Virology 282, 87–101 (2001)

doi:10.1006/viro.2000.0819, available online at http://www.idealibrary.com on

The 3⬘ End of Hepatitis E Virus (HEV) Genome Binds Specifically

to the Viral RNA-Dependent RNA Polymerase (RdRp)

Shipra Agrawal, Dinesh Gupta, 1 and Subrat Kumar Panda 2

Department of Pathology, All India Institute of Medical Sciences, Ansari Nagar, New Delhi 110029, India

Received May 16, 2000; returned to author for revision June 20, 2000; accepted December 26, 2000

Hepatitis E virus (HEV) is the major cause of acute epidemic and sporadic hepatitis in the developing world. It is a
positive-strand RNA virus with a genome length of about 7.2 kb. The replication mechanism of this virus is virtually
unexplored. Identification of the regulatory elements involved in initiation of replication may help in designing specific
inhibitors for therapy. In the positive-stranded RNA viruses the initiation of replication requires interaction of the 3⬘ end of
genome with its RNA-dependent RNA polymerase (RdRp) and possibly host-derived cofactors for synthesis of the minus-
strand replicative intermediate. Secondary structure prediction of the conserved 3⬘ end of the infectious HEV genome was
carried out to identify possible stem-loop structures necessary for RNA-protein interaction and the model was confirmed by
structure probing experiments. Electrophoretic mobility-shift assays showed specific binding of purified and refolded
recombinant HEV RdRp protein to the 3⬘ end of its RNA genome containing the poly(A) stretch. Mutations at the 3⬘ end, in
which the stem-loop structures were partially or completely destroyed or recreated revealed that the two stem-loop
structures SL1 and SL2 at the 3⬘ end and the poly(A) stretch are necessary for this binding. The interacting nucleotides in
such an interaction were further identified by generating footprints of the complex by Pb(II)-induced hydrolysis. This specific
binding of viral RdRp to the 3⬘ end of HEV RNA directs the synthesis of complementary-strand RNA and thus such a binding
domain might assume the role of a possible cis-acting element as a potential site for the initiation of replication. © 2001
Academic Press

INTRODUCTION functional domains are yet to be identified. ORF 2 en-

Hepatitis E virus (HEV) is the major etiological agent
responsible for large epidemics as well as many spo-
radic cases of acute viral hepatitis in much of the devel-
oping world (Khuroo, 1980, 1991; Nanda et al., 1994a;
Panda et al., 1989; Ray et al., 1991; Reyes et al., 1991;
Wong et al., 1980). New recommendations of the Inter-
national Committee on the Taxonomy of Viruses (http://
www.ncbi.nlm.nih.gov/ICTV/) now place HEV into a sep-
arate family called hepatitis E-like viruses. The viral ge-
nome is a single-stranded ⬃7.2-kb polyadenylated RNA
of positive sense containing three open-reading frames
(ORFs) (Panda and Jameel, 1997; Purdy et al., 1993). ORF
1 encodes the putative nonstructural polyprotein includ-
ing domains representative of (a) a viral methyltrans-
ferase, (b) a papain-like cysteine protease, (c) a RNA
helicase, and (d) a viral RNA-dependent RNA polymerase
(Koonin et al., 1992). However, the exact cleavage sites
on the nonstructural polyprotein giving rise to various
1
Dr. Dinesh Gupta is currently undergoing a bio-informatics training
program funded by WHO, in the Department of Biology at University of
Pennsylvania, PA.
2
To whom correspondence should be addressed at Department of
Pathology, AIMS, Ansari Nagar, New Delhi 110 029, India. Fax: 91-11-
686-2663. E-mail: pandask@hotmail.com; skpanda@medinst.ernet.in.
87
codes a ⬃88-kDa glycoprotein that is the major viral
capsid protein (Jameel et al., 1996) and ORF 3 encodes a
13.5-kDa phosphoprotein of unknown function (Zafrullah
et al., 1997). The coding sequences in the HEV genome
are flanked by 5⬘ and 3⬘ noncoding regions (NCRs) which
are 27 and 68 nucleotides long, respectively (Tam et al.,
1991). The noncoding regions of the positive-strand viral
RNA genomes are known to function as cis-acting ele-
ments for the genomic RNA replication via interaction
with viral or cellular proteins (Oh et al., 2000; Hwang and
Brinton, 1998; Kuhn et al., 1990; Rohll et al., 1994; Song
and Simon, 1995; Tiley et al., 1994; Yu and Leibowitz,
1995a). The 3⬘ end of the viral RNA has been specifically
implicated as the site for the initiation of replication in
these viruses.
Recently we have developed an infectious cDNA clone
of HEV, which not only produces replicative intermedi-
ates but also processed viral proteins and infectious
virus (Panda et al., 2000). These infection studies indi-
cated that the HEV follows a replication strategy involv-
ing a negative-strand intermediate similar to those of
other positive-strand RNA viruses. In lieu of this fact, one
approach to study HEV replication would be to work
toward the identification of the cis-acting elements in the
RNA and the viral and the cellular proteins interacting
with it to possibly form a replication complex. Information
0042-6822/01 $35.00
Copyright © 2001 by Academic Press
All rights of reproduction in any form reserved.
88 AGRAWAL, GUPTA, AND PANDA

FIG. 1. (A) Secondary structure prediction of the 3⬘ end (nt 7084–7194 A n) of HEV RNA (Indian isolate) using the MFOLD (Zuker) program. The two
stem-loop structures, SL1 and SL2, comprise nt 7173–7194 and 7089–7163, respectively, and the single-strand region (SS) extends from 7164 to 7172
nt. The SL1 structure involves the poly(A) stretch at its 3⬘ end. Hairpin loop, interior loop, and stem regions a and b within SL1 have also been
designated. Nucleotide variations found in other isolates are indicated by arrows (PAK, Pakistan; CHI, China; MYN, Mynamar). Free energy of the
predicted structure is ⫺24.9 kcal/mol. (B) Summary of the experimental data of chemical and enzymatic structure probing. Nucleotides within the
native RNA that were determined to be susceptible to Pb(II) and RNases are labeled (p, Pb 2⫹; o, ribonuclease I; s, S1 nuclease; m, mung bean
nuclease). Nucleotides prone to Pb(II) hydrolysis in the RNA-RdRp complex are shown in brackets.

