doi:10.1006/jmbi.2001.5368 available online at http://www.idealibrary.com on J. Mol. Biol.

(2002) 316, 547±561

The Large Subunit of Bacteriophage l 's Terminase

Plays a Role in DNA Translocation and
Packaging Termination
Carol Duffy and Michael Feiss*

Department of Microbiology The DNA packaging enzyme of bacteriophage l, terminase, is a hetero-

College of Medicine, University
of Iowa, Iowa City
IA 52242, USA
*Corresponding author
multimer composed of a small subunit, gpNu1, and a large subunit,
gpA, products of the Nu1 and A genes, respectively. The role of termi-
nase in the initial stages of packaging involving the site-speci®c binding
and cutting of the DNA has been well characterized. While it is believed
that terminase plays an active role in later post-cleavage stages of packa-
ging, such as the translocation of DNA into the head shell, this has not
been demonstrated. Accordingly, we undertook a generalized mutagen-
esis of l's A gene and found ten lethal mutations, nine of which cause
post-cleavage packaging defects. All were located in the amino-terminal
two-thirds of gpA, separate from the carboxy-terminal region where
mutations affecting the protein's endonuclease activity have been found.
The mutants fall into ®ve groups according to their packaging pheno-
types: (1) two mutants package part of the l chromosome, (2) one mutant
packages the entire chromosome, but very slowly compared to wild-type,
(3) two mutants do not package any DNA, (4) four mutants, though invi-
able, package the entire l chromosome, and (5) one mutant may be
defective in both early and late stages of DNA packaging. These results
indicate that gpA is actively involved in late stages of packaging, includ-
ing DNA translocation, and that this enzyme contains separate functional
domains for its early and late packaging activities.
# 2002 Elsevier Science Ltd.
Keywords: virus DNA packaging; virion assembly; virus DNA processing

Introduction packaging is one example of this type of biological

The transduction of chemical energy, obtained
through the hydrolysis of ATP, into movement is a
subject of general interest in biology. The transloca-
tion of DNA into a capsid during viral DNA
Abbreviations used: am, amber nonsense mutation;
cos, cohesive end site; bZIP, basic leucine zipper protein-
dimerization and DNA-binding motif; gpA and gpNu1,
the large and small terminase subunits, respectively,
and the products of l genes A and Nu1; KnR,
kanamycin-resistant; LA and LB, Luria agar and broth,
respectively; P-loop, ATPase phosphate-binding loop
with the consensus sequence GXXGXGKS/T; PFU,
plaque-forming unit; supF, amber-suppressing mutation;
TA, TB, TBSA, tryptone agar, broth, and soft agar,
respectively. Genetic mutations are denoted with a ÿ
(e.g. Aÿ), wild-type genes are denoted with a ‡ (e.g.
A‡). The l and P1 hybrid phage described in Materials
and Methods is referred to as l-P1.
E-mail address of the corresponding author:
michael-feiss@uiowa.edu
motor. While the mechanism of viral DNA translo-
cation is not completely understood in any system,
the bacteriophage l system, with its excellent gen-
etics, serves as a useful model for DNA packaging
by large double-stranded DNA viruses.
Bacteriophage l's DNA packaging occurs in sev-
eral stages (Figure 1). To initiate packaging, the
viral packaging enzyme, terminase, binds a speci®c
sequence, called cos, which joins adjacent chromo-
somes of the concatemeric DNA substrate. Next, in
a reaction stimulated by the presence of proheads
and ATP but not requiring ATP hydrolysis, termi-
nase introduces nicks at cos, 12 bp apart, to gener-
ate the cohesive ends of virion chromosomes.1 ± 3
Terminase then separates the cohesive ends in a
reaction requiring ATP hydrolysis.1,2,4 The enzyme
remains bound to the left end of the chromosome
to be packaged, forming a stable DNA-protein
complex known as complex I.5 In a reaction facili-
tated by a viral assembly catalyst, gpFI, complex I
binds a prohead, a preformed head shell precursor,

0022-2836/02/030547±15 $35.00/0 # 2002 Elsevier Science Ltd.

548
Figure 1. Model of bacteriophage l DNA packaging.
In the initial and nicked complexes the large (gpA) and
small (gpNu1) subunits of terminase are represented by
the large ellipse and small circle, respectively. cosN is
represented by the rectangle with staggered lines indi-
cating the nick positions. cosB is represented by the
open rectangle to the right of cosN. cosQ is represented
by the open square to the left of cosN. The cosN
sequence shows 2-fold rotational symmetry and thus
terminase is represented bound in a symmetrical man-
ner in the initial and nicked complexes. Subunit stoichi-
ometry is not known for any of the complexes and the
structures in the Figure do not represent actual struc-
tures. Refer to the text for an explanation of the stages
of packaging.
to form complex II.5 ± 7 In another packaging reac-
tion requiring ATP hydrolysis, the DNA is translo-
cated into the prohead until the next cos site on the
concatemer reaches the packaging complex.8,9 At
this time the downstream cos is cut and terminase
undocks from the DNA-®lled head to remain
bound to the left end of the concatemer's next
chromosome. A tail is added to the ®lled head to
form a virion and the new terminase-DNA com-
plex binds another prohead to continue the proces-
sive, polarized packaging of the concatemer.
Terminase is a heteromultimer composed of a
small subunit, gpNu1 (181 aa), and a large subunit,
gpA (641 aa). Terminase's role in the initial stages
of packaging involving the site-speci®c binding
and cutting of the DNA at cos is well characterized.
cos is composed of three subsites: cosN is the site
 DNA Packaging Mutants
where nicks are placed during the endonuclease
reaction, cosB is located to the right of cosN and
anchors terminase during the initial endonuclease
reaction, and cosQ is located to the left of cosN and
is required for packaging termination. Terminase
binds cosB through a winged helix-turn-helix DNA
binding motif located at the amino-terminal end of
gpNu1 (Figure 2).10 gpNu1 interacts with gpA
through domains located at the carboxy-terminal
end of gpNu1 and the amino-terminal end of
gpA.11,12 gpA possesses the enzyme's endonuclease
activity. Davidson and Gold selected for mutant
terminases that had lost their endonuclease
activity.13 Three different changes in gpA near resi-
due 400 and one at residue 586 resulted in termi-
nases that could not package immature l DNA,
but could still package mature, or pre-cut, DNA at
close to wild-type levels. Davidson and Gold also
reported that the region around residue 586 bears
striking sequence similarity to the basic leucine
zipper, or bZIP, protein dimerization and DNA
binding motif frequently found in eukaryotic tran-
scription factors. The mutation at residue 586
changes a highly conserved residue of the bZIP
consensus sequence and therefore the defect seen
with this mutant terminase may be caused by the
enzyme's inability to interact with cosN during the
endonuclease reaction. gpA also contains a high
af®nity ATPase center and a match to the con-
served P-loop sequence of known ATPases is
found starting near residue 490.14,15 The lysine
located at residue 497 is a highly conserved residue
of the P-loop consensus sequence. When Hwang
and Feiss changed this residue to an alanine
(K497A) or an aspartic acid (K497D) they found
the mutant terminases to be defective in cos clea-
vage of immature l DNA both in vivo and
in vitro.16 However, like Davidson and Gold's
mutant terminases, when mature l DNA was used
for in vitro packaging reactions in a puri®ed sys-
tem, the mutant terminases created by Hwang and
Feiss showed packaging activities either close to
(K497D) or indistinguishable from (K497A) that of
wild-type terminase. It is known that ATP hydroly-
sis is required for separating the cohesive ends
after nicks have been made at cosN.2,17 When this
helicase-type activity was assayed by adding either
wild-type or K497D mutant terminase to annealed,
mature l DNA, the K497D terminase was found to
have a severe defect in its cohesive end-separating
function.18 Thus, ®ve different changes in gpA, all
located at the C-terminal end of the protein
between residues 401 and 586, affect the initial
endonuclease and cohesive end-separating stages
of packaging.
In addition to its role in cos cleavage, the C termi-
nus of gpA is important for prohead binding.19 ± 22
Replacement of gpA's last six residues gave a lethal
phenotype that was rescued by an allele-speci®c
suppressor located in the B gene.22 The B gene
encodes the portal protein of l proheads. This por-
tal forms the vertex through which the DNA is
thought to enter the prohead during packaging, exit
 DNA Packaging Mutants 549

