.
Thus, these should be measured directly and should not be
extrapolated from measurements performed on long DNA. We
further observed that the persistence length of bare ds-DNA
decreases with salt concentration, which can be attributed to
easy bending resulting from neutralization of the backbone
charges. We saw opposite trends for the stretch modulus with
salt concentration calculated using two different methods,
namely, linear elastic rod model (γG) and macroscopic elastic
theory (γWLC). We observe that γG increases with an increase in
salt concentration. Decreasing salt concentration reduces the
intrastrand electrostatic screening between phosphate groups
and makes it easier for the DNA to stretch, hence reducing the
stretch modulus. Stretch modulus and persistence length of
short ds-DNA vary in opposite ways with salt concentration.
This inverse variation is in sharp contrast to macroscopic elastic
theory, which predicts these two quantities to be directly
proportional to each other. We have listed and compared
different elastic properties of various ds-DNA by including and
excluding the termini and find significant quantitative differ-
ences in various elastic properties of bulk DNA as compared to
DNA fragments including termini. This comparison clearly
demonstrates the effect induced by finite molecular size and the
presence of boundaries in the system with regard to its elastic
properties. We have further studied and compared elastic
properties of 24bp ds-DNA using two different force fields
DOI: 10.1021/acs.jpcb.5b03006
J. Phys. Chem. B 2015, 119, 11146−11156
The Journal of Physical Chemistry B
Table 2. Elastic Properties of the 24 bp ds-DNA at No Salt Condition
force field Lmp
0 (nm) ⟨L⟩ (nm) lp (nm) γWLC (pN) γG (pN)
CHARMM 7.58 6.87 38.19 ± 2.38 158 974 ± 62
AMBER 7.76 6.84 45.84 ± 0.88 760 871 ± 17
CHARMM 36 and ff99bsc0. Future work will involve
calculating the elastic properties of DNA using the recently
developed ϵζOL1 refinement of the ff99bsc0 force field, which
improves the backbone description of the double helix.84 We
have determined the elastic properties of NCP DNA both in
the presence and in the absence of histone tails at different salt
concentrations. We observe that both persistence length and
stretch modulus increase with salt concentration, which
suggests that NCP DNA follows macroscopic elastic theory.
We observed NCP DNA to be stiffer than bare short DNA.
Values of persistence length, stretch modulus, and bending
rigidity for NCP DNA are found to be many times larger than
their respective values for bare short DNAs. Our results
illustrate how the elastic properties of DNA are modified by its
interaction with histone proteins. To the best of our knowledge
this kind of systematic study for determining elastic properties
of nucleosomal DNA and various short ds-DNAs is very new.
We used many different methods such as macroscopic elastic
theory, WLC model, linear elastic rod model, conformational
energy analysis to calculate the DNA elastic properties.
Comparing the results obtained from all these methods with
the available experimental results, we feel that linear elastic rod
model, eqs 2 and 5, provides a better trend for the values
obtained for various elastic properties. In principle, our results
and predictions can be tested by carrying out in vitro single
molecule experiments. We believe this kind of study certainly
helps to understand how elastic properties of ds-DNA evolve
with length scale as well as when it interacts with protein.
■
ASSOCIATED CONTENT
*
S Supporting Information
Radial distribution functions, bend angle distributions, contour
length distributions, persistence length and stretch modulus
comparison, hydrogen bond analysis, RMSD and end-to-end
distance distributions for various cases at different salt
concentrations, force field comparisons, elastic properties,
regression analysis details. The Supporting Information is
available free of charge on the ACS Publications website at
DOI: 10.1021/acs.jpcb.5b03006.
■
AUTHOR INFORMATION
Corresponding Author
*P. K. Maiti. Phone: +91 80 2293 2865/2360 7301. Fax: +91
80 2360 2602/0228. E-mail: maiti@physics.iisc.ernet.in.
Notes
The authors declare no competing financial interest.