regarding the replication control may help to design
strategies for intervention.
In the present study we have focused on the interac-
tion of the recombinant viral RNA-dependent RNA poly-
merase with the 3⬘ end of HEV genome because such an
interaction would possibly offer a potential initiation step
in the replication of the HEV genome. Computer-assisted
prediction of the thermodynamically stable structure of
the 3⬘ end of HEV RNA has been carried out to identify
the elements essential for RNA-protein interaction. Solu-
tion structure studies by metal ion and enzymatic probing
of the RNA have been done to confirm the predicted
structure. RNA-RdRp protein interaction has been ana-
lyzed by binding studies and major interacting motifs
have been identified by mutational analysis, com-
pounded by RNA footprinting experiments. In vitro poly-
merase activity of the recombinant RdRp is also studied
at the 3⬘ end to produce a complementary strand of HEV
RNA.
RESULTS
Structural analysis of the 3⬘ end
The nucleotide sequence analysis of the 3⬘ noncod-
ing region of the full-length HEV sequences in Gen-
Bank [India (AF076239), Pakistan (M80851), Myanmar
(M73218), China (L08816), and Mexico (M74506)] showed
a high degree of homology with very few C3U variations
in Pakistani, Myanmar, and Chinese isolates and a single
A3G variation in the Mynamar isolate (Fig. 1A). The
Mexican isolate had 9 nucleotides extra at the 3⬘ end
and showed quite a few variations within the sequence.
Secondary structure prediction of the last 300 nucleo-
tides at the 3⬘ end of five different isolates indicated the
 RNA-RdRp INTERACTIONS AT THE 3⬘ END OF HEV RNA
presence of a number of stem and loops, two stem-loop
structures of which at the extreme 3⬘ end were found to
be conserved among all viral isolates with minor differ-
ences in the Mexican isolate. This conserved region
spans nucleotide positions 7084 to 7194 in the Indian
isolate of HEV and the predicted structure of the last 110
bases of the Indian isolate is shown in Fig. 1A. Stem-loop
structures 1 and 2 (SL1, SL2) comprise nucleotides 7173–
7194 and 7089–7163, respectively, separated by a single-
strand region (SS) of nt 7164–7172. The SL1 structure
involves the poly(A) stretch at its 3⬘ end in base pairing.
All the nucleotide variations in other isolates were found
in the bulge regions (Fig. 1A). In the Mexican isolate, SL1
involves four A residues in base pairing instead of three
as observed in others, and the SL2 structure also bifur-
cates into two hairpin loops unlike other isolates (data
not shown).
In order to confirm the predicted structure at the 3⬘
end, Pb 2⫹ ions induced cleavage and RNase probing of
the RNA transcript of the 3⬘ end with a poly(A) stretch
[3⬘(⫹)A n] was performed. Catalysis by Pb 2⫹ is known to
be specific at the single-stranded regions, loops, and
bulges, leaving out the double-stranded RNA stretches
(Ciesiolka et al., 1992a,b, 1998). In our structure probing
studies, Pb 2⫹ hydrolysis gave a more descriptive picture
of the structure than the enzymatic probing utilizing dif-
ferent single-strand cutting ribonucleases like ribonucle-
ase I, S1 nuclease, and mung bean nuclease. This might
be due to the ability of smaller Pb 2⫹ ions having better
access into the folded RNA structure than the enzymes.
The digestion pattern observed is summarized in Fig. 1B
and the representative structure probing gel is shown in
Fig. 2. Pb 2⫹ and RNases including S1 nuclease and
mung bean nuclease cut at every single nucleotide from
nt 7164 to 7172 which forms a single-strand region (SS) in
the computer-predicted structure model. Occasional cuts
within this region were observed by ribonuclease I en-
zyme too. Pb 2⫹ ions could identify and thus confirm the
loops and bulge regions in SL1 and SL2, the reactivities
being shown by the nt 7177, 7182–7183, 7189–7193 and
7198–7199 in SL1 structure and nt 7094–7097, 7113–7119,
7125–7127, 7130–7133, 7136, 7141, 7154, and 7159 in the
SL2 structure. Occasional hydrolysis was observed at
either ends of the loops like nt 7098, 7100, 7111, 7112,
7124, indicating toward some conformational flexibility in
these regions. Different RNases cleaved at the bulge and
loop regions of SL1 and SL2 as depicted in Fig. 1B. Prior
to the reaction with Pb(OAc) 2, the end-labeled RNA tran-
scripts were denatured and then cooled slowly for effi-
cient folding and obtaining a maximum number of native
molecules. However, omission of this procedure had no
effect on the probing profiles obtained (Fig. 2), suggest-
ing that the RNA secondary structure as determined in
these experiments forms rapidly and reproducibly under
the chosen conditions.
Various point mutants and deletion mutants were con-
89
FIG. 2. Chemical and enzymatic probing of the secondary struc-
ture of 3⬘ end of HEV RNA. Cleavage products obtained by hydro-
lysis of 5⬘ end-labeled RNA transcripts with Pb 2⫹ ions and digestion
with single-strand-specific RNases (Ribonuclease I, S1 nuclease,
and mung bean nuclease) were separated on 15% polyacrylamide
gel and given short and long runs. Prior to the reaction, the labeled
RNA transcripts were supplemented with tRNA and brought to a
concentration of 8 ␮M and subjected to a denaturation/renaturation
procedure. Lane A: control incubation of the RNA without Pb 2⫹ ions
or RNases. Lane B: limited RNase T1 hydrolysis under denaturing
conditions: cutting at every G residue. Some of the numbers of G
residues in the RNA sequence are depicted on the left. Lane C:
formamide ladder. Lanes D and E: Pb(II)-induced hydrolysis at 2.5
and 5 mM Pb(OAc) 2 . Lane F: same as 5 but with the omission of the
denaturation/renaturation procedure. Lanes G, H, and I: diges-
tion with ribonuclease I, S1 nuclease, and mung bean nuclease,
respectively.
structed (Fig. 3A) based on the secondary structure
model. The predicted structure of the mutants is demon-
strated in Fig. 3B.
Viral RNA-dependent RNA polymerase protein
Earlier observations on sequence homology search
(Koonin et al., 1992) with other positive-strand RNA vi-
ruses defined the coding region of RdRp in the HEV
genome. The recent computer-derived structure analysis
data of HEV RdRp based on the crystal structure of
poliovirus and HCV RdRps corroborate the sequence
homology results (Panda et al., unpublished data). RdRp
was expressed as a 63-kDa His-tagged protein, in E. coli
(Fig. 4). The 63-kDa band is composed of ⬃59-kDa RdRp
and ⬃4-kDa His tag from the vector sequence. The
expressed RdRp could be detected in the Western blot
assay using acute-phase HEV-infected patient serum
and rabbit anti-RdRp antibodies (data not shown). The
recombinant RdRp protein was expressed in high
amounts in E. coli and purified and refolded on a Ni-NTA
90 AGRAWAL, GUPTA, AND PANDA

FIG. 3. (A) Schematic diagram and description of RNA transcripts corresponding to the native [3⬘(⫹)A n] and mutant forms of the 3⬘ end of HEV RNA
used for binding analysis. (B) Secondary structure prediction of various mutant forms of 3⬘ end of HEV RNA using the MFOLD (Zuker) program. These
mutants were generated using PCR mutagenesis in the laboratory for analysis. Arrow indicates point mutation. Arrow with ⌬ indicates deletion. Free
energies of these predicted structures of mutants are: 3⬘(⫹), ⫺22.8 kcal/mol; 3⬘(⫹)D, ⫺17.2 kcal/mol; 3⬘(⫹)dA n, ⫺18.2 kcal/mol; s3⬘(⫹)A n, ⫺6.7
kcal/mol; 3⬘(⫹)M1, ⫺22.8 kcal/mol; 3⬘(⫹)M2, ⫺23.0 kcal/mol; 3⬘(⫹)M3, ⫺26.4 kcal/mol; 3⬘(⫹)M4, ⫺19.9 kcal/mol.

column. SDS-PAGE analysis of the eluted fractions
showed a relatively pure RdRp protein (Fig. 4, lane P).
Interaction of viral RdRp with the 3⬘ end of HEV
An in vitro RNA EMSA was developed to study binding
of purified and refolded RdRp protein to the 3⬘ end of
positive-sense HEV genomic RNA. Binding of RdRp was
observed with the wild-type transcript with the poly(A)
stretch [3⬘(⫹)A n] (Fig. 5A, lane 2), but not with a similar
RNA lacking the poly(A) stretch [3⬘(⫹)] (Fig. 5A, lane 4).
The binding to [3⬘(⫹)A n] RNA showed a concentration
response since the band intensity increased on increas-
ing the amount of RdRp for a fixed amount of RNA probe
(Fig. 5B). The binding showed a saturation effect and an
optimal binding condition of 5 ␮g RdRp protein for 1 ng
(10 5 cpm) of input RNA was used for subsequent exper-
iments. The specificity of the complex formation between
RdRp and [3⬘(⫹)A n] was evaluated in competition assays
(Figs. 5C and D). While a specific competitor, unlabeled
[3⬘(⫹)A n] RNA, disrupted the RNA-RdRp complex com-
pletely at 10–25 times the molar excess, a nonspecific
competitor such as E. coli tRNA failed to disrupt the
complex even at a 50-fold molar excess (Fig. 5C). To rule
out the possibility that the poly(A) stretch itself confers all
specificity to this RNA-RdRp interaction, polyadenylated
human placental mRNA was also used as a nonspecific
competitor. It could not disrupt the [3⬘(⫹)A n] RNA-RdRp
complex even at a 60-fold molar excess (Fig. 5D). Use of
unlabeled 3⬘ end RNA without poly(A) stretch, [3⬘(⫹)], as
a competitor also could not disrupt the [3⬘(⫹)A n] RNA-
RdRp complex (data not shown). In another competition
assay, oligo(dT) also failed to compete with the [3⬘(⫹)A n]
RNA-RdRp complex at a 60-fold molar excess (Fig. 5D). In
yet another experiment, a nonspecific protein, heparin,
failed to bind to the [3⬘(⫹)A n] probe under similar binding
conditions, as used for [3⬘(⫹)A n]-RdRp interaction (data
not shown). In the supershift assay (Fig. 5E), addition of
rabbit anti-RdRp sera shifted the specific complex (C) to
a higher position in the gel (band marked S). This shifted
complex was absent with the preimmune sera, though a
nonspecific band was observed in both the sera above
the complex S (Fig. 5E).
Localization of RdRp binding site in the 3⬘ end
of HEV RNA
To identify domains within the 3⬘ end of the HEV
genome involved in interaction with RdRp, a mutational
study was carried out. Various deletion and point muta-
 RNA-RdRp INTERACTIONS AT THE 3⬘ END OF HEV RNA 91

FIG. 3—Continued

tions of the 3⬘ end transcripts were made and assayed

for their binding activity with the purified viral RdRp
protein. The results are summarized in Fig. 6. A major
deletion of the nucleotides 7163–7194 (last 32 nucleo-
tides) from the 3⬘ NCR as well as omission of the 3⬘
poly(A) stretch [3⬘(⫹)D] (Fig. 3Bii) completely abolished
binding with RdRp, indicating the requirement of this
region in complex formation (Fig. 5A, lane 6). The light
band seen in lane 6 corresponding to the position of
RNA-RdRp complex was not observed consistently and,
whenever seen, was completely abrogated by nonspe-
cific competition. Further, a negligible amount of binding
was observed with the wild-type 3⬘ end lacking only the
poly(A) stretch [3⬘(⫹)] (Fig. 3Bi), even with increased
concentrations of RdRp. This clearly suggested that the
FIG. 4. Expression and purification of HEV RdRp protein. Coomassie
3⬘ end poly(A) sequences are essential for binding of brilliant blue-stained SDS–10% polyacrylamide gel showing the expres-
RdRp to the 3⬘ end. From the secondary structure models sion and purification of recombinant HEV RdRp protein in E. coli as a
(Fig. 3Bi) it is apparent that removal of poly(A) disrupts 63-kDa band. E. coli BL21(DE3) cells were transformed with pRSET C
the necessary structure in SL1 which may be required for vector containing HEV RdRp coding sequence (nt 3493–5163) in-frame
and induced with 1 mM IPTG. The expressed RdRp protein containing
binding. To further analyze the 3⬘ end-RdRp interaction,
the 6 His tag was purified on a Ni-NTA column. U, uninduced lane; I,
two major deletions in the 3⬘ end were generated, induced lane; P, lane showing the band of purified RdRp protein; M,
{[3⬘(⫹)dA n] and [s3⬘(⫹)A n]} (Fig. 3Biii, iv). While both of high molecular weight marker (Life Technologies). Arrow indicates the
these mutants contained the poly(A) stretch at their 3⬘ expressed protein band.
92 AGRAWAL, GUPTA, AND PANDA
 RNA-RdRp INTERACTIONS AT THE 3⬘ END OF HEV RNA 93