Figure 2. Functional domains of terminase. Terminase's small subunit, gpNu1, contains a winged helix-turn-helix
DNA binding motif (HTHw) at its amino-terminal end through which terminase interacts with cosB. gpNu1 also con-
tains a domain at its carboxy-terminal end (gpA) through which it interacts with gpA. Terminase's large subunit,
gpA, interacts with gpNu1 through a domain at its amino-terminal end (gpNu1). At its carboxy-terminal end gpA
contains a phosphate-binding loop sequence match (P-loop), a basic leucine zipper DNA binding motif (bZIP), and a
domain through which the enzyme interacts with the prohead (Prohead). Mutations that affect the endonuclease
activity of terminase have all been found to be located in the carboxy-terminal end of gpA (*).

during DNA injection, and to which the tail is
attached during virion assembly. In summary, the
region of gpA involved in early stages of packaging
including (1) endonucleolytic cleavage at cosN, (2)
separation of the cohesive ends, (3) ATP binding
and hydrolysis and (4) the recognition and binding
of proheads is located at the protein's C-terminal
end.
Here, we report the identi®cation of ten gpA
mutants, nine of which possess lethal defects in
post-cleavage stage(s) of packaging. All have mis-
sense mutations affecting the N-terminal two-
thirds of the protein, a region distinctly separate
from that in which mutations affecting early stages
of packaging have been reported. The mutants fall
into ®ve groups based on their packaging pheno-
types: (1) those that package part of the chromo-
some, (2) one that translocates DNA very slowly,
(3) those that do not package any DNA, (4) those
that package the whole chromosome, and (5) one
that may be defective in both early and late stages
of packaging.
Results
Isolation of lethal post-cleavage packaging
mutants of gpA
To isolate lethal mutations in gene A affecting
late packaging activities, we performed a random
mutagenesis of a plasmid containing A. The
pBR322-based plasmid pJM1 contains a segment of
l DNA extending from the late promoter, P0R,
through cos and genes Nu1, A, W, and B. Escheri-
chia coli mutD strain MF2449 transformed with
pJM1 was grown overnight and the mutagenized
plasmids isolated.
pJM1 plasmids with mutations in gene A were
identi®ed through spot test complementation
experiments. Speci®cally, we tested for the inability
of the mutagenized pJM1 plasmids to complement
a l Aam phage, as follows. MF2735, a non-sup-
pressing E. coli strain carrying a l Aam prophage
was transformed with mutagenized pJM1. The
resulting transformants were spotted onto TA
plates at 32  C for future use and onto lawns of
MF1968, a supF E. coli strain, at 42  C to test for
complementation. Incubation at 42  C heat-induces
the lcI857 Aam prophage, which causes expression
of truncated gpA from the prophage and mutant
or wild-type gpA from the mutagenized plasmid.
Successful complementation results in a spot of
lysis on the suppressing lawn, whereas no spot is
formed if the mutagenized plasmid cannot comp-
lement the lcI857 Aam virus. To ensure we were
examining complementation and not recombina-
tion, both the host strain, E. coli C1a galKam recA,
and the prophage, l cI857 red3 Aam11am32, were
defective in recombination. pJM1 plasmids which
did not complement lcI857 Aam contained A gene
mutation(s) and were studied further.
To quantify the severity of the A mutations on
virus assembly, we performed burst size exper-
iments using the above complementing system of
MF2735 (E. coli C1a galKam recA (l cI857 red3
Aam11am32)) carrying the mutated pJM1 plas-
mids. A minimum burst of approximately six
PFU/induced lysogen is required for plaque for-
mation. Our positive control, MF2735 carrying
wild-type pJM1, gave a burst of 30 PFU/induced
lysogen. Our negative control, MF2735 alone, gave
550
a burst of <7  10ÿ7 PFU/induced lysogen. We
selected for further study mutants that were deter-
mined to contain lethal mutations, i.e. that reduced
the burst to less than six PFU/induced lysogen.
Out of 9500 transformants tested we obtained 109
pJM1 plasmids with lethal mutations in the A
gene.
To ensure the lethal phenotype observed for the
gpA mutants was due solely to mutation(s) in the
A gene and not to possible additional mutations in
other genes carried by pJM1, we performed
additional complementation experiments. We
asked whether the products of the Nu1, W, and B
genes carried on the mutagenized pJM1 plasmids
could complement Nu1am, Wam, and Bam phages
(f395, f398, and f507, respectively) for growth.
Mutant pJM1 plasmids found to contain mutations
only in gene A were studied further.
To determine which of the mutants had retained
endonuclease activity, and therefore had a lethal
defect in a post-cleavage stage of packaging, we
performed in vivo cos cleavage assays. In these
assays, the substrate for DNA packaging was con-
catemeric l DNA, end-to-end multimers of l
chromosomes produced by rolling circle replication
and recombination. As terminase nicks and separ-
ates the cohesive ends that join the concatemer's
adjacent chromosomes, it generates mature right
and left chromosomal ends. We assayed for in vivo
cos cutting by looking for mature right and left l
chromosomal ends in total cellular DNA isolated
from induced MF2735 lysogens carrying the pJM1
plasmids with A gene mutations. Out of the 109
lethal gpA mutants originally isolated, 26 were
determined to have retained endonuclease activity
(data not shown) and were studied further.
To identify speci®c regions of gpA involved in
late packaging activities it was of interest to study
missense mutations rather than deletions or trunca-
tions of the A gene. To determine whether the
mutations causing the lethal phenotype were mis-
sense, nonsense, or deletions, we performed restric-
tion digests and Western blots. The pJM1 plasmids
carrying lethal mutations in A were digested with
restriction enzymes and subjected to agarose gel
electrophoresis to identify plasmids with deletions.
No deletion mutations were found (data not
shown). To distinguish between missense and non-
sense mutations we performed Western blots with
anti-terminase antibody. Proteins from all 26
mutants that retained endonuclease activity also
had a Mr equal to that of wild-type gpA (data not
shown). The absence of deletion and nonsense
mutations is consistent with the selection for
mutants retaining endonuclease activity.
Locations of gene A mutations that cause
lethal post-cleavage packaging defects
To identify regions of gpA important for post-
cleavage stages of packaging, we sequenced plas-
mids bearing A mutations with lethal effects on
post-cleavage stages of packaging. Plasmids were
 DNA Packaging Mutants
Table 1. Nucleotide and predicted amino acid changes
of lethal packaging mutants
Nucleotide position Predicted amino acid
Mutant and change change
1 G763A G18E
2 A937G K76R
3 A1206T N166Y
4 C1248T L180F
5 G1281A G191S
6 C1291T T194M
7 G1344A G212S
8 G1384A R225H
9 C1693T T328I
10 A1756G D349G
puri®ed and both strands of A were sequenced.
Each of the 26 plasmids sequenced contained one
of ten different point mutations in A. Plasmids
with identical mutations were most likely siblings
that arose through the mutagenesis process. Table 1
shows the nucleotide and predicted amino acid
changes of the ten mutants.
The sequencing results were con®rmed with
mapping experiments. The mutations were crossed
from pJM1 into l-P1, a kanamycin-resistant hybrid
phage that carries the phage P1 plasmid replication
and partitioning-encoding sequences. The resulting
MF1427 lysogens of l-P1 Aÿ were used in marker
rescue experiments. Four different marker rescue
plasmids, each carrying roughly one-fourth of A,
were tested for the ability to rescue, by homolo-
gous recombination, each of the gene A mutations
(Table 2). As a control for the expected frequency
of recombination, marker rescue experiments were
also performed with MF2734, a non-suppressing
lysogen of lAam42, carrying each of the marker
rescue plasmids. Each of the mutants isolated in
this study was rescued by only one segment of the
A gene, either the ®rst or second, indicating that
the lethal defect was not due to multiple mutations
located in different regions of the gene. As
expected, the Aam42 mutation was rescued by the
segment containing the 30 end of gene A.
Before using the mutant lysogens in other exper-
iments, gene A was sequenced for each l-P1 Aÿ
mutant to ensure additional mutations had not
been introduced into A as the mutations under
study were crossed into l-P1. The A gene carried
on the mutant prophages was ampli®ed by PCR in
four segments. Both strands of the PCR fragments
were sequenced. Each of the ten mutant prophages
contained a single point mutation located within
the ®rst 349 codons of gene A.
Effect of gene A mutations in a
non-complementing background
To ensure the mutations had the same effects on
phage production and cos cleavage activity when
located on prophages, rather than on plasmids
complementing a l Aam prophage, we repeated
the burst size experiments and in vivo cos cleavage
 DNA Packaging Mutants 551