■ ACKNOWLEDGMENTS
We thank Department of Atomic Energy (DAE) for financial
support. We also thank Supurna Sinha for fruitful discussions.
■
REFERENCES
(1) Garcia, H. G.; Grayson, P.; Han, L.; Inamdar, M.; Kondev, J.;
Nelson, P. C.; Philips, R.; Widom, J.; Wiggins, P. A. Biological
Consequences of Tightly Bent DNA: The Other Life of a
Macromolecular Celebrity. Biopolymers 2007, 85 (2), 115−130.
11154
Article
γcl (pN) γetel (pN) κ (pN nm2) Rmp
0 (nm) γGetel (pN)
150 136 158.18 ± 9.86 7.58 852.05 ± 73.84
409 397 189.87 ± 3.65 7.58 966.41 ± 30.67
(2) Yuan, C.; Chen, H.; Lou, X. W.; Archer, L. A. DNA Bending
Stiffness on Small Length Scales. Phys. Rev. Lett. 2008, 100, 018102.
(3) Richmond, T. J.; Davey, C. A. The Structure of DNA in the
Nucleosome Core. Nature 2003, 423, 145−150.
(4) Kornberg, R.; Lorch, Y. Interplay between Chromatin Structure
and Transcription. Curr. Opin. Cell Biol. 1995, 7, 371−375.
(5) Kornberg, R.; Lorch, Y. Twenty-five Years of the Nucleosome,
Fundamental Particle of the Eukaryote Chromosome. Cell 1999, 98,
285−294.
(6) Workman, J.; Kingston, R. Alteration of Nucleosome Structure as
a Mechanism of Transcriptional Regulation. Annu. Rev. Biochem. 1998,
67, 545−579.
(7) Wolffe, A.; Guschin, D. Chromatin Structural Features and
Targets that Regulate Transcription. J. Struct. Biol. 2000, 129, 102−
122.
(8) Gottesfeld, J.; Belitsky, J.; Melander, C.; Dervan, P.; Luger, K.
Blocking Transcription Through a Nucleosome with Synthetic DNA
Ligands. J. Mol. Biol. 2002, 321, 249−263.
(9) Hagerman, P. J. Flexibility of DNA. Annu. Rev. Biophys. Biophys.
Chem. 1988, 17, 265−86.
(10) Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., Walter,
P. Molecular Biology of the Cell, 4th ed.; Garland Science: New York,
2002.
(11) Bintu, L.; Ishibashi, T.; Dangkulwanich, M.; Wu, Y.-Y.;
Lubkowska, L.; Kashlev, M.; Bustamante, C. Nucleosomal Elements
that Control the Topography the Barrier to Transcription. Cell 2012,
151, 738−749.
(12) Bustamante, C.; Bryant, Z.; Smith, S. B. Ten Years of Tension:
Single-Molecule DNA Mechanics. Nature 2003, 421, 423−426.
(13) Crick, F. H. C.; Klug, A. Kinky helix. Nature (London, U. K.)
1975, 255, 530−533.
(14) Peters, J. P.; Maher, L. J. DNA Curvature and Flexibility in vitro
and in vivo. Q. Rev. Biophys. 2010, 43, 23−63.
(15) Luger, K.; Richmond, T. J. DNA Binding Within the
Nucleosome Core. Curr. Opin. Struct. Biol. 1998, 8, 33−40.
(16) Becker, N. B.; Everaers, R. DNA Nanomechanics in the
Nucleosome. Structure 2009, 17, 579−589.
(17) Kumar, S.; Li, M. S. Biomolecules Under Mechanical Force.
Phys. Rep. 2010, 486, 1−74.
(18) Marko, John F.; Siggia, Eric D. Driving Proteins off DNA Using
Applied Tension. Biophys. J. 1997, 73, 2173−2178.
(19) Wang, Y. H.; Griffith, J. Expanded CTG Triplet Blocks from the
Myotonic-Dystrophy Gene Create the Strongest Known Natural
Nucleosome Positioning Elements. Genomics 1995, 25, 570−573.