FIG. 6. Graphical representation of the effect of mutations at the 3⬘ end of HEV RNA on the binding efficiency with RdRp. Different probes
corresponding to the native and mutant forms of 3⬘ end of HEV RNA were allowed to bind to a fixed amount of RdRp protein (5 ␮g). Deletion of the
poly(A) stretch or of SL1 or SL2 brings down the binding to minimal. Minor deletions and point mutations within SL1 effect the binding by varying
degrees.

ends, mutant [3⬘(⫹)dA n] was deleted of nt 7173–7194 and
lacked SL1, and mutant [s3⬘(⫹)A n] was deleted of nt
7084–7138 and did not form SL2. Both these mutants
showed less than 5% of the binding observed with the
wild-type 3⬘ end containing poly(A) sequences. This
clearly suggested that the presence of the SL1 and SL2
sequences, along with the presence of the poly(A)
stretch, is necessary for binding of the viral RdRp to the
3⬘ end of HEV genome.
To determine the elements in SL1 important for RdRp
binding, two point mutants {[3⬘(⫹)M1] and [3⬘(⫹)M2]}
(Fig. 3Bv and vi) and two deletion mutants {[3⬘(⫹)M3] and
[3⬘(⫹)M4]} (Fig. 3Bvii and viii) were generated. These
mutants compromised the interaction at the optimal con-
centration of RdRp protein by varying degrees. A single
G3A point mutation at nucleotide 7194 in [3⬘(⫹)M1],
which resulted in the disruption of SL1 by opening the
interior loop and stem region (a), reduced the binding to
48% of the binding observed with the wild type. A com-
pensatory C3T point mutation at nucleotide 7176 in the
[3⬘(⫹)M1] background was introduced in mutant
[3⬘(⫹)M2], which restored the original structure. This
mutant showed a slightly increased binding efficiency of
⬃60% of the wild type, though not the same as the wild
type. The deletion mutant [3⬘(⫹)M3] lacking the interior
loop and the three C residues showed only 13% of the
binding observed with the wild type, whereas the dele-
tion mutant [3⬘(⫹)M4] deleted of nt 7178–7188 and thus