Table 2. Genetic mapping of mutations causing lethal packaging defects

Recombinants as PFU when crossed with cloned DNA phage segmentsa
A allele of l-P1 phage (l bp mutated) bp 693-1234 bp 1219-1834 bp 1819-2270 bp 2251-2827
G18E (bp 763) 5.8  105 <10 <10 <10
K76R (bp 937) 5.6  104 <10 <10 <10
N166Y (bp 1206) 2.4  104 <10 <10 <10
L180F (bp 1248) 1.0  101 5.0  103 <10 <10
G191S (bp 1281) <10 9.0  103 <10 <10
T194M (bp 1291) <10 2.9  104 <10 <10
G212S (bp 1344) 5.0  101 2.0  105 <10 1.0  101
R225H (bp 1384) 1.0  101 1.2  105 1.0  101 1.0  101
T328I (bp 1693) 1.0  101 2.5  105 8.0  101 2.4  102
D349G (bp 1756) <10 1.0  103 1.0  101 2.0  101
Aam42 (bp 2620 and 2621) 1.0  101 2.0  101 <10 9.7  105
a
Crosses were performed between the mutant l-P1 phages and derivatives of pBluescript that carry the cloned l DNA segments
in the Table. The titers of recombinant phages were determined by plating on MF1427. lAam42 served as a control for the expected
frequency of recombination.

assays. Because l-P1 carries a kanamycin-resist-
ance marker, the burst sizes of the l-P1 Aÿ phages
were determined by measuring both PFU/induced
lysogen and KnR-transducing particles/induced
lysogen. Approximately six PFU/induced lysogen
are required for plaque formation. As the KnR-
transduction assay does not require a second
round of virus assembly for burst measurement, it
is useful for determining the virus yield of phages
unable to form plaques. For these phages, the num-
ber of PFUs/induced lysogen re¯ects the reversion
frequency. The results are shown in Table 3. The
mutants were found to have virus yields at or
below one phage/induced cell.
In vivo cos cutting was assayed with the l-P1Aÿ
mutant phages by looking for mature right and left
l chromosomal ends in ClaI-digested total cellular
DNA isolated from the induced mutant lysogens.
cos cleavage by terminase cuts a 6.3 kb cos-span-
ning ClaI restriction fragment (J) into mature left
(L; 4.2 kb) and right (R; 2.1 kb) chromosomal ends
that can be detected by Southern hybridization
(Figure 3). Once terminase has performed the DNA
nicking and strand separation activities required
for cos cleavage, it remains bound to the left end of
the chromosome to be packaged. Thus, left chro-
mosomal ends created through packaging
initiation events are protected from cellular
nucleases, but right ends are not and so are present
in smaller quantities on the gel. All ten mutants
retained cos cleavage activity when the mutations
were present in a prophage. The in vivo cos clea-
vage activities of the mutants and of two control
gpA mutants with defects in prohead binding,
Aam42 and Are636,20, 21 were quanti®ed and com-
pared to that of l-P1 A‡. The results are shown in
Table 4. While each mutant showed a reduction in
in vivo cos cleavage activity compared to wild-type
enzyme, the mutants identi®ed here showed in vivo
endonuclease activities similar to or greater than
those of the prohead binding mutants. The reduced
levels of cutting for the mutants of this study and
the control prohead binding mutants will be taken
up in the Discussion. Having con®rmed that each
of the mutants identi®ed here possesses cos clea-
vage activity, we next studied their ability to pack-
age DNA.
DNA packaging by gpA mutants
DNA packaging was studied in vivo by restric-
tion endonuclease analysis of virion DNA from
DNase-challenged lysates. In order to study DNA
packaging without cell lysis, each of the mutations

Table 3. Effect of mutations in gene A on phage yield

A allele of lP1 phage Yield: (PFU/cella) Relative yield Yield: (KnR-phage/cell)a Relative yield
‡ 1.2  102 ˆ1.0 3.1  101 ˆ1.0
G18E <1.8  10ÿ7 <1.5  10ÿ9 1.3 4.2  10ÿ2
K76R <2.0  10ÿ7 <1.7  10ÿ9 5.6  10ÿ7 1.8  10ÿ8
N166Y 1.1 9.2  10ÿ3 1.1  10ÿ1 3.5  10ÿ3
L180F 5.3  10ÿ5 4.4  10ÿ7 8.5  10ÿ3 2.7  10ÿ4
G191S 6.9  10ÿ7 5.8  10ÿ9 1.6  10ÿ6 5.2  10ÿ8
T194M 6.2  10ÿ7 5.2  10ÿ9 7.5  10ÿ3 2.4  10ÿ4
G212S 4.1  10ÿ3 3.4  10ÿ5 1.1  10ÿ2 3.5  10ÿ4
R225H 9.2  10ÿ9 7.7  10ÿ4 3.8  10ÿ1 1.2  10ÿ2
T328I 9.8  10ÿ7 8.2  10ÿ9 2.5  10ÿ1 8.1  10ÿ3
D349G 1.4  10ÿ5 1.2  10ÿ7 9.7  10ÿ1 3.1  10ÿ2
a
Lysogens were induced and titered on MF1427. Yields are numbers of plaque-forming units/induced lysogen and KnR-transdu-
cing particles/induced lysogen and are representative of three separate trials.
552  DNA Packaging Mutants

Figure 3. In vivo cos cutting by l-P1 A mutants. (a) Depiction of in vivo cos cleavage assays. (Top) Concatameric l
DNA. Right (R) and left (L) ends of adjacent chromosomes are shown. cosN sites are indicated by the boxes with
staggered vertical lines. (Middle) Cleavage of an initial cos site generates one mature right and one mature left chro-
mosomal end. Packaging proceeds left to right protecting the mature left chromosomal end from intracellular
nucleases. (Bottom) Restriction digestion of l DNA at ClaI sites yields mature right (R, 2.1 kb) and left end fragments
(L, 4.2 kb) from concatamers cut by terminase, and joint fragments (J, 6.3 kb) from chromosomal junctions that were
not cut. These restriction fragments are resolved by agarose gel electrophoresis and detected by Southern blotting. (b)
Effect of gene A mutations on the enzyme's endonuclease activity. Immature concatameric joint (J, second band,
6.3kb), mature left (L, third band, 4.2kb), and mature right (R, bottom band, 2.1kb) fragments are indicated.
Additional ClaI fragments that hybridize to the pJM1 probe include the left penultimate fragment (top band, 11.4kb)
and the right penultimate fragment (fourth band, 2.6kb). Positive controls included l-P1 and the prohead-binding
mutants l-P1 Are636 and l-P1 Aam42. The cos cleavage-defective mutant lcI857 red3 Aam11am32 served as a nega-
tive control.

was crossed into l-P1 Sam7. l-P1 Sam7 served as
a positive control and l-P1 Sam7 cos2, which does
not package DNA, served as a negative control.
Three different packaging phenotypes were
observed when induced lysogens were examined
one hour after induction (Figure 4). The L180F,
T194 M, and G212S, mutants appeared to have a
stalled translocation phenotype in which they
packaged between 5.5 kb and 22.5 kb of the 48.5
kb l chromosome. For these mutants, the BamHI
fragment representing the ®rst 5.5 kb of the l
chromosome is seen on the gel. However, packa-
ging terminates at or before the next BamHI frag-
ment, 16.8 kb further along the chromosome. The
K76R and G191S mutants packaged no DNA. The
G18E, N166Y, R225H, T328I, and D349G mutants
packaged the entire l chromosome. With these
mutants the HindIII fragment representing the last
4.3 kb of the l chromosome is seen on the gel. To
determine the total amount of DNA packaged by
each mutant relative to the wild-type control, undi-
gested packaged DNA was quanti®ed (Table 5).
Time-courses of the DNase protection assay
were performed to determine whether those
 DNA Packaging Mutants 553