(20) Godde, J. S.; Wolffe, A. P. Nucleosome Assembly on CTG
Triplet Repeats. J. Biol. Chem. 1996, 271, 15222−15229.
(21) Bacolla, A.; Gellibolian, R.; Shimizu, M.; Amirhaeri, S.; Kang, S.;
Ohshima, K.; Larson, J. E.; Harvey, S. C.; Stollar, B. D.; Wells, R. D.
Flexible DNA: Genetically Unstable CTG.CAG and CGG.CCG from
Human Hereditary Neuromuscular Disease Genes,. J. Biol. Chem.
1997, 272, 16783−16792.
(22) Kratky, O.; Porod, G. Rö ntgenuntersuchung gelö s ter
fadenmoleküle. Rec.Trav.Chim.Pays-Bas 1949, 68, 1106−1123.
(23) Landau, L. D.; Lifshitz, E. M. Statistical Physics; Nauka: Moscow,
1976; Part 1.
(24) Rubinstein, M., Colby, R. Polymer Physics; Oxford University
Press: Oxford, U.K., 2003.
(25) Marko, J. F.; Siggia, E. D. Stretching DNA. Macromolecules
1995, 28, 8759−8770.
(26) Baumann, C. G.; Smith, S. B.; Bloomfield, V. A.; Bustamante, C.
Ionic Effects on the Elasticity of Single DNA Molecules. Proc. Natl.
Acad. Sci. U. S. A. 1997, 94, 6185−6190.
DOI: 10.1021/acs.jpcb.5b03006
J. Phys. Chem. B 2015, 119, 11146−11156
The Journal of Physical Chemistry B
(27) Hansma, H. G.; Kim, K. J.; Laney, D. E.; Garcia, R. A.; Argaman,
M.; Allen, M. J.; Parsons, S. M. Properties of Biomolecules Measured
from Atomic Force Microscope Images: A Review,. J. Struct. Biol. 1997,
119, 99−108.
(28) Cloutier, T. E.; Widom, J. Spontaneous Sharp Bending of
Double-Stranded DNA. Mol. Cell 2004, 14, 355−362.
(29) Cloutier, T. E.; Widom, J. DNA Twisting Flexibility and the
Formation of Sharply Looped Protein-DNA Complexes. Proc. Natl.
Acad. Sci. U. S. A. 2005, 102, 3645−3650.
(30) Wiggins, P. A.; Heijden, T. V. D.; Moreno-Herrero, F.;
Spakowitz, A.; Phillips, R.; Widom, J.; Dekker, C.; Nelson, P. C. High
Flexibility of DNA on Short Length Scales Probed by Atomic Force
Microscopy. Nat. Nanotechnol. 2006, 1, 137−141.
(31) Mazur, A. K. Wormlike Chain Theory and Bending of Short
DNA. Phys. Rev. Lett. 2007, 98, 218102−218105.
(32) Matsumoto, A.; Go, N. Dynamic Properties of Double-Stranded
DNA by Normal Mode Analysis. J. Chem. Phys. 1999, 110, 11070−
11075.
(33) Vafabakhsh, R.; Ha, T. Extreme Bendability of DNA less than
100 Base Pairs Long Revealed by Single-Molecule Cyclization. Science
2012, 337, 1097−1101.
(34) Noy, A.; Golestanian, R. Length Scale Dependence of DNA
Mechanical Properties. Phys. Rev. Lett. 2012, 109, 228101.
(35) Nelson, P. C. Spare the (Elastic) Rod,. Science 2012, 337, 1045−
1046.
(36) Vologodskii, A.; Frank-Kamenetskii, M. D. Strong Bending of
the DNA Double Helix. Nucleic Acids Res. 2013, 41, 6785−6792.
(37) Mogurampelly, S.; Nandy, B.; Netz, R. R.; Maiti, P. K. Elasticity
of DNA and the Effect of Dendrimer Binding,. Eur. Phys. J. E: Soft
Matter Biol. Phys. 2013, 36, 68−76.