FIG. 5. EMSA with purified and refolded viral RdRp protein and 3⬘ end of HEV RNA. (A) The labeled probes (⬃1 ng) were allowed to bind to 5 ␮g
RdRp protein in the presence of excess of tRNA, and the reaction mix was subjected to 5% nondenaturing polyacrylamide gel electrophoresis (PAGE).
Lane 1, free probe of the native 3⬘ end with poly(A) stretch [3⬘(⫹)A n]; lane 2, [3⬘(⫹)A n] with RdRp; lane 3, free probe of the native 3⬘ end without poly(A)
stretch [3⬘(⫹)]; lane 4, [3⬘(⫹)] with RdRp; lane 5, free probe of 3⬘ end with a deletion of 32 nucleotides at the 3⬘ end [3⬘(⫹)D]; lane 6, [3⬘(⫹)D] with
RdRp. (B) Effect of increasing amounts of RdRp on binding. Lane 1, free probe of [3⬘(⫹)A n]; lanes 2–8, increasing amounts of RdRp added to [3⬘(⫹)A n];
lane 9, free probe of [3⬘(⫹)]; lanes 10–16, increasing amounts of RdRp added to [3⬘(⫹)]. (C) Competition experiment with RdRp and [3⬘(⫹)A n]. Lane
1, free probe of [3⬘(⫹)A n]; lane 2, [3⬘(⫹)A n] with RdRp; lanes 3–6, same as lane 2 with increasing molar excess of specific competitor (unlabeled
3⬘(⫹)A n); lanes 7–10, same as lane 2 with increasing molar excess of nonspecific competitor (E. coli tRNA). (D) Competition experiment with
nonspecific competitors. Lane 1, free probe of [3⬘(⫹)A n]; lane 2, [3⬘(⫹)A n] with RdRp; lanes 3 and 4, same as lane 2 with increasing molar excess of
human placental mRNA; lanes 5 and 6, same as lane 2 with increasing molar excess of oligodT (18 mer). (E) Supershift assay with RdRp and [3⬘(⫹)A n].
The binding mix containing RNA-RdRp complex was further incubated with rabbit sera raised against RdRp or with the preimmune sera to serve as
control. The entire reaction mix was then subjected to 5% nondenaturing PAGE. Lane 1, free probe [3⬘(⫹)A n]; lane 2, [3⬘(⫹)A n] with RdRp; lane 3, same
as lane 2 with 10 ␮l of anti RdRp rabbit sera; lane 4, same as lane 2 with 10 ␮l of preimmune rabbit sera. F, free probe; C, RNA-RdRp complex; S,
supershifted complex of RNA-RdRp-anti RdRp antibody.
94 AGRAWAL, GUPTA, AND PANDA
FIG. 7. Pb(II)-induced cleavage of the 5⬘ end-labeled HEV 3⬘ end RNA
in the native form (D, E) and complexed with RdRp (F–H). Lane A:
control incubation of RNA without Pb 2⫹ ions. Lane B: limited RNase T1
hydrolysis under denaturing conditions: cutting at every G residue.
Some of the numbers of G residues in the RNA sequence are depicted
on the left. Lane C: formamide ladder. Lanes D and E: reaction of native
form of RNA with 2.5 and 5 mM Pb 2⫹. Lanes F, G, and H: reaction of the
RNA-RdRp complex with 5, 2.5, and 1.25 mM Pb 2⫹.
lacking the hairpin loop still showed about 60% binding
of the wild type.
Pb(II) ions induced hydrolysis of the RNA-RdRp
complex
Pb 2⫹-induced hydrolysis carried out on the native 3⬘
end RNA molecule and the one complexed with viral
RdRp protein further confirmed the nucleotides involved
in such an interaction (Figs. 7 and 1B). Although this
approach limited the identification of interacting nucleo-
tides to the single-stranded regions, loops, and bulges,
nevertheless it was helpful in confirming the results
obtained using different mutant forms of 3⬘ end. The
nucleotides that could still be hydrolyzed by Pb 2⫹ on
forming the RNA-RdRp complex are bracketed in Fig. 1B,
thus representing the unmasked nucleotides in such an
interaction. It is quite evident from the footprinting data
that the RdRp interacting sites are spread over SL1, SL2,
and SS regions. This is indeed shown by the experi-
ments with deletion mutants [3⬘(⫹)dA n, 3⬘(⫹)D, and
s3⬘(⫹)A n] wherein the deletion of either of these three
regions abrogates all the binding activity (Fig. 6). Finer
mutational analysis involving minor deletions in SL1 like
lack of 3 C (7190–7192) in mutant 3⬘(⫹)M3 (Fig. 3Bvii)
brings down the binding activity to 13% of the normal.
This is in agreement with the Pb 2⫹ hydrolysis data of the
RNA-RdRp complex wherein all these three C residues
are masked and thus resistant to hydrolysis (Fig. 1B).
Some of the nucleotides in the double-stranded re-
gions (7178 and 7176), which were resistant to hydrolysis
in the native form of RNA, become exposed to Pb 2⫹ ions
in the RNA-RdRp complex (Fig. 1B). This might be due to
local conformational changes during complex formation
of RNA with RdRp protein.
In vitro RNA synthesizing activity of recombinant
HEV RdRp
Figure 8A (lane 2) shows that the 3⬘ end of HEV
genome with poly(A) stretch acts as a template for the in
vitro synthesis of complementary RNA catalyzed by re-
combinant RdRp expressed in E. coli, purified, and re-
folded. This activity is primer independent and results in
the production of RNA, migrating a little faster than the
template RNA. Control lanes without the added RdRp or
template RNA did not show any incorporation (Fig. 8A,
lanes 3 and 4). The specificity of the newly synthesized
product was checked by a Northern hybridization exper-
iment using positive-strand 3⬘ end RNA (nt 7084–7194) as
riboprobe (Fig. 8B). Lane 1 in Fig. 8B shows the product
to be of negative sense as picked by plus polarity probe.
Control lanes for the RdRp activity assay do not show any
signal, which contain the template RNA without the ad-
dition of RdRp (Lane 2) and in the presence of RdRp
without the template RNA (Lane 3). After checking for the
expression of RdRp in the TNT rabbit reticulocyte system
(data not shown), a similar activity assay reaction was
carried out with RdRp produced in the TNT rabbit reticu-
locyte lysate system and it showed the generation of a
similar band migrating slightly faster to the template (Fig.
8C, lane 2). In addition to this, another band similar in
size to the template RNA was also observed. Back-
ground smearing was observed in this reaction lane (Fig.
8C, lane 2) and also in the reaction lane containing RdRp
but no added template RNA (Fig. 8B, lane 4). However,
the reaction lane (Fig. 8C, lane 3) without RdRp protein
showed no incorporation even in the presence of added
3⬘ end RNA template.
DISCUSSION
HEV has a positive-sense polyadenylated RNA ge-
nome consisting of three open-reading frames. The
genomic organization of HEV distantly mimics alpha vi-
ruses (Purdy et al., 1993). The nonstructural protein cod-
ing region (ORF 1) is located at the 5⬘ end of the capped
RNA and the structural region (ORF2) at the 3⬘ end. The
third ORF overlaps ORF 2 substantially and ORF 1 by one
nucleotide. Based on the replication strategy of other
positive-strand RNA viruses and the genomic organiza-
tion of HEV, a basic replication mechanism for HEV has
been hypothesized earlier (Reyes et al., 1993). Upon
entering the cell, the nonstructural gene products are
 RNA-RdRp INTERACTIONS AT THE 3⬘ END OF HEV RNA
FIG. 8. RdRp activity assay. (A) In vitro RNA synthesis by recombinant
RdRp expressed in E. coli, purified, and refolded using RNA transcripts
containing the 3⬘ end of HEV genome with poly(A) stretch as the
template. RdRp was added to the template in the presence of rNTPs
and radiolabeled UTP in an appropriate reaction buffer and incubated
for 2 h at 25°C. After phenol:chloroform extraction and ethanol precip-
itation, the reaction products were run in a 8% polyacrylamide gel
containing 7 M urea and visualized by autoradiography. Lane 1, labeled
[3⬘(⫹)A n] RNA as a size marker; lane 2, RNA synthesized by recombi-
nant RdRp; lane 3, activity reaction mix without added RdRp; lane 4,
activity reaction mix without added template [3⬘(⫹)A n] RNA. (B) North-
ern blot analysis of newly synthesized RNA produced by reaction of the
recombinant RdRp on 3⬘ end-positive sense RNA of HEV genome. The
reaction products were run on 2% formaldehyde-agarose gel, trans-
ferred to nylon membrane, and probed using positive sense 3⬘ end (nt
7084–7194) riboprobe. Lane 1, RNA synthesized by recombinant RdRp,
detected as antisense HEV RNA; lane 2, template RNA in the activity
mix without the addition of recombinant RdRp and probed with HEV 3⬘
end positive RNA; lane 3, activity reaction mix containing the recombi-
nant RdRp without the template RNA and probed with HEV 3⬘ end
positive RNA. (C) RdRp produced in the transcription coupled transla-
tion (TNT) rabbit reticulocyte lysate system used for the activity assay
and the products run on a 8% polyacrylamide gel containing 7 M urea.
Lane 1, labeled [3⬘(⫹)A n] RNA as a size marker; lane 2, RNA synthe-
sized by recombinant RdRp in the rabbit reticulocyte lysate; lane 3,
activity reaction mix containing template RNA but the rabbit reticulocyte
lysate without RdRp; lane 4, activity reaction mix containing the rabbit
reticulocyte lysate with recombinant RdRp but no added template
[3⬘(⫹)A n] RNA.
presumably expressed from the full-length positive-
sense genome, which are then involved in the earliest
stages of replication. The replicase unit, i.e., RdRp either
alone or in association with cellular proteins, subse-
quently directs the synthesis of negative-sense pre-
genomic RNA from the 3⬘ end of the viral genome. Such
a negative-strand HEV RNA intermediate has indeed
been detected earlier (Nanda et al., 1994b) and in the
recent infection studies (Panda et al., 2000). Subse-
quently, the synthesis of progeny positive-strand RNA
95
takes place using the de novo-synthesized negative
strand as the template. Thus, the entire process of rep-
lication of HEV RNA genome minimally utilizes an inter-
action between viral and possibly host cell proteins and