Table 4. Measurements of cos cleavage by lethal gpA packaging mutants

A allele of l-P1 phage % DNA cuttinga Relative % cuttinga
‡ 51.4 (3.4) 100
G18E 1.6 (1.3) 3.1
K76R 7.9 (0.5) 15.3
N166Y 3.0 (0.5) 5.8
L180F 4.6 (1.6) 8.9
G191S 8.7 (2.4) 16.9
T194M 17.4 (4.0) 33.8
G212S 12.1 (1.1) 23.5
R225H 11.6 (2.5) 22.5
T328I 5.0 (1.1) 9.7
D349G 5.9 (2.6) 11.5
Are636 7.8 (2.0) 15.1
Aam42 4.4 (2.0) 8.6
Aam11 am32 1.3  10ÿ4 (2.2  10ÿ4) 2.5  10ÿ6
a
Percent DNA cutting re¯ects the percent of cos sites cleaved during in vivo cos cleavage assays and was determined by quantify-
ing right, left and joint chromosomal fragments from these assays. Numbers given represent the mean from three different experi-
ments. Standard deviations are given in parenthesis. Positive controls were l-P1 and the prohead binding mutants l-P1 Are636 and
l-P1 Aam42. lcI857 red3 Aam11am32 served as a negative control.

mutants that packaged none or part of the chromo-
some in one-hour packaging experiments would
show progression in DNA packaging if given more
time for packaging. The mutants' packaging phe-
notypes were compared for packaging times of one
hour, 1.5 hours, two hours, and 2.5 hours
(Figure 5). The K76R and G191S mutants, which
packaged no DNA in one-hour packaging exper-
iments, did not package any DNA even when
given 2.5 hours for packaging (data not shown).
The L180F mutant showed a stalled translocation
phenotype in which it consistently packaged
between 5.5 kb and 22.5 kb at all packaging times.
The T194M mutant showed a very slow transloca-
tion phenotype in which a larger number of further
downstream chromosome regions were packaged
as the packaging time increased. This mutant pack-
aged initial and terminal chromosome ends in
approximately equimolar amounts only when 2.5
hours were allowed for packaging. The G212S
mutant showed a stalled packaging phenotype in
which it consistently packaged between 5 kb and
31 kb at all time points. The G212S defect appears
to be leaky in that chromosomal terminal ends
were packaged and observed on the gel at longer
packaging times, albeit at a much lower frequency
than the chromosome's ®rst 31 kb. Fewer packa-
ging initiation events take place in experiments
with shorter packaging times and, therefore, less
total DNA is packaged in these experiments. Thus,
it is likely that the G212S defect is also leaky when
one hour is allowed for packaging, but because
less total DNA is packaged in these experiments,
the fragments corresponding to the chromosome's
downstream regions cannot be seen. The molar
ratio of the restriction fragments representing the
chromosome's initial and terminal ends appears to
be consistent for the G212S mutant at each of the
different packaging times examined. Thus, we
believe the G212S mutant possesses a leaky stalled,
rather than a slow translocation phenotype.