(38) Mazur, A. K.; Maaloum, M. DNA Flexibility on Short Length
Scales Probed by Atomic Force Microscopy. Phys. Rev. Lett. 2014, 112,
068104.
(39) Mazur, A. K.; Maaloum, M. Atomic Force Microscopy Study of
DNA Flexibility on Short Length Scales: Smooth Bending versus
Kinking. Nucleic Acids Res. 2014, 42, 14006−14012.
(40) Mathew-Fenn, Rebecca S.; Das, R.; Harbury, Pehr A. B.
Remeasuring the Double Helix. Science 2008, 322, 446−449.
(41) Becker, N. B.; Everaers, R. Comment on ‘Remeasuring the
Double Helix’. Science 2009, 325, 538−b.
(42) Ranjith, P.; Sunil Kumar, P. B.; Menon, Gautam I. Distribution
Functions, Loop Formation Probabilities, and Force-Extension
Relations in a Model for Short Double-Stranded DNA Molecules.
Phys. Rev. Lett. 2005, 94, 138102.
(43) Ranjith, P.; Menon, Gautam I. Stretching and Bending
Fluctuations of Short DNA Molecules. Biophys. J. 2013, 104, 463−471.
(44) Bomble, Y. J.; Case, D. A. Multiscale Modeling of Nucleic Acids:
Insights into DNA Flexibility. Biopolymers 2008, 89 (2), 722−731.
(45) Olson, W. K.; Gorin, A. A.; Lu, X.-J.; Hock, L. M.; Zhurkin, V. B.
DNA Sequence-Dependent Deformability Deduced from Protein-
DNA Crystal Complexes. Proc. Natl. Acad. Sci. U. S. A. 1998, 95,
11163−11168.
(46) Ruscio, J. Z.; Onufriev, A. A. Computational Study of
Nucleosomal DNA Flexibility. Biophys. J. 2006, 91, 4121−4132.
(47) Maiti, P. K.; Pascal, Tod A.; Vaidehi, N.; Goddard William, A.,
III. The Stability of Seeman JX DNA Topoisomers of Paranemic
Crossover (PX) Molecules as a function of Crossover Number. Nucleic
Acids Res. 2004, 32 (20), 6047−6056.
(48) Maiti, P. K.; Pascal Tod, A.; Vaidehi, N.; Heo, J.; Goddard
William, A., III. Atomic-Level Simulations of Seeman DNA
Nanostructures: The Paranemic Crossover in Salt Solution. Biophys.
J. 2006, 90, 1463−1479.
(49) Mogurampelly, S.; Maiti, P. K. Force Induced DNA Melting. J.
Phys.: Condens. Matter 2009, 21, 034113.
(50) Mogurampelly, S.; Maiti, P. K. Structural Rigidity of Paranemic
Crossover and Juxtapose DNA Nanostructures. Biophys. J. 2011, 101
(6), 1393−1402.
11155
Article
(51) Joshi, H.; Dwaraknath, A.; Maiti, P. K. Structure, Stability and
Elasticity of DNA Nanotubes. Phys. Chem. Chem. Phys. 2015, 17,
1424−1434.
(52) Salomon-Ferrer, R.; Case, David A.; Walker, Ross C. An
Overview of the Amber Bimolecular Simulation Package. WIREs
Comput. Mol. Sci. 2013, 3, 198−210.
(53) Cheatham, T. E., III; Case, David A. Twenty-five Years of
Nucleic Acid Simulations. Biopolymers 2013, 99, 969−977.
(54) Davey, C. A.; Sargent, D. F.; Luger, K.; Maeder, A. W.;
Richmond, T. J. Solvent Mediated Interactions in the Structure of the
Nucleosome Core Particle at 1.9 Å resolution. J. Mol. Biol. 2002, 319,
1097−1113.