the 3⬘ and 5⬘ terminal RNA motifs. Similar interactions
have been characterized in Japanese encephalitis virus
(Chen et al., 1997), west nile virus (Blackwell and Brinton,
1995), encephelmoyocarditis virus (Cui et al., 1993), al-
falfa mosaic virus (Graff et al., 1995), hepatitis A virus
(Kusov et al., 1996), brome mosaic virus (Quadt et al.,
1993), mouse hepatitis virus (Yu and Leibowitz, 1995a,b),
sindbis alphavirus (Pardigon et al., 1993), and hepatitis C
virus (Yen et al., 1995). In light of the proposed replication
model, this study was undertaken to analyze the RNA-
viral RdRp interactions that occur at the 3⬘ end of HEV
RNA, which might possibly serve as the key step in the
initiation of replication of the viral genome. To our knowl-
edge this is the first report describing the interaction of
viral RdRp with the 3⬘ end of the HEV genome. The report
also attempts to deal with the RNA elements and sec-
ondary structures responsible for the formation of these
specific RNA-protein complexes.
Chemical and enzymatic probing of the 3⬘ end of HEV
RNA of the Indian isolate (AF076239) with 5 A residues
confirmed the computer-predicted structure model de-
rived by the MFOLD program (Figs. 1A and 1B). Chemical
probing utilized Pb 2⫹ which not only discriminates the
single-stranded regions and loops from double-stranded
stem structures, but also has the ability to distinguish
between regions of increased conformational flexibility
as well as altered conformation of RNA (Ciesiolka et al.,
1992a,b, 1998). The approach of Pb(II)-induced hydrolysis
has been successfully applied in structural studies of
several RNA molecules, like tRNA (Behlen et al., 1990;
Krzyzosiak et al., 1998; Marciniec et al., 1989; Sampson et
al., 1987), mouse U1 small nuclear RNA (Zietkiewicz et
al., 1990), and E. coli 16 S RNA (Gornicki et al., 1989) and
different prokaryotic 5S rRNA (Ciesiolka et al., 1992b;
Ciesiolka and Krzyzosiak, 1996).
The 3⬘ ends of several positive-strand RNA viruses like
hepatitis C virus (Oh et al., 2000), alfalfa mosaic virus
(AAMV) (Graff et al., 1995), poliovirus (Pata et al., 1995)
turnip crinckle virus (TCV) (Song and Simon, 1995), hu-
man rhinovirus (Todd et al., 1995), and encephalomyo-
carditis virus (Cui et al., 1993) are known to specifically
bind to their respective RNA-dependent RNA poly-
merases. Using gel-shift assays we demonstrated that
the purified and refolded HEV RdRp protein binds spe-
cifically to the 3⬘ end of the HEV RNA genome with the
poly(A) stretch. tRNA was included in the binding reac-
tion mix in sufficient quantity to avoid any nonspecific
binding. The specificity of the interaction was further
confirmed by competition and supershift assays. Specific
competitors, i.e., cold RNA corresponding to the probe,
disrupted the retarded complex even at 10- to 25-fold
molar excess, but the nonspecific competitors like E. coli
96 AGRAWAL, GUPTA, AND PANDA
tRNA could not abolish the complex formation even at
concentrations as high as 50-fold molar excess. Super-
shift assay using anti-RdRp antibodies further confirmed
the specificity of interaction. The 3⬘ end lacking the
poly(A) stretch showed an almost negligible amount of
binding to RdRp, even with increased amounts of protein
(20 ␮g). Thus, the interaction between 3⬘ end and RdRp
shows an absolute requirement for the poly(A) stretch,
which might be due to its participation in the formation of
SL1 (Fig. 1A). A similar requirement for the poly(A) tail
has been established earlier for encephalomyocarditis
virus (Cui et al., 1993). Functional relevance of a 3⬘
pseudoknot that includes part of the 3⬘ poly(A) tail has
been shown for efficient replication of bamboo mosaic
potexivirus RNA (Tsai et al., 1999). Specificity of the viral
RdRp binding to the viral sequences rather than to poly-
adenylated RNA was confirmed by the inability of the
polyadenylated mRNA and 3⬘ end RNA of HEV genome
lacking the poly(A) stretch to compete with the interac-
tion. Deletion mutants lacking either SL1 or SL2 did not
form the complex with RdRp. This suggests that the
complete 3⬘ end domain, including two stem loops and
the poly(A) stretch is recognized by the viral RdRp. Pb 2⫹-
induced hydrolysis of the RNA-RdRp complex revealed
that the interacting sites were indeed spread over the
SL1, the SL2, and even the SS region. Modifications in
SL1 by deletion and point mutations affected the binding
by varying degrees (Fig. 6). Opening of the interior loop
and stem region (a) by a point mutation brings down the
binding efficiency to 48% of the wild type. A compensa-
tory point mutation that restores SL1 base pairing was
able to partially restore binding to 60% of the wild type.
Incomplete restoration of binding to wild type (normal-
ized to 100%) might be due to the sequence dependence
of the interaction in addition to the structure depen-
dence. Deletion of three cytosines in the interior loop
effects the RNA-RdRp interaction drastically, bringing it
down to merely 13% of the wild type. In contrast, removal
of stem region (b) and hairpin loop had little effect on
binding. These combined results suggest that both struc-
tured RNA motifs and sequence elements (CCC in the
interior loop or the nt modified in M2 mutant) are impor-
tant for RdRp binding.
Recombinant HEV RdRp, expressed in E. coli, purified,
and refolded and used in this study, was able to synthe-
size RNA in vitro using 3⬘ end HEV RNA with poly(A)
stretch as the template in a primer-independent manner.
Such an in vitro RdRp activity of synthesizing RNA de
novo has been demonstrated earlier for hepatitis C virus
by Oh et al. (1999). Another study (Luo et al., 2000) has
shown a de novo initiation of RNA synthesis by the HCV
RdRp expressed in baculovirus system. Cui et al. (1993)
have shown a similar activity of E. coli-expressed re-
combinant RdRp in encephalomyocarditis virus using
Oligo(dT) as the primer. Other reports of RdRp activity
from viral RdRps purified from native and recombinant
sources have come from poliovirus (Neufeld et al., 1991;
Plotch et al., 1989), rhinovirus (Morrow et al., 1985), den-
gue virus (Tan et al., 1996), and brome mosaic virus
(Quadt and Jaspars, 1990). Synthesis of slightly faster
migrating RNA species by HEV RdRp might be due to
initiation at a specific site on the 3⬘ end RNA template
[3⬘(⫹)A n] or due to premature termination. Such an ob-
servation was also made when the 98 nt X region RNA of
HCV 3⬘ end was used as a template by recombinant HCV
RdRp expressed in E. coli (Oh et al., 1999). Production of
a complete hairpin dimer product is less likely, because
such a product would migrate very much faster than the
monomer (Luo et al., 2000). The polarity of the newly
synthesized product was confirmed to be of negative
sense by Northern hybridization with the positive polarity
probe. RdRp expressed in TNT rabbit reticulocyte lysate
resulted in the synthesis of RNA species similar in size to
the template RNA in addition to the slightly faster migrat-
ing band. This can be attributed to the presence of some
cellular factors in the rabbit reticulocyte lysate, which
might assist RdRp in its replicase activity to initiate syn-
thesis from the start site and hold it onto the template till
the end. Interaction of cellular proteins with the 3⬘ end
has indeed been observed in our other studies (Panda et
al., unpublished data). Background smearing might be
due to nonspecific RdRp activity on internally present
RNAs in the TNT rabbit reticulocyte lysate. The fact that
no smearing was observed when rabbit reticulocyte ly-
sate without RdRp was used suggests the absence of
activity on HEV 3⬘ end template due to any cellular
polymerase. For many viral RdRps, activity on homopoly-
mers has been demonstrated using complementary
primers or even in a primer-independent manner at high
concentrations of rNTPs (Luo et al., 2000). Cowpea mo-
saic virus (CPMV) RdRp has been shown to efficiently
copy CPMV RNA and various unrelated RNAs in vitro
while binding specifically only to CPMV RNA (Zabel et al.,
1974).
Here we report the specific binding of purified and
refolded HEV RdRp to the 3⬘ end of the viral genome,
which requires the structured SL1 and SL2 domains and
the poly(A) stretch. Multiple sequence and structural
factors are recognized by RdRp, which may explain the
specificity of recognition of the HEV RNA. By forming the
specific binding site for viral RdRp and as a template for
in vitro synthesis of complementary-strand RNA, the 3⬘
end of HEV might assume a possible role as a cis-acting
element for the initiation of replication of HEV genome.
MATERIALS AND METHODS
Structural modeling of the 3⬘ end
Sequences of five geographically different HEV iso-
lates including those from India (AF076239), Pakistan
(M80851), Myanmar (M73218), China (L08816), and Mex-
ico (M74506) were analyzed for conserved domains
 RNA-RdRp INTERACTIONS AT THE 3⬘ END OF HEV RNA
TABLE 1
Primers Used for the Amplification of the 3⬘ End of HEV RNA and Generation of Its Mutants
Probe Positive-sense 5⬘ primer a
3⬘ (⫹) A n pT7-7084-GCTCCAGCGCCTTAAGATGAA
3⬘ (⫹) pT7-7084-GCTCCAGCGCCTTAAGATGAA
3⬘ (⫹) D pT7-7084-GCTCCAGCGCCTTAAGATGAA
3⬘ (⫹) dA n pT7-7084-GCTCCAGCGCCTTAAGATGAA
s3⬘ (⫹) A n pT7-7139-TTGTGCCCCCCTTCTCTCTG
3⬘ (⫹) M1 pT7-7084-GCTCCAGCGCCTTAAGATGAA
3⬘ (⫹) M2 pT7-7084-GCTCCAGCGCCTTAAGATGAA