Discussion
Table 5. Measurements of total DNA packaged by lethal
gpA packaging mutants Late packaging activities of gpA
Phage Relative % DNA packageda
Previous studies have established a role for the
l-P1 Sam7 100 large subunit of bacteriophage l's terminase in the
l-P1 Sam7 A G18E 16.2 early stages of DNA packaging including endonu-
l-P1 Sam7 A K76R 0.4 cleolytic cleavage at cosN, separation of the cohe-
l-P1 Sam7 A N166Y 1.4
l-P1 Sam7 A L180F 0.8 sive ends, and prohead binding. The present work
l-P1 Sam7 A G191S 0 was directed at determining whether gpA plays a
l-P1 Sam7 A T194M 1.2 role in later stages of packaging and, if so, identify-
l-P1 Sam7 A G212S 3.4 ing regions of the protein involved in those activi-
l-P1 Sam7 A R225H 16.4
l-P1 Sam7 A T328I 17.6
ties. While it has never been shown that terminase
l-P1 Sam7 A D349G 9.3 plays an active role in post-prohead binding stages
l-P1 Sam7 cos2 0.4 of packaging, the assumption is prevalent. This
a
Relative percent DNA packaged re¯ects the percent of assumption is based on the knowledge that ATP
DNA packaged by the mutants as compared to l-P1 Sam7 dur- hydrolysis is required for packaging mature DNA
ing in vivo DNA packaging experiments. Numbers given repre- in puri®ed in vitro packaging systems and that, to
sent the mean from three different experiments. l-P1 Sam7 cos2 date, terminase is the only protein present in those
does not package DNA and served as a negative control.
systems possessing ATPase activity. Genetic
554
studies have also suggested that gpA plays a role
in later stages of DNA packaging as follows.
Frackman et al. found that the packaging defect
possessed by a l-21 hybrid phage with a chimeric
large terminase subunit could be partially over-
come by shortening the phage chromosome.11 This
argues that the unhealthy phenotype of this phage
was not due solely to defect(s) in early, pre-translo-
cation stages of packaging and, therefore, that l
 DNA Packaging Mutants
Figure 4. DNA packaging by
lethal gpA mutants. Positions of
the chromosomal restriction frag-
ments packaged ®rst, second, third,
fourth, and last are indicated. The
position of the pUC19 carrier DNA
is also indicated. Fragments from
DNase-challenged, HindIII- and
BamHI-digested lysates of mutant
or wild-type l-P1 Sam7 are shown.
l-P1 Sam7 served as a positive con-
trol and the non-packaging mutant
l-P1 Sam7 cos2 served as a nega-
tive control.
terminase does play a role in late stages of packa-
ging. Additional genetic evidence comes from the
recent identi®cation of an ATPase center in
gpA.23,24 Hang et al. changed residues 46 and 84 of
gpA, which were found to bind ATP in 8-azido-
adenosine-50 -triphosphate crosslinking studies,
through site-speci®c mutagenesis. These mutant
enzymes, while defective in ATP hydrolysis,
retained activities required for early stages of
Figure 5. Time-course of DNA
packaging by stalled/dissociated
translocation mutants. E. coli C1a
galK100 lysogens of l-P1 Sam7
AL180F, l-P1 Sam7 AT194M, and l-
P1 Sam7 AG212S were induced and
one, 1.5, two, and 2.5 hours were
allowed for phage packaging
before DNase treatment. The pos-
itions of the chromosomal restric-
tion fragments packaged ®rst,
second, third, fourth, and last are
indicated. The position of the
pUC19 carrier DNA is also indi-
cated.
 DNA Packaging Mutants
packaging, such as DNA binding and nicking at
cos and separation of the cohesive ends. However,
the mutant enzymes were defective in assembling
virions in vitro, pointing to a role for this ATPase
in post-cleavage stages of packaging.
cos cleavage by gpA mutants
The present study provides further evidence that
gpA is involved in later stages of DNA packaging.
Ten gpA mutants that retained a measurable
amount of endonuclease activity as assayed by
in vivo cos cleavage experiments (Figure 3) were
isolated and nine are believed to possess defects in
later, post-cleavage stages of packaging. While
these nine mutants show a reduction in endonu-
clease activity as compared to l-P1 A‡ (Table 4),
we believe these mutants' lethal packaging pheno-
types do not derive from defects in initial cos-
cleavage for the following reasons. First, because
wild-type l packages its concatemeric DNA sub-
strate in a processive manner, any mutation caus-
ing incomplete packaging of the initial
chromosome prevents downstream packaging.25
Due to the loss of processivity, these mutants
would show a decrease in all measurable packa-
ging activities, including cos cleavage. Second, it
has been observed during puri®cations of termi-
nase that point mutations in A that cause speci®c
defects in packaging, as opposed to general folding
defects, also cause signi®cant decreases in the
amount of active enzyme recovered (J. K. Hang &
M. F., unpublished observations). This decrease in
the amount of mutant terminase available to
catalyze the endonuclease reaction should have a
substantial effect on the amount of cos cleavage
observed for the mutants compared to the wild-
type control.
A decrease in cos cleavage activity due to a lack
of processivity and/or a decrease in correctly
assembled terminase has also been observed with
gpA prohead binding mutants. For example, it was
found that the Aam42 mutant enzyme, which lacks
the last ®ve residues, cut cos as ef®ciently as wild-
type enzyme in in vitro reactions where equal
quantities of mutant and wild-type enzyme were
assayed, but showed substantially reduced endo-
nuclease activity when assayed in vivo.20 With the
exception of the G18E mutant, all the mutants
identi®ed here had in vivo cos cleavage activities
similar to or greater than those of the prohead
binding mutants, showing that these mutants are
also defective in a post-cleavage stage of packa-
ging. In summary, we believe the decreased endo-
nuclease activity observed for these mutants is
caused by (1) the lack of processive packaging by
the mutants as compared to wild-type l, and (2) a
substantial decrease in the amount of functional
mutant enzyme produced and/or correctly pro-
cessed in cells compared to the wild-type control.
While the G18E mutant packages 16.2 % as much
total DNA as wild-type, it has relative cos cleavage
and phage yield values of only 3.1 % and 4.2 %,
555
respectively. Therefore, we cannot discount the
possibility that this mutant's low phage yield and
lethal phenotype could be caused by its low endo-
nuclease activity. The present study has identi®ed
nine mutants of gpA defective in post-cleavage
packaging activities and has helped establish a role
for terminase in late stages of DNA packaging.
DNA packaging by gpA mutants
The different packaging phenotypes of the
mutants isolated here point to several possible late
packaging functions for gpA. By examining the
packaging phenotype observed for each of the
mutants we can begin to eliminate stages of packa-
ging not affected and, therefore, in some cases
deduce the stage(s) of packaging affected.
The L180F, T194M, and G212S mutants package
part of the l chromosome. This partial packaging
capability suggests that these mutants are not
defective in complex II formation, but rather pos-
sess a translocation defect. Time-course packaging
experiments show that two of the mutants, L180F
and G212S, stop DNA translocation after part of
the chromosome has been packaged even when
given 2.5 hours for packaging (Figure 5). This par-
tial packaging could be caused either by a stalling
of translocation, in which the translocation com-
plex is still assembled but quits translocating the
DNA, or by disassembly of an unstable transloca-
tion complex. A stalled or disassembled transloca-
tion phenotype could result from any of several
possible defects. For example, one can envision a
structural defect that would allow complex II for-
mation and the start of DNA translocation, but
eventually would cause the mutant protein or the
entire translocation complex to disassemble such
that DNA can no longer be translocated. As gpA's
role in DNA translocation is not well understood
there are many imaginable possibilities for a struc-
tural defect that could explain the leaky packaging
phenotype seen with the G212S mutant and the
variable lengths of DNA packaged by both the
L180F and G212S mutants (Figure 5). A motor that
is not bolted together properly might run for a
while, but will eventually fall apart. The point
along the concatemeric substrate at which a defec-
tive translocation motor disassembles would
depend on the structural importance of the chan-
ged residue, and could vary from one packaging
event to another. Thus, with a large number of
packaging events, a broad range of DNA lengths
could be packaged and, with changes in residues
of less structural importance or under less strain,
the entire chromosome could be packaged
occasionally. Another type of structural defect
could affect the removal of DNA-binding proteins,
such as polymerases, and in turn prevent the
packaging substrate from being translocated into
the capsid. It is not known how these proteins are
removed. Terminase may perform this function
and remove these proteins from the DNA substrate
as they reach the translocation protein complex. A
556
structural defect in terminase that prevents this
activity could lead to a stalling of translocation or
dissociation of the translocation complex when it
encounters the ®rst of these DNA-binding proteins.
In this scenario, a broad range of DNA lengths,
even the entire chromosome, could be packaged
and would give the observed translocation pheno-
type.
A different phenotype is observed with the
T194M mutant. This mutant possesses a slow-
packaging phenotype in which a larger number of
further downstream chromosomal regions are
packaged as the time allowed for packaging
increases (Figure 5). This phenotype could be
caused by defects similar to the ones described
above. For example, a structural defect could cause
slippage during DNA translocation, increasing the
time required for packaging the whole chromo-
some compared to wild-type. A slow-packaging
phenotype could also result if the residue changed
is part of the translocation ATPase center. Inef®-
cient ATP binding or hydrolysis could lengthen the
time required for packaging the whole chromo-
some. Alternately, the T194M change may affect a
gpA region responsible for transferring the energy
from ATP hydrolysis to another protein, such as
the portal, or to another region of gpA involved in
DNA translocation. Any slippage in this transfer of
energy could also affect the rate of packaging.
A very different packaging phenotype is
observed with the K76R and G191S mutants. Both
mutants fail to package any DNA (Figure 4), even
in 2.5-hour packaging experiments (data not
shown). These mutants could have defects in pro-
head binding or in DNA translocation. While a
domain necessary for prohead binding has been
identi®ed at the C-terminal end of gpA, additional
regions of the protein might also be involved.
However, because of the locations of the K76R and
G191S mutations relative to the other mutations
identi®ed here and in the study of Hang et al.,24 a
defect in DNA translocation is a likely explanation
for their lethal phenotypes. The total abolishment
of DNA packaging caused by the conservative
amino acid substitution of the K76R mutant
suggests that this is a critical residue. Residues 46
and 84 were shown by Hang et al. to be necessary
for a post-cleavage ATPase activity of gpA24 and,
thus, residue 76 may be involved in the transloca-
tion ATPase activity. The G191S mutant is located
in the middle of the cluster of translocation defect
mutants, only three residues away from the slow
packaging mutant T194 M. Thus it is very likely
that the packaging phenotype observed for G191S
is also caused by a defect in DNA translocation.
Still another phenotype is observed for the
N166Y, R225H, T328I, and D349G mutants. These
mutants, while lethal, package the entire chromo-
some (Figure 4). There are several possible packa-
ging termination defects that could result in such a
phenotype. Because the terminal chromosomal
restriction endonuclease fragments for these
mutants are of the correct size, their translocation
 DNA Packaging Mutants
complexes do not appear to be defective in term-
inal cos recognition. However, a defect causing
aberrant cutting or a total lack of terminal cos clea-
vage such that chromosome circularization cannot
take place upon infection is possible and would
give the observed lethal phenotype. Alternately,
these residues could be involved in terminal strand
separation activity. Finally, a defect in which termi-
nase fails to dissociate from the ®lled head follow-
ing terminal cos cleavage would prevent tail
attachment, causing a lethal defect in phage pro-
duction. The packaging defect possessed by the
N166Y mutant may be further deduced by compar-
ing its cos cleavage and DNA packaging pheno-
types. This mutant possesses a relative
endonuclease activity of 5.8 % and packages the
entire chromosome, but packages only 1.4 % as
much total DNA as wild-type. Thus, the lethal phe-
notype seen with this mutant is most likely not
caused by a defect in packaging termination, but
rather by a slightly leaky defect in prohead binding
or DNA translocation.
The G18E mutant also packages the entire
chromosome (Figure 4) and packages 16.2 % as
much DNA as wild-type. Therefore, like the above
mutants, this mutant may be defective in packa-
ging termination. However, unlike the above
mutants, the G18E mutant has greatly reduced
endonuclease activity (only 3.1 % that of wild-type
and one-®fth and one-third that of the Are636 and
Aam42 prohead binding mutants, respectively)
which could also account for its lethal phenotype.
Small discrepancies between relative cleavage and
packaging may be explained by the different virus
assembly times allotted in the two assays. How-
ever, the large discrepancy in relative cleavage and
packaging seen with this mutant, together with the
mutation's location, points to a probable general
defect in terminase function. Residue 18 is located
in the gpNu1-interacting domain of gpA. There-
fore, the G18E change may cause a slight defect in
holoenzyme formation that affects both early and
late terminase functions.
Functional domains of gpA
The group of mutants isolated here provides
information about gpA's functional domains.
While past studies demonstrated that the carboxy-
terminal third of gpA is required for the endonu-
clease, strand-separation, and prohead-binding
activities of DNA packaging, the present study
demonstrates that an entirely separate, non-over-
lapping, amino-terminal region of the protein is
needed for later, post-cleavage packaging activities.
Our work shows that, at the primary structure
level, gpA possesses functional domains for its
endonuclease and post-cleavage packaging activi-
ties (Figure 6). In addition, based on the observed
packaging phenotypes of the mutants isolated here
and those of Hang et al., we can begin to divide
the amino-terminal two-thirds of the protein into
separate functional domains. Hang et al. showed
 DNA Packaging Mutants 557