(55) Wang, J.; Cieplak, P.; Kollman, P. A. How Well Does a
Restrained Electrostatic Potential (RESP) Model Perform in
Calculating Conformational Energies of Organic and Biological
Molecules? J. Comput. Chem. 2000, 21 (12), 1049−1074.
(56) Perez, A.; Marchan, I.; Svozil, D.; Sponer, J.; Cheatham, T. E.,
III; Laughton, C. A.; Orozco, M. Refinement of the Amber Force Field
for Nucleic Acids: Improving the Description of α/γ Conformers.
Biophys. J. 2007, 92, 3817−3829.
(57) Zgarbova, M.; Otyepka, M.; Sponer, J.; Lankas, F.; Jurecka, P.
Base Pair Fraying in Molecular Dynamics Simulations of DNA and
RNA. J. Chem. Theory Comput. 2014, 10, 3177−3189.
(58) Jorgensen, W. L.; Chandrasekhar, J.; Madura, J. D.; Impey, R.
W.; Klein, M. L. Comparison of Simple Potential Functions for
Simulating Liquid Water. J. Chem. Phys. 1983, 79, 926−935.
(59) Joung, I. S.; Cheatham, T. E., III Determination of Alkali and
Halide Monovalent Ion Parameters for Use in Explicitly Solvated
Bimolecular Simulations. J. Phys. Chem. B 2008, 112 (30), 9020−9041.
(60) Ryckaert, J. P.; Ciccotti, G.; Berendsen, H. J. C. Numerical
Integration of the Cartesian Equations of Motion of a System with
Constraints: Molecular Dynamics of n-alkanes. J. Comput. Phys. 1977,
23, 327−341.
(61) Berendsen, H. J. C.; Postma, J. P. M.; van Gunsteren, W. F.;
Dinola, A.; Haak, J. R. Molecular Dynamics with Coupling to an
External Bath. J. Chem. Phys. 1984, 81 (8), 3684−3690.
(62) Darden, T.; York, D.; Pedersen, L. Particle Mesh Ewald: An N
log(N) Method for Ewald Sums in Large Systems. J. Chem. Phys. 1993,
98, 10089−92.
(63) Humphrey, W.; Dalke, A.; Schulten, K. J. VMD: Visual
Molecular Dynamics,. J. Mol. Graphics 1996, 14, 33−8.
(64) Blanchet, C.; Pasi, M.; Zakrzewska, K.; Lavery, R. CURVES+
Web Server for Analyzing and Visualizing the Helical, Backbone and
Groove Parameters of Nucleic Acid Structures. Nucleic Acids Res. 2011,
39, W68−W73.
(65) Polley, A.; Samuel, J.; Sinha, S. Bending Elasticity of
Macromolecules: Analytic Predictions from the Wormlike Chain
Model. Phys. Rev. E 2013, 87, 012601.
(66) Odijk, T. Polyelectrolytes. Near the Rod Limit. J. Polym. Sci.,
Polym. Phys. Ed. 1977, 15, 477−483.
(67) Skolnic, J.; Fixman, M. Electrostatic Persistence Length of a
Wormlike Polyelectrolyte. Macromolecules 1977, 10 (5), 944−948.
(68) Wenner, Jay R.; Williams, Mark C.; Rouzina, I.; Bloomfield,
Victor A. Salt Dependence of the Elasticity and Overstretching
Transition of Single DNA Molecules. Biophys. J. 2002, 82, 3160−3169.
(69) Podgornik, R.; Hansen, P. L.; Parsegian, V. A. Elastic Moduli
Renormalization in Self-Interacting Stretchable Polyelectrolytes. J.
Chem. Phys. 2000, 113, 9343−9350.
(70) Fujimoto, B. S.; Miller, J. M.; Ribeiro, N. S.; Schurr, M. Effects
of Different Cations on the Hydrodynamic Radius of DNA. Biophys. J.
1994, 67, 304−308.