3⬘ (⫹) M3 pT7-7084-GCTCCAGCGCCTTAAGATGAA
3⬘ (⫹) M4 pT7-7084-GCTCCAGCGCCTTAAGATGAA
a
pT7 represents the T7 RNA polymerase promoter sequence (TGTAATACGACTCACTATAGG); 7084 and 7139 are the nucleotide positions in the HEV
genome at which the positive-sense primers begin.
within the 3⬘ noncoding region using clustal (DNAStar
Inc.). The terminal 300 nucleotide sequences of all the
isolates at the 3⬘ end followed by the poly(A) stretch were
subjected to secondary structure prediction using the
MFOLD 2.3 program (Zuker, 1989). RNA parameters were
used as given by Walter and Turner (1994). All the optimal
and suboptimal conformers predicted by MFOLD were
visualized by ESSA, an interactive tool for analyzing RNA
secondary structure (Chetouani et al., 1997). A more
elaborate secondary structure analysis of the last 110
bases of the Indian isolate (Accession No. AF076239)
was carried out based on the conserved stem-loop struc-
tures found at the 3⬘ end of various isolates with added
poly(A) stretch. These were equivalent to nucleotide po-
sitions 7084–7194 nt of the Indian isolate (AF076239)
followed by five adenosine residues. All further studies
were carried out using sequences of the Indian isolate.
Based on the structure model, we designed various
mutants, in which stem-loop structures were deleted,
destroyed, or recreated (Figs. 1 and 3).
Construction of recombinant plasmids and
sequencing
A PCR-based strategy was used to generate the cDNA
clones for the production of RNA transcripts correspond-
ing to the 3⬘ end of the HEV genome and its various
mutant forms from the infectious clone described by us
earlier (Panda et al., 2000). A schematic representation
and description of the constructs is shown in Fig. 3A.
Forward and reverse primers were designed using the
OLIGO 4.0 software and synthesized on an automated
DNA synthesizer (Model 392, Applied Biosystems) (Table
1). These were used to amplify regions of the 3⬘ end
using a HEV cDNA 6046–7194 nt pCRScript clone (Panda
et al., 1995) as a template and a combination of Taq
(Promega) and Pfu (Stratagene) DNA polymerases. The
forward primer contained the T7 promoter sequence
immediately upstream of the HEV sequence. The ampli-
fied products were gel-purified, polished with a Klenow
97
Negative-sense 3⬘ primer
GCCTCGAGTTTTTCAGGGAGCGCGGAACGCA
AGGGAGCGCGGAACGCAGAAATGAGAAATAAGCAACAGA
GCAACAGAGAGAAGGGGGGCACA
TTTTTTGAGAAATAAGCAACA
GCCTCGAGTTTTTCAGGGAGCGCGGAACGCA
TTTTTTAGGGAGCGCGGAACGCAGA
TTTTTTAGGGAGCGCGGAACGCAAAAATG
TTTTTCGCGCGGAACGCAGA
TTTTTCAGGGAAGAAATGAGAAATAAGC
fragment of DNA polymerase (Amersham International),
and phosphorylated with polynucleotide kinase (Amer-
sham International). Subsequently these fragments were
cloned into pUC18 vector (Ready to go pUC18 SmaI/
BAP ⫹ ligase) (Pharmacia biotech., Sweden) and se-
quenced by Sanger’s dideoxy chain termination method
using the Sequenase version 2.0 sequencing kit (Amer-
sham International).
Production of RNA transcripts
For the generation of run-off transcripts, plasmids
were linearized using the appropriate restriction enzyme
at the 3⬘ end of the insert. The XhoI restriction enzyme
site present in the 3⬘ end primer was used to linearize
the clones [3⬘(⫹)A n] and [s3⬘(⫹)A n] and the BamHI site of
the vector MCS was used for other mutants (Table 1). An
in vitro transcription reaction was performed with T7 RNA
polymerase (Life Technologies) in the presence of 500
␮M each of ATP, CTP, and GTP along with 1 ␮M UTP and
50 ␮Ci [␣- 33P]UTP (2500 Ci/mmol; Amersham Interna-
tional or BARC, India) and 40 U RNasin (Promega) at
37°C for 1 h. The reaction mixtures were then treated
with 30 U of RNase-free DNase I (Amersham Interna-
tional) for 30 min at 37°C, extracted with phenol:chloro-
form, and precipitated twice with ethanol. Soluble and
TCA-precipitable counts were measured in a liquid scin-
tillation counter (Beckman) to estimate the incorporation
level. Total amount of RNA synthesized was determined
by the amount of limiting rNTP (UTP) present in the
reaction, the maximum theoretical yield, and the percent-
age incorporation. The specific activity of the probe was
expressed as the total incorporated counts per minute
per total microgram of RNA synthesized (Promega, 1996).
Up to 60% incorporation of the [ 33P]UTP was routinely
achieved resulting in labeled transcripts with a specific
activity of typically 10 8 cpm/␮g. The transcription reac-
tion generated expected size transcripts as visualized on
an 8% denaturing polyacrylamide gel (data not shown).
Unlabeled RNA was similarly transcribed using 500 ␮M
98 AGRAWAL, GUPTA, AND PANDA
of each of NTPs, phenol:chloroform-extracted, and etha-
nol-precipitated.
Radioactive end labeling of RNA transcripts
The in vitro-transcribed RNA from the HindIII linearized
clone [3⬘(⫹)A n] was treated with calf intestinal alkaline
phosphatase (Promega) and purified on 8% polyacryl-
amide/8 M urea gel. The RNA bands were visualized by
UV shadowing using a fluorescent TLC plate, cut, and
eluted overnight in a buffer containing 1% SDS and 2.5 M
ammonium acetate. The transcripts were ethanol-precip-
itated and 5⬘ end-labeled using T4 polynucleotide kinase
(Promega) and [␥- 32P]ATP (5000 Ci/mmol; BARC, India)
and further purified on 8% polyacrylamide/8 M urea gel to
remove the unincorporated nucleotides. Autoradio-
graphic exposure of 1 min enabled the visualization of
the labeled bands.
Metal ion and enzymatic probing of RNA secondary
structure
Prior to reaction, the 32P-labeled RNA transcripts were
supplemented with carrier tRNA (Calbiochem) to a final
concentration of 8 ␮M and subjected to a denaturation/
renaturation procedure by heating the samples at 65°C
for 3 min and slow cooling to 25°C over 60 min. The
renaturation step was performed in the buffer containing
10 mM Tris/HCl, pH 7.2, 10 mM MgCl 2, and 40 mM NaCl
for lead ion-induced cleavage and in the respective en-
zyme buffers for enzymatic cleavage reaction. Subse-
quently, Pb(OAc) 2 (Sigma) solution was added to the final
concentration of 2.5 and 5 mM, and the digestion was
conducted at 25°C for 15 min. For enzymatic cleavage,
ribonuclease I (0.1 U) (Promega), S1 nuclease (0.4125 U)
(Amersham International), and mung bean nuclease (0.1
U) (Amersham International) were independently added
and the reaction proceeded at 25°C for 10 min. All the
reactions were quenched by adding an equal volume of
7 M urea and 10 mM EDTA solution and loaded on 15%
polyacrylamide/7 M urea gel at ⬃10 4 cpm/well. Electro-
phoresis was performed in 0.5⫻ TBE buffer at 2000 V for
⬃1.5–4 h for short and long runs, respectively. Autora-
diography was performed at ⫺80°C with an intensifying
screen (DuPont). The RNA cleavage products were run
along with the products of alkaline RNA hydrolysis and
limited ribonuclease T1 (Calbiochem) digestion of the
same RNA. An alkaline hydrolysis ladder was generated
by incubating the RNA with formamide in boiling water
for 15 min. Partial T1 digestion was performed under
denaturing conditions (50 mM sodium citrate, pH 4.5, 7 M
urea) with 0.05 U of enzyme at 55°C for 10 min. The
above-mentioned procedure was carried out after the
standardization of reaction, gel electrophoresis, and au-
toradiography conditions.
Cloning and expression of the HEV RdRp domain
The RdRp coding region covering nucleotide positions
3546–5106 in the HEV genome (Koonin et al., 1992) was
amplified as a larger fragment (3493–5163 nt) by PCR
using a combination of Taq (Promega) and Pfu (Strata-
gene) DNA polymerases from a HEV cDNA clone com-
prising nucleotides 2346–5163 in the pCRScript vector
(Ansari et al., 2000). The primers used were forward
primer, ACAGctcgagcccgggGCATGATTCAGTCG nucleo-
tides 3493 to 3523 (GenBank Accession No. AF076239);
reverse primer, GCGaagcttCggtaccTGGTCGCGAAC-
CCATGG nucleotides 5163 to 5131 (GenBank Accession
No. AF076239). The forward primer sequence was mod-
ified at the 5⬘ end to create the restriction enzyme sites
for XhoI and SmaI (lowercase nt in the primer sequence)
and the start codon ATG. Similarly the reverse primer
was modified at the 5⬘ end to incorporate the restriction
enzyme sites for KpnI and HindIII (lowercase nt in the
primer sequence). The amplified fragment was cloned
into pGEM-T vector (Promega) and sequenced as de-
scribed earlier. It was then subcloned into the expres-
sion vector pRSET (Invitrogen) as a XhoI-KpnI fragment.
The recombinant pRSET C- RdRp clone was transformed
into E. coli BL21-DE3 (Stratagene) and its overnight cul-
ture (O/N) grown in Luria-Bertani (LB) medium. The O/N
culture was inoculated at 1% in NZ-amine medium (Difco,
U.S.A.) supplemented with 0.4% glucose, 1⫻ M9 salts, 1
mM MgSO 4, and 50 ␮g/ml ampicillin and the culture
incubated at 37°C with shaking. Isopropyl-␤-D thiogalac-
topyranoside (IPTG) was added at 1 mM concentration
when the culture attained an optical density of 0.5. The
culture was further incubated at 37°C with shaking for
3 h. Cells were pelleted, solubilized in 2⫻ Laemmili
sample buffer (100 mM Tris-HCl, pH 6.8, 2% ␤-mercap-
toethanol, 4% SDS, 0.2% bromophenol blue, 20% glycerol)
and the extracts were separated on a sodium dodecyl
sulfate (SDS)–10% polyacrylamide gel along with high
molecular weight marker (Life Technologies). The protein
bands were visualized by Coomassie blue staining. The
specificity of the expressed protein was determined by