Figure 6. Clustering of gpA mutational phenotypes. The amino-terminal end of gpA contains a domain through
which gpA interacts with gpNu1 (gpNu1)11,12 and a region (ATPase) where mutations affecting ATP binding and
hydrolysis, and post-cleavage stages of packaging have been found.23,24 At its carboxy-terminal end gpA contains a
sequence that resembles the P-loop of known ATPases (P-loop),15 a basic leucine zipper DNA binding motif (bZIP),13
and a domain through which the enzyme interacts with the prohead (Prohead).19 ± 22 Mutations isolated by Davidson
and Gold (~)13 and Hwang et al. (*)16,18 that affect the endonuclease activity of terminase are located in the car-
boxy-terminal third of gpA. The mutations identi®ed in this study (*) are located in the amino-terminal two-thirds of
gpA and, with the exception of G18E, affect post-cleavage stages of packaging. See the text for details.

that residues 46 and 84 are necessary for a post-
cleavage ATPase activity.24 This region of the
protein might contain the ATPase that powers
DNA translocation. The cluster of translocation
defective mutants isolated here, including L180F,
T194 M, and G212S, points to a region of the pro-
tein involved in DNA translocation. Another
group of mutants including R225H, T328I, and
D349G all possess packaging termination defects
and thus point to another possible functional
domain of gpA.
Separation of function with respect to the pri-
mary sequence has not only been observed in l,
but also in terminases of other double-stranded
DNA bacteriophages. However, it is interesting to
note that the various functional domains do not
always occur in the same regions of the different
terminases studied. For example, functional
domains involved in cos cleavage and prohead
binding are located at the carboxy-terminal end of
gpA. However, mutations in gene 17 encoding the
large subunit of T4's terminase that cause the pro-
duction of empty heads, indicative of an endonu-
clease or prohead binding defect, are located in the
50 region of this gene.26 Also, the mutations pre-
sented here that cause a stalled/dissociated trans-
location phenotype are located at the 50 end of
gene A, while mutations in gene 17 that result in
the accumulation of partially ®lled heads are
located at the 30 end of the gene. This divergence
in the arrangement of functional domains is also
interesting from an evolutionary standpoint. The
bacteriophages for which packaging has been stu-
died show notable similarities, such as gene
arrangement on the chromosome and terminases
composed of a large and small subunit. These simi-
larities have led to the belief that these phages
have a common ancestor. How the divergence in
functional domain arrangement occurred without a
loss of viability is an interesting question.
While gpA can be divided into separate func-
tional domains, there is no evidence that the ter-
tiary structure is composed of separate structural
domains. In fact, unpublished studies from our lab-
oratory indicate the opposite. When terminase was
digested with different proteases no consistent pat-
tern of digestion was seen among the different pro-
teases used (J. Q. Hang & M.F., upublished
results). Terminase not only performs many differ-
ent activities, but also performs them in a speci®c
order. With such an enzyme it can be proposed
that the engagement of one activity, such as ATP
binding and/or hydrolysis, could change the con-
formation of the protein so that it is ready to per-
form the next required activity. Thus,
bacteriophage l's terminase may not be composed
of distinct structural domains that comprise a
single tertiary structure. Instead, terminase may be
composed of several interacting functional
domains that undergo a series of structural trans-
formations.
Understanding DNA packaging by bacterio-
phage l will aid in the understanding of packaging
by other double-stranded DNA viruses, such as
the herpes viruses and poxviruses. The study of
viral DNA translocation will answer questions con-
cerning the mechanism of this and other molecular
motors. The present study has increased our
understanding of terminase's role in packaging
and of regions of gpA involved in DNA transloca-
tion and packaging termination.
558
Materials and Methods
Media and reagents
Luria broth (LB) and Luria agar (LA) were prepared
as described.27 Tryptone broth (TB), tryptone agar (TA),
and tryptone soft agar (TBSA) were prepared as
described28 except that each was supplemented with
0.01 M MgSO4. Kanamycin and ampicillin were used at
®nal concentrations of 50 and 100 mg/ml, respectively.
Isopropylthio-b-D-galactoside (IPTG) and X-gal were
used in LA at ®nal concentrations of 0.1 mM and 0.02 %
(w/v), respectively.
Phages, bacterial strains and plasmids
Bacterial and phage strains used are listed in Table 6.
l-P1:5R cI857 KnR nin5 and l-P1:5R cI857 Sam7 KnR
nin5, referred to as l-P1 and l-P1 Sam7, were the stan-
dard phages into which the A gene mutations were
crossed. The l-P1 hybrid phage carries a 10 kb segment
of phage P1 DNA encoding functions for plasmid repli-
cation and partitioning, and a 1.3 kb kanamycin resist-
ance cassette.29 The cI857 repressor is inactivated at
42  C, allowing temperature induction of the lytic growth
cycle. l-P1 has a genome size of approximately 46.2 kb,
compared to a genome size of 48.5 kb for wild-type
l.30,31 The Sam7 mutation causes a defect in cell lysis
allowing phage production to continue past the normal
lysis time. The cloning vectors used were pBluescript
SK‡ and pBluescript KS‡. Plasmid pJM1 is a derivative
of pBR322 that carries the HindIII (l bp 44,141) to BamHI
(l bp 5505) cos-spanning segment of l DNA into which
an XbaI site was inserted at bp 48,447.10
The four plasmids used for the marker rescue exper-
iments were constructed as follows. The A gene, encoded
by l bp 711-2633, was divided into four segments which
were ampli®ed by PCR using standard methods and pri-
mers containing restriction sites. Segments 1 through 4
encompass l bp 689-1228, 1225-1828, 1825-2263, and
2260-2820, respectively. After digestion with the appro-
priate restriction enzymes, the PCR products were
cloned in a non-reading orientation into either pBlue-
Table 6. Bacterial strains and phages used
Strain Relevant genotype
E. coli strains
AY331 MF1427 (l-P1:5R cI857 Are636 KnR)
MF1427 C1a galK100
MF1894 MF1427 (l-P1:5R cI857 Sam7 KnR)
MF1963 OR1265 carrying the terminase expression vector pCM101
MF1968 C4518: Fÿ argEam btuB::Tn10 supF
MF1974 C1a galKam recA
MF2449 C1a zae-13::Tn10 mutD
MF2530 MF1427 (l-P1:5R cI857 cos2 KnR)
MF2539 MF1427 (l-P1:5R cI857 KnR)
MF2734 MF1427 (l-P1:5R cI857 Aam42 KnR)
MF2735 MF1974 (l cI857 red3 Aam11am32)
MF2847 MF1427 (l-P1:5R cI857 Sam7 cos2 KnR)
Phages
f299 l cI857
f395 l-80 hy 2 1am3 imm434 cI
f398 l cI857 red3 Wam403
f497 l cI857 red3 Aam11 am32
f507 l cI857 red3 Bam1
 DNA Packaging Mutants
script KS‡ (segments 1 and 3) or pBluescript SK‡ (seg-
ments 2 and 4).
Sequence designations
All references to the l sequence are based on the
established numbering system.32 The ®rst base of the 50
end of the left (l) strand (top strand) is designated 1 and
the numbering proceeds left to right (50 to 30 ) along the l
strand.
Enzymes and general recombinant DNA techniques