(71) Smith, S. B.; Finzi, L.; Bustamante, C. Direct Mechanical
Measurements of the Elasticity of Single DNA Molecules by Using
Magnetic Beads. Science 1992, 258, 1122−1126.
(72) Smith, S. B.; Cui, Y.; Bustamante, C. Overstretching B-DNA:
The Elastic Response of Individual Double-Stranded and Single-
Stranded DNA Molecules. Science 1996, 271, 795−799.
DOI: 10.1021/acs.jpcb.5b03006
J. Phys. Chem. B 2015, 119, 11146−11156
The Journal of Physical Chemistry B Article

(73) Strick, T. R.; Allemand, J. F.; Bensimon, D.; Bensimon, A.;

Croquette, V. The Elasticity of a Single Supercoiled DNA Molecule.
Science 1996, 271, 1835−1837.
(74) Moroz, J. D.; Nelson, P. Torsional Directed Walks, Entropic
Elasticity, and DNA Twist Stiffness. Proc. Natl. Acad. Sci. U. S. A. 1997,
94, 14418−14422.
(75) Gross, P.; Laurens, N.; Oddershede, L. B.; Bockelmann, U.;
Peterman, E. J. G.; Wuite, G. J. L. Quantifying How DNA Stretches,
Melts and Changes Twist Under Tension,. Nat. Phys. 2011, 7, 731−
736.
(76) Luger, K.; Maeder, A. W.; Richmond, R. K.; Sargent, D. F.;
Richmond, T. J. Crystal Structure of the Nucleosome Core Particle at
2.8 Å resolution. Nature 1997, 389, 251−260.
(77) Hegner, M.; Smith, S. B.; Bustamante, C. Polymerization and
Mechanical Properties of Single RecA-DNA Filaments,. Proc. Natl.
Acad. Sci. U. S. A. 1999, 96, 10109−10114.
(78) Yan, J.; Marko, J. F. Effects of DNA-distorting Proteins on DNA
Elastic Response. Phys. Rev. E: Stat. Phys., Plasmas, Fluids, Relat.
Interdiscip. Top. 2003, 68, 011905.
(79) Reddy, S. Y.; Leclerc, F.; Karplus, M. DNA Polymorphism: A
Comparison of Force Fields for Nucleic Acids. Biophys. J. 2003, 84,
1421−1449.
(80) Case, D. A.; Cheatham, T. E., III; Darden, T.; Gohlke, H.; Luo,
R.; Merz, K. M., Jr.; Onufriev, A.; Simmerling, C.; Wang, B.; Woods, R.
J. The Amber Biomolecular Simulation Programs. J. Comput. Chem.
2005, 26 (16), 1668−88.
(81) Cheatham, T. E., III; Young, M. A. Molecular Dynamics
Simulation of Nucleic Acids: Successes, Limitations, and Promise.
Biopolymers 2001, 56, 232−256.
(82) MacKerell, A. D., Jr.; Banavali, N. All-Atom Empirical Force
Field for Nucleic Acids: Application to Molecular Dynamics
Simulations of DNA and RNA in Solution. J. Comput. Chem. 2000,
21, 105−120.
(83) Best, R. B.; Zhu, X.; Shim, J.; Lopes, P. E.; Mittal, J.; Feig, M.;
Mackerell, A. D., Jr. Optimization of the Additive CHARMM All-atom
Protein Force Field Targeting Improved Sampling of the Backbone
phi, psi and Side-Chain χ1 and χ2 Dihedral Angles. J. Chem. Theory
Comput. 2012, 8 (9), 3257−3273.
(84) Zgarbova, M.; Luque, F. Javier; Sponer, J.; Cheatham, T. E., III;
Otyepka, M.; Jurecka, P. Toward Improved Description of DNA
Backbone: Revisiting Epsilon and Zeta Torsion Force Field
Parameters. J. Chem. Theory Comput. 2013, 9 (5), 2339−2354.

11156 DOI: 10.1021/acs.jpcb.5b03006

J. Phys. Chem. B 2015, 119, 11146−11156