immunoblotting either with rabbit sera raised against the
E. coli-expressed RdRp region (Ansari et al., 2000) or
patient sera as the source of primary antibodies and
peroxidase-conjugated swine anti-rabbit and anti-human
immunoglobulins (Sigma), respectively, as secondary an-
tibodies. Color development was carried out with 3,3⬘-
diaminobenzidine (Sigma) as the substrate.
Purification of RdRp protein
The overexpressed hexa-histidine-tagged recombi-
nant protein corresponding to RdRp was purified on
Ni 2⫹-NTA-agarose (Qiagen, Germany) as per the manu-
facturer’s instructions. The protein was refolded while
immobilized on the column to avoid the formation of
misfolded aggregates. Renaturation was carried out over
 RNA-RdRp INTERACTIONS AT THE 3⬘ END OF HEV RNA
a period of 1.5 h using a linear 6M–1 M urea gradient in
500 mM NaCl, 20% glycerol, Tris/HCl, pH 7.4, containing
phenylmethylsulfonyl fluoride (PMSF) (Sigma) as a pro-
tease inhibitor. After refolding, the bound protein was
eluted by the addition of 250 mM imidazole (Sigma). The
eluted fractions were checked on SDS–10% polyacryl-
amide gel and those containing high amounts of RdRp
protein were further concentrated using the Centrisart I
starter kit (20,000 cutoff Da) (Sartorius, Germany). Protein
concentration was determined by the Bradford assay
(BioRad).
Electrophoretic mobility-shift assay (EMSA)
EMSA was standardized for protein concentration,
buffer conditions, reaction temperature and time, type of
gel, and electrophoresis conditions. In the standard bind-
ing assay 5 ␮g of purified RdRp protein and ⬃1 ng of
[ 33P]UTP-labeled RNA probe (⬃10 5 cpm) were incubated
at 28°C for 20 min in a buffer containing 10 mM HEPES
(pH 7.6), 0.3 mM MgCl 2, 60 mM KCl, 2% glycerol, and 1
mM DTT. Prior to addition of the labeled RNA probe, 20
␮g of E. coli tRNA (Calbiochem) was added to the reac-
tion mixture and incubated for 10 min at 28°C. RNA-RdRp
complex was then subjected to electrophoresis on a 5%
nondenaturing polyacrylamide gel (acrylamide:bisacryl-
amide ratio ⫽ 60:1) containing 5% glycerol in 0.5⫻ Tris-
borate-EDTA (TBE) buffer at 250 V at 4°C. Gels were
fixed, dried, and autoradiographed.
Partially purified and refolded RdRp protein was added
to the binding reaction mix at concentrations ranging
from 1 to 20 ␮g. To confirm the specificity of RdRp-RNA
interaction, specific and nonspecific competitor RNAs
were added to the binding reaction mix prior to addition
of the probe. Unlabeled RNA corresponding to the probe
as a specific competitor and E. coli tRNA as a nonspe-
cific competitor were used at a molar excess of 5- to
50-fold with respect to the probe. Human placental
mRNA and oligo(dT) (18 mer) were also used at a molar
excess of 20- to 60-fold as nonspecific competitors. Un-
labeled 3⬘ end RNA lacking the poly(A) stretch was also
used as a competitor at 50-fold molar excess. In another
reaction, 5 ␮g heparin (as a protein control) was added
to the binding reaction mix containing the [3⬘(⫹)A n] RNA
probe. Supershift assay was performed to further confirm
the specificity of RNA-RdRp interaction. The RNA-RdRp
complex in the binding mix was incubated with the rabbit
sera raised against E. coli-expressed RdRp region for 20
min at 30°C. The rabbit serum was earlier verified for the
presence of anti-RdRp antibodies by immunoblotting (An-
sari et al., 2000; Panda et al., 2000). The RNA-RdRp
complex was incubated with preimmune sera also in a
separate reaction mix to be used as a control. The
reaction mix was then subjected to nondenaturing poly-
acrylamide gel electrophoresis as described above.
Quantitative estimation of binding was performed by
99
measuring the ratio of RNA probe bound to RdRp to the
unbound probe under optimal binding conditions. This
was accomplished by cutting the gel piece correspond-
ing to the bound and unbound probe and measuring the
counts by scintillation. Percentage binding was deter-
mined as follows:
Percentage binding ⫽ bound probe/
共bound probe ⫹ unbound probe兲 ⫻ 100.
Pb(II)-induced cleavage of RNA-RdRp complex
The 5⬘ end-labeled probe of [3⬘(⫹)A n] was allowed to
bind to RdRp protein as noted above and the complex
was subjected to reaction with Pb(OAc) 2 at final concen-
tration of 1.25, 2.5, and 5 mM at 25°C for 10 min. The
reaction was stopped by the addition of EDTA to a final
concentration of 10 mM, extracted with water-saturated
phenol, and RNA precipitated with ethanol. The samples
were dissolved in 7 M urea/10 mM EDTA solution and
loaded on the gel as described above.
In vitro RdRp activity assay
For the in vitro RdRp activity, an RNA synthesis reac-
tion was undertaken in vitro using 3⬘ end of HEV RNA as
template in the presence of [ 33P]UTP. Briefly the reaction
was carried out in 40 ␮l volume containing 50 mM
HEPES (pH 8.0); 7 mM MgCl 2; 5 mM DTT; 500 ␮M each
of ATP, CTP, and GTP; and 20 ␮Ci of [␣- 33P]UTP (2500
Ci/mmol: Amersham International or BARC, India); 40 U
of RNasin (Promega); 0.15 ␮g of template RNA, [3⬘(⫹)A n]
⫺110 nt, and 5 ␮g of recombinant RdRp expressed in E.
coli, purified, and refolded as described earlier. After 2 h
of incubation at 25°C, the mixture was phenol:chloro-
form-extracted and ethanol-precipitated. The labeled
RNA products were separated in 8% polyacrylamide gel
containing 7 M urea and identified by autoradiography
using an intensifying screen (DuPont) and Kodak X-Omat
XK-5 film. Control reactions were also put simultaneously
that did not contain either recombinant RdRp or template
RNA.
To check for the specificity of the newly synthesized
RNA, Northern hybridization was carried out. Briefly, RNA
synthesis reaction was performed as described above
with cold UTP (500 ␮M) instead of radiolabeled UTP, and
the products were electrophoresed on a 2% formalde-
hyde-agarose gel. Control reactions were also run simul-
taneously that did not contain either recombinant RdRp
or template RNA. After the run, the gel was washed in
water for 30 min followed by 2⫻ SSC wash (20⫻ SSC is
3 M NaCl, 0.3 M trisodium citrate 2H 2O, pH 7). Transfer
of RNA from the agarose gel to Hybond -N nylon hybrid-
ization transfer membrane (Amersham International) was
done by the capillary transfer method. The positive po-
larity 3⬘ end HEV RNA 3⬘ riboprobe (7084–7194 nt) was
prepared as noted above under Production of RNA tran-
100 AGRAWAL, GUPTA, AND PANDA
scripts. The gel blot was UV-crosslinked (CL-1000 Ultra-
violet Crosslinker, Stratagene) for 5 min and then put in
prehybridization solution (6⫻ SSC, 5⫻ Denhardt’s solu-
tion, 0.5% SDS, 100 ␮g/ml calf thymus DNA) for 6 h at
65°C in a hybridization oven (Schel Lab, Model 1004).
Prehybridization solution was replaced by hybridization
solution which contained the probe (⬃10 6 cpm) in addi-
tion and the hybridization was carried out at 65°C for
⬃16 h. After hybridization the blot was washed twice in
2⫻ SSC for 20 min each, followed by a 30-min wash with
2⫻ SSC and 0.1% SDS, followed by a wash in 0.1⫻ SSC
for 10 min. The blot was rinsed in 2⫻ SSC, dried, and
exposed to Kodak X-Omat XK-5 film with an intensifying
screen (DuPont) at ⫺70°C overnight.
Alternative reaction was carried out using RdRp ex-
pressed in the transcription coupled translation (TNT)
rabbit reticulocyte lysate system (Promega). For this, the
RdRp coding region was subcloned into eukaryotic ex-
pression vector pSG1 (pSGI derived from pSG5; Jameel
et al., 1996) as a SmaI-HindIII fragment from a previously
described pGEM-T-RdRp clone. The TNT protocol was
followed as per the manufacturer’s guidelines. First,
RdRp was synthesized as a [ 35S]methionine-labeled pro-
tein and checked on SDS-PAGE and then later unlabeled
RdRp protein was synthesized for the purpose of mea-
suring RdRp activity. Twenty-five microliters of the TNT
lysate containing expressed RdRp protein was added to
the activity assay reaction mix. TNT rabbit reticulocyte
lysate reaction mix without the addition of pSG1-RdRp
DNA template was used as control in the activity assay.
ACKNOWLEDGMENTS
This study was funded by grant-in-aid programs from the Department
of Science and Technology and Department of Biotechnology, Govern-
ment of India to Prof. S. K. Panda. Shipra Agrawal is a Research Fellow
of Council of Scientific and Industrial Research at the Department of
Pathology, AIIMS, India. We acknowledge the critical appraisal given by
Dr. Ben Berkhout during the preparation of the manuscript.
REFERENCES
Ansari, I. H., Nanda, S. K., Durgapal, H., Agrawal, S., Mohanty, S. K.,
Gupta, D., Jameel, S., and Panda, S. K. (2000). Cloning, sequencing
and expression of the hepatitis E virus (HEV) nonstructural open
reading frame 1 (ORF1). J. Med. Virol. 60, 275–283.
Behlen, L., Sampson, J. R., DiRenzo, A. B., and Uhlenbeck, O. C. (1990).
Lead-catalyzed cleavage of yeast tRNA Phe mutants. Biochemistry 29,
2515–2523.
Blackwell, J. L., and Brinton, M. A. (1995). BHK cell proteins that binds
to the 3⬘ stem loop structure of the West Nile virus genome RNA.
J. Virol. 69, 5650–5658.
Chen, C. J., Kuo, M. D., Chien, L. J., Hsu, S. L., Wang, Y. M., and Lin, J. H.
(1997). RNA-protein interactions: Involvement of NS3, NS5 and 3⬘
noncoding regions of Japanese encephalitis virus genomic RNA.
J. Virol. 71, 3466–3473.
Chetouani, F., Monestie, P., Thebault, P., Gaspin, C., and Michot, B.
(1997). ESSA: An integrated and interactive computer tool for ana-