Restriction enzymes, T4 DNA ligase, and the Klenow
fragment of DNA polymerase I were purchased from
New England Biolabs and Boehringer-Mannheim and
used as recommended by the manufacturers. Taq DNA
polymerase (TaqBeadTM Hot Start Polymerase) was pur-
chased from Promega (Madison, WI) and used under
conditions recommended by the manufacturer. Oligonu-
cleotides used as primers for PCR and sequencing reac-
tions were synthesized by and purchased from
Integrated DNA Technologies Inc., Coralville, IA.
Standard recombinant DNA procedures were employ-
ed.33 Plasmid DNA was prepared using either the QIA-
prep Spin Miniprep Kit or the Plasmid Midi Prep Kit
(both by Qiagen Inc.). Transformation of competent cells
was performed as described.34 All sequencing reactions
were performed using dye terminator cycle sequencing
chemistry with AmpliTaq DNA polymerase, FS enzyme
(PE Applied Biosystems). The reactions were analyzed
with an Applied Biosystems Model 373A stretch ¯uor-
escent automated sequencer at the University of Iowa
DNA Facility.
General mutagenesis by E. coli mutD
General mutagenesis of genes carried by the plasmid
pJM1 was performed using the E. coli mutD strain
MF2449. To reduce the number of sibling mutants, sev-
eral cultures of MF2449 were made competent and trans-
formed with pJM1. After overnight growth on LA plus
ampicillin at 37  C, colonies were used to start cultures
grown overnight in LB plus ampicillin at 37  C. Plasmid
Source or reference
21
40
This work
36
41
42
M. Sunshine (Iowa City)
38
39
20
This work
Feiss collection
43
44
Feiss collection
19
Feiss collection
 DNA Packaging Mutants
preps were performed on the overnight cultures to
obtain mutagenized plasmid DNA. The frequency of
mutagenesis of a single gene by this method was
roughly predetermined to be 0.5-1.0 %.
In vivo cos cleavage assays
In vivo cos cutting activity was studied using a modi®-
cation of the assay described by Murialdo and Fife.35
Overnight cultures were diluted 100-fold into 10 ml LB
and were grown at 31  C with aeration to a cell density
of approximately 5x107 cells/ml. The cultures were
induced at 42  C for 15 minutes and then incubated at
37  C with aeration for 20 minutes. The cells were har-
vested and nucleic acids were extracted as described.20
BstXI or ClaI-digested DNAs were separated by
electrophoresis through a 0.8 % (w/v) agarose gel and
transferred to a GeneScreen Plus membrane (NENTM
Life Science Products Inc.). DNA hybridizations were
performed using 32P-labeled, SalI-linearized pJM1 as
probe.
Protein analysis by Western blot
Cell extracts were prepared from induced MF1974
lysogens of l Aam carrying either mutagenized or
unmutagenized pJM1 by boiling collected cells in the
presence of SDS. For a marker of gpA, a sonicated crude
extract of wild-type terminase was prepared from a
culture of MF1963 (OR1265 carrying the terminase
expression vector pCM101) as described by Chow et al.36
The conditions used for growth and induction of lyso-
gens and the preparation of extracts have been
described.37 The terminase crude extract marker and
each of the gpA mutant crude extracts were subjected to
electrophoresis through a 4.5 % stacking gel and a 12.5 %
separating SDS-polyacrylamide gel. After transfer to a
HybondTM-C pure nitrocellulose membrane (Amersham
Life Science, Buckinghamshire, England), gpA was
probed with anti-terminase polyclonal antibody.
Genetic analyses
The various A gene mutations were introduced into
l-P1 and l-P1 Sam7 via crosses between the pJM1
plasmids bearing mutations in A and l-P1 cos2 and l-P1
Sam7 cos2 as described by Cue and Feiss.38 Standard
methods were used for complementations, marker rescue
tests, and burst size determinations.38,39
In vivo DNase protection assays
Overnight cultures of MF1427 lysogens of wild-type
and mutant l-P1 Sam7s were diluted 100-fold into 50 ml
LB and were grown at 31  C with aeration to a cell den-
sity of approximately 5  107 cells/ml. The cultures were
induced at 42  C for 20 minutes then incubated at 37  C
with aeration for one hour. The cells were harvested by
centrifugation and resuspended in 0.5 ml of DNase buf-
fer (40 mM Tris (pH 8.0), 10 mM MgSO4, 1.0 mM CaCl2,
10 mM putrescine) containing 25 units of RQ1 RNase-
Free DNase (Promega Corporation) and 25 units of
RNase, DNase-free (Boehringer Mannheim). To allow
cell lysis in the presence of the DNase, 150 ml of CHCl3
was added to the suspension. The lysates were incubated
at 37  C for one hour to allow degradation of all unpack-
aged DNA. The suspension was clari®ed by centrifu-
gation and the top phase was transferred to a new tube.
559
DNase activity was stopped by the addition of EDTA to
50 mM. One mg of pUC19 DNA was added as a carrier
to increase the recovery of packaged DNA. Packaged
DNA was recovered and cleaned through four phenol
extractions, one CHCl3-isoamyl extraction, and ethanol
precipitation. The cohesive ends of HindIII and BamHI-
digested DNAs were separated by incubation at 70  C in
the presence of the following left cohesive end-binding
oligonucleotide:
30 CCCCCCCC
jjjjjjjj
50 AGGTCGCCGCCCGGGGGGGG
After electrophoresis through a 0.6 % agarose gel,
nucleic acids were stained by soaking the gel in SYBRTM
Green I nucleic acid gel stain (Molecular Probes, Eugene,
OR).
DNA packaging activity was quanti®ed using the
above protocol for the puri®cation of packaged DNA.
The undigested DNAs were electrophoresed through a
0.8 % agarose gel containing 0.5 mg/ml ethidium bro-
mide. After electrophoresis the DNA was transferred to
a GeneScreen Plus membrane (NENTM Life Science Pro-
ducts Inc., Boston, MA). DNA hybridizations were per-
formed using 32P-labeled l DNA as a probe. An
InstantImagerTM (Packard, Meriden, CT) electronic auto-
radiographer was used to quantify the hybridized, radio-
labeled probe.
Time-courses of DNA packaging activity were per-
formed using the same protocol but varying the time
allowed for packaging at 37  C following the 42  C
induction.
Acknowledgments
We thank our co-workers Qi Hang, Jenny Meyer, Jean
Sippy, and Doug Wieczorek for advice and interest
during the course of this work. This work was supported
by National Institutes of Health (NIH) Research Grant
GM-51611.
References
1. Gold, M. & Becker, A. (1983). The bacteriophage l
terminase: partial puri®cation and preliminary
characterization of properties. J. Biol. Chem. 258,
14619-14625.
2. Higgins, R. R., Lucko, H. J. & Becker, A. (1988).
Mechanism of cos DNA cleavage by bacteriophage
lambda terminase: multiple roles of ATP. Cell, 54,
765-775.
3. Cue, D. & Feiss, M. (1993). The role of cosB, the
binding site for terminase, the DNA packaging
enzyme of bacteriophage lambda, in the nicking
reaction. J. Mol. Biol. 234, 594-609.
4. Yang, Q. & Catalano, C. E. C. (1997). Kinetic charac-
terization of the strand separation (``helicase'')
activity of the DNA packaging enzyme from bac-
teriophage l. Biochemistry, 36, 10638-10645.
5. Becker, A., Murialdo, H. & Gold, M. (1977). Early
events in the in vitro packaging of bacteriophage
DNA. Virology, 78, 291-305.
6. Davidson, A. & Gold, M. (1987). A novel in vitro
DNA packaging system demonstrating a direct role
560
for the bacteriophage l FI gene product. Virology,
161, 305-315.
7. Becker, A., Murialdo, H., Lucko, H. & Morell, J.
(1988). Bacteriophage lambda DNA packaging. The
product of the FI gene promotes the incorporation
of the prohead to the DNA-terminase complex.
J. Mol. Biol. 199, 597-607.
8. Hwang, Y. & Feiss, M. (1995). A de®ned system for
in vitro lambda DNA packaging. Virology, 211, 367-
376.
9. Becker, A. & Gold, M. (1988). Prediction of an ATP
reactive center in the small subunit, gpNu1, of the
phage lambda terminase enzyme. J. Mol. Biol. 199,
219-222.
10. de Beer, T., Fang, J., Ortega, M., Yang, Q., Maes, L.,
Duffy, C. et al. (2002). Insights into speci®c DNA
recognition during assembly of a viral genome
packaging machine: structure and genetics of the
DNA binding domain of gpNu1. Molecular Cell, in
the press.
11. Frackman, S., Siegele, D. A. & Feiss, M. (1985). The
terminase of bacteriophage lambda. Functional
domains for cosB binding and multimer assembly.
J. Mol. Biol. 183, 225-238.
12. Wu, W. F., Christiansen, S. & Feiss, M. (1988).
Domains for protein-protein interactions at the N
and C termini of the large subunit of bacteriophage
lambda terminase. Genetics, 119, 477-484.
13. Davidson, A. & Gold, M. (1992). Mutations abolish-
ing the endonuclease activity of bacteriophage l
terminase lie in two distict regions of the A gene,
one of which may encode a leucine zipper DNA
binding domain. Virology, 161, 305-315.
14. Hwang, Y., Catalano, C. E. & Feiss, M. (1996). Kin-
etic and mutational dissection of the two ATPase
activities of terminase, the DNA packaging enzyme
of bacteriophage l. Biochemistry, 35, 2796-2803.
15. Guo, P., Peterson, C. & Anderson, D. (1987). Pro-
head and DNA-gp3-dependent ATPase activity of
the DNA packaging protein gp16 of bacteriophage
f29. J. Mol. Biol. 197, 229-236.
16. Hwang, Y. & Feiss, M. (1996). Mutations affecting
the high af®nity ATPase center of gpA, the large
subunit of bacteriophage lambda terminase, inacti-
vate the endonuclease activity of terminase. J. Mol.
Biol. 261, 524-535.
17. Rubinchik, S., Parris, W. & Gold, M. (1994). The
in vitro ATPases of bacteriophage lambda terminase
and its large subunit, gene product A. The relation-
ship with their DNA helicase and packaging activi-
ties. J. Biol. Chem. 269, 13586-13593.
18. Hwang, Y., Hang, J. Q., Neagle, J., Duffy, C. &
Feiss, M. (2000). Endonuclease and helicase activities
of bacteriophage l terminase: changing nearby resi-
due 515 restores activity to the gpA K497D mutant
enzyme. Virology, 277, 204-214.
19. Frackman, S., Siegele, D. A. & Feiss, M. (1984). A
functional domain of bacteriophage lambda termi-
nase for prohead binding. J. Mol. Biol. 180, 283-300.
20. Sippy, J. & Feiss, M. (1992). Analysis of a mutation
affecting the speci®city domain for prohead binding
of the bacteriophage lambda terminase. J. Bacteriol.
174, 850-856.
21. Yeo, A. & Feiss, M. (1995). Mutational analysis of
the prohead binding domain of the large subunit of
terminase, the bacteriophage lambda DNA packa-
ging enzyme. J. Mol. Biol. 245, 126-140.
22. Yeo, A. & Feiss, M. (1995). Speci®c interaction of
terminase, the DNA packaging enzyme of bacterio-
 DNA Packaging Mutants
phage lambda, with the portal protein of the pro-
head. J. Mol. Biol. 245, 141-150.
23. Babbar, B. K. & Gold, M. (1998). ATP-reactive sites
in the bacteriophage l packaging protein terminase
lie in the N-termini of its subunits, gpA and gpNu1.
Virology, 247, 251-264.
24. Hang, J. Q., Tack, B. F. & Feiss, M. (2000). ATPase
center of bacteriophage l terminase involved in
post-cleavage stages of DNA packaging: identi®-
cation of ATP-interactive amino acids. J. Mol. Biol.
302, 777-795.
25. Emmons, S. W. (1974). Bacteriophage lambda
derivatives carrying two copies of the cohesive end
site. J. Mol. Biol. 83, 511-525.
26. Lin, H., Rao, V. B. & Black, L. W. (1999). Analysis of
capsid portal protein and terminase functional
domains: interaction sites required for DNA packa-
ging in bacteriophage T4. J. Mol. Biol. 289, 249-260.
27. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982).
Molecular Cloning, A Laboratory Manual, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, NY.
28. Arber, W., Enquist, L., Hohn, B., Murray, N. E. &
Murray, K. (1983). Experimental methods for use
with lambda. In Lambda II (Hendrix, R. W., Roberts,
J. W., Stahl, F. W. & Weisberg, R. A., eds), pp. 433-
366, Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, NY.
29. Sternberg, N. & Austin, S. (1983). Isolation and
characterization of P1 minireplicons, l-P1:5R and l-
P1:5L. J. Bacteriol. 153, 800-812.
30. Pal, S. K. & Chattoraj, D. K. (1988). P1 plasmid repli-
cation: initiator sequestration is inadequate to
explain control by initiator-binding sites. J. Bacteriol.
172, 2819-2824.
31. Sanger, F., Coulson, A. R., Hong, G. F., Hill, D. F.
& Petersen, G. B. (1982). Nucleotide sequence of
bacteriophage lambda DNA. J. Mol. Biol. 162, 729.
32. Daniels, D., Schroeder, J., Szybalski, W., Sanger, F.,
Coulsen, A., Hong, D. et al. (1983). Completed anno-
tated lambda sequence. In Lambda II (Robers, J.,
Stahl, F. & Weisberg, R., eds), pp. 519-676, Cold
Spring Harbor Laboratory Press, Cold Spring
Harbor, NY.
33. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989).
Molecular Cloning: A Laboratory Manual, 2nd edit.,
Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, NY.
34. Hanahan, D. (1983). Studies on transformation of
Escherichia coli with plasmids. J. Mol. Biol. 166, 557-
580.
35. Murialdo, H. & Fife, W. L. (1987). Synthesis of a
trans-acting inhibitor of DNA maturation by pro-
head mutants of phage l. Genetics, 115, 3-10.
36. Chow, S., Daub, E. & Murialdo, H. (1987). The over-
production of DNA terminase of coliphage lambda.
Gene, 60, 277-289.
37. Murialdo, H., Fife, W. L., Becher, A., Feiss, M. &
Yochem, J. (1981). Bacteriophage lambda DNA
maturation. The functional relationships among the
products of genes Nul, A and FI. J. Mol. Biol. 145,
375-404.
38. Cue, D. & Feiss, M. (1992). Genetic analysis of
mutations affecting terminase, the bacteriophage
lambda DNA packaging enzyme, that suppress
mutations in cosB, the terminase binding site. J. Mol.
Biol. 228, 72-87.
39. Cue, D. & Feiss, M. (1992). Genetic analysis of cosB,
the binding site for terminase, the DNA packaging
 DNA Packaging Mutants
enzyme of bacteriophage lambda. J. Mol. Biol. 228,
58-71.
40. Six, E. & Klug, C. A. C. (1973). Bacteriophage P4: a
satellite virus depending on a helper such as proph-
age P2. Virology, 51, 327-344.
41. King, R. A., Anders, D. L. & Christie, G. E. (1992).
Site-directed mutagenesis of an amino acid residue
in the bacteriophage P2 Ogr protein implicated in
interaction with Escherichia coli RNA polymerase.
Mol. Microbiol. 6, 3313-3320.
(Received 21 August 2001; received in revised form 12 December 2001; accepted 12 December 2001)
561
42. Ghisotti, D., Chiaramonte, R., Forti, F., Zangrossi, S.,
Sironi, G. & Deho, G. (1992). Genetic analysis of the
immunity region of phage-plasmid P4. Mol. Micro-
biol. 6, 3405-3413.
43. Sussman, R. & Jacob, F. (1962). Sur un systeme de
repression thermosensible chez le bacteriophage
lambda d' Escherichia coli. Compt. Rend. Acad. Sci.
254, 1517.
44. Weisberg, R. A., Sternberg, N. & Gallay, E. (1979).
The Nu1 gene of coliphage lambda. Virology, 95, 99-
106.
Edited by M. Gottesman