lysing RNA secondary structure. Nucleic Acids Res. 25, 3514–3522.
Ciesiolka, J., Lorenz, S., and Erdmann, V. A. (1992a). Structural analysis
of three prokaryotic 5SrRNA species and selected 5S rRNA-riboso-
mal-protein complexes by means of Pb(II)-induced hydrolysis. Eur.
J. Biochem. 204, 575–581.
Ciesiolka, J., Lorenz, S., and Erdmann, V. A. (1992b). Different confor-
mational forms of Escherichia coli and rat liver 5S rRNA revealed by
Pb(II)-induced hydrolysis. Eur. J. Biochem. 204, 583–589.
Ciesiolka, J., and Krzyzosiak, W. J. (1996). Structural analysis of two plant
5S rRNA species and fragments thereof by lead-induced hydrolysis.
Biochem. Mol. Biol. Int. 39, 319–328.
Ciesiolka, J., Michalowski, D., Wrzesinski, J., Krajewski, J., and Krzyzo-
siak, W. J. (1998). Patterns of cleavages induced by lead ions in
defined RNA secondary structure motifs. J. Mol. Biol. 275, 211–220.
Cui, T., Sankar, S., and Porter, A. G. (1993). Binding of encephelomyo-
carditis virus RNA polymerase to the 3⬘ noncoding region of the viral
RNA is specific and requires the 3⬘ poly A tail. J. Biol. Chem. 268,
26093–26098.
Gornicki, P., Baudin, F., Romby, P., Wiewiorowski, M., Krzyzosiak, W. J.,
Ebel, J. P., Ehresmann, C., and Ehresmann, B. (1989). Use of Pb(II) to
probe the structure of large RNAs. Conformation of 3⬘ terminal
domain of E. coli 16S rRNA and its involvement in building the tRNA
binding sites. J. Biomol. Struct. Dynam. 6, 971–984.
Graaff, M. D., Thorburn, C., and Jaspars, E. M. J. (1995). Interaction
between RNA dependent RNA polymerase of alfalfa mosaic virus
and its template: Oxidation of vicinal hydroxyl groups blocks in vitro
RNA synthesis. Virology 213, 650–654.
Hwang, Y. K., and Brinton, M. A. (1998). A 68-nucleotide sequence within
the 3⬘ noncoding region of simian hemorrhagic fever virus negative
strand RNA binds to four MA104 cell proteins. J. Virol. 72, 4341–4351.
Jameel, S., Zafrullah, M., Ozdener, M. H., and Panda, S. K. (1996).
Expression in animal cells and characterization of the hepatitis E
virus structural proteins. J. Virol. 70, 207–216.
Khuroo, M. S. (1980). Study of an epidemic of non A, non B hepatitis:
Possibility of another human hepatitis virus distinct from post trans-
fusion non-A, non-B type. Am. J. Med. 68, 818–823.
Khuroo, M. S. (1991). Hepatitis E: The enterically transmitted non A, non
B hepatitis. Indian J. Gastroenterol. 10, 96–100.
Koonin, E. V., Gorbalenya, A. E., Purdy, M. A., Rozanov, M. N., Reyes,
G. R., and Bradley, D. W. (1992). Computer-assisted assignment of
functional domains in the nonstructural polyprotein of hepatitis E
virus: Delineation of an additional group of positive-strand RNA plant
and animal viruses. Proc. Natl. Acad. Sci. USA 89, 8259–8263.
Krzyzosiak, W. J., Marciniec, T., Wiewiorowski, M., Romby, P., Ebel, J. P.,
and Giege, R. (1998). Characterisation of Pb(II) induced cleavages in
tRNAs in solution and effect of the Y-base in yeast tRNA Phe. Biochem-
istry 27, 5771–5777.
Kuhn, R. J., Hong, Z., and Strauss, J. H. (1990). Mutagenesis of the 3⬘
nontranslated region of Sindbis virus RNA. J. Virol. 64, 1465–1476.
Kusov, Y., Weitz, M., Dollenmeier, G., Muller, V. G., and Siegl, G. (1996).
RNA-protein interactions at the 3⬘ end of the hepatitis A virus RNA.
J. Virol. 70, 1890–1897.
Luo, G., Hamatake, R. K., Mathis, D. M., Racela, J., Rigat, K. L., Lemm, J.,
and Colonno, R. J. (2000). De novo initiation of RNA synthesis by the
RNA-dependent RNA polymerase (NS5B) of hepatitis C virus. J. Virol.
74, 851–863.
Marciniec, T., Ciesiolka, J., Wrzesinski, J., and Krzyzosiak, W. J. (1989).
Identification of magnesium, europium and lead binding sites in E.
coli and lupine tRNA Phe by specific metal ion induces cleavages.
FEBS Lett. 243, 293–298.
Morrow, C. D., Lubinski, J., Hocko, J., Gibbons, G. F., and Dasgupta, A.
(1985). Purification of a soluble template-dependent rhinovirus RNA
polymerase and its dependence on a host cell protein for viral RNA
synthesis. J. Virol. 53, 266–272.
Neufeld, K. L., Richards, O. C., and Ehrenfeld, E. (1991). Purification,
characterization, and comparison of poliovirus RNA polymerase from
native and recombinant sources. J. Biol. Chem. 266, 24212–24219.
Nanda, S. K., Kezbau, Y., Panigrahi, A. K., Acharya, S. K., Jameel, S., and
Panda, S. K. (1994a). Etiological role of hepatitis E virus in sporadic
fulminant hepatitis. J. Med. Virol. 42, 133–137.
 RNA-RdRp INTERACTIONS AT THE 3⬘ END OF HEV RNA
Nanda, S. K., Panda, S. K., Durgapal, H., and Jameel, S. (1994b). Detec-
tion of negative strand of hepatitis E virus RNA in the livers of
experimentally infected rhesus monkeys: Evidence for viral replica-
tion. J. Med. Virol. 42, 237–240.
Oh, J. W., Ito, T., and Lai, M. M. (1999). A recombinant hepatitis C virus
RNA-dependent RNA polymerase capable of copying the full-length
viral RNA. J. Virol. 73, 7694–7702.
Oh, J. W., Sheu, G. T., and Lai, M. M. (2000). Template requirement and
initiation site selection by hepatitis C virus polymerase on a minimal
viral RNA template. J. Biol. Chem., in press.
Panda, S. K., Datta, R., Kaur, K., Zuckerman, A. J., and Nayak, N. C.
(1989). Enterically transmitted non-A, non-B hepatitis: recovery of
virus like particles from an epidemic in South Delhi and transmission
studies in rhesus monkeys. Hepatology 10, 466–472.
Panda, S. K., Nanda, S. K., Zafrullah, M., Ansari, I. H., Ozdener, M. H.,
and Jameel, S. (1995). An Indian strain of hepatitis E virus (HEV):
Cloning, sequencing and expression of structural region and anti-
body responses in sera from individuals from an area of high-level
HEV endemicity. J. Clin. Microbiol. 33, 2653–2659.
Panda, S. K., and Jameel, S. (1997). Hepatitis E virus: from epidemiology
to molecular biology. Viral Hepatitis Rev. 3, 227–251.
Panda, S. K., Ansari, I. H., Durgapal, H., Agrawal, S., and Jameel, S.
(2000). The in-vitro synthesized RNA from a cDNA clone of hepatitis
E virus (HEV) is infectious. J. Virol. 74, 2430–2437.
Pardigon, N., Lenches, E., and Strauss, J. H. (1993). Multiple binding
sites for cellular proteins in the 3⬘ end of sindbis alphavirus minus-
sense RNA. J. Virol. 67, 5003–5011.
Pata, J. D., Schultz, S. C., and Kirkegaard, K. (1995). Functional oligomer-
ization of poliovirus RNA dependent RNA polymerase. RNA 1, 466–
477.
Plotch, S. J., Palant, O., and Gluzman, Y. (1989). Purification and prop-
erties of poliovirus RNA polymerase expressed in Escherichia coli.
J. Virol. 63, 216–225.
Promega (1996). Promega protocols and applications guide, III ed.,
Determination of percent incorporation and specific activity, pp. 118–
119. Promega, Madison, WI. (ISBN 1-882274-57-1).
Purdy, M. A., Tam, A. W., Huang, C. C., Yarbough, P. O., and Reyes, G. R.
(1993). Hepatitis E virus: A non-enveloped member of the ‘alpha-like’
RNA virus supergroup. Sem. Virol. 4, 319–326.
Quadt, R., and Jaspars, E. M. (1990). Purification and characterization of
brome mosaic virus RNA-dependent RNA polymerase. Virology 178,
189–194.
Quadt, R., Kao, C. C., Browning, K. S., Hershberger, R. P., and Ahlquist,
P. (1993). Characterization of a host protein associated with brome
mosaic virus dependent RNA polymerase. Proc. Natl. Acad. Sci. USA
90, 1498–1502.
Ray, R., Aggarwal, R., Salunke, P. N., Mehrotra, N. N., Talwar, G. P., and
Naik, S. R. (1991). Hepatitis E virus genome in stools of hepatitis
patients during large epidemic in north India. Lancet 338, 783–784.
Reyes, G. R., Yarbough, P. O., Tam, A. W., Purdy, M. A., Huang, C. C., Kim,
J. S., Bradley, D. W., and Fry, K. E. (1991). Hepatitis E virus (HEV): The
novel agent responsible for enterically transmitted nonA, non B
hepatitis. Gastroenterol. Jpn. 26(Suppl. 3), 142–147.
Reyes, G. R., Huang, C. C., Tam, A. W., and Purdy, M. A. (1993).
Molecular organisation and replication of hepatitis E virus (HEV).
Arch. Virol. (Suppl. 7), 15–25.
Rohll, J. B., Percy, N., Ley, R., Evans, D. J., Almond, J. W., and Barclay,
W. S. (1994). The 5⬘ untranslated regions of picornavirus RNAs
101
contain independent functional domains essential for RNA replica-
tion and translation. J. Virol. 68, 4384–4391.
Sampson, J. R., Sullivan, F. X., Behlen, L. S., DiRenzo, A. B., and
Uhlenbeck, O. C. (1987). Characterization of two RNA catalyzed RNA
cleavage reaction. Cold Spring Harbor Symp. Quant. Biol. 52, 267–
275.
Song, C., and Simon, A. E. (1995). Requirement of a 3⬘ terminal stem
loop in in vitro transcription by an RNA dependent RNA polymerase.
J. Mol. Biol. 254, 6–14.
Tam, A. W., Smith, M. M., Guerra, M. E., Huang, C. C., Bradley, D. W., Fry,
K. E., and Reyes, G. R. (1991). Hepatitis E virus (HEV): Molecular
cloning and sequencing of the full-length viral genome. Virology 185,
120–131.
Tan, B. H., Fu, J., Sugrue, R. J., Yap, E. H., Chan, Y. C., and Tan, Y. H.
(1996). Recombinant dengue type 1 virus NS5 protein expressed in
Escherichia coli exhibits RNA-dependent RNA polymerase activity.
Virology 216, 317–325.
Tiley, L., Hagen, M., Matthews, J. T., and Krystal, M. (1994). Sequence
specific binding of the influenza virus RNA polymerase to sequences
located at the 5⬘ ends of the viral RNAs. J. Virol. 68, 5108–5116.
The International Committee on the Taxonomy of Viruses, 8th report (in
press). http://www.ncbi.nlm.nih.gov/ICTV/
Todd, S., Nguyen, J. H. C., and Semler, B. L. (1995). RNA-protein inter-
actions directed by the 3⬘ end of human rhinovirus genomic RNA.
J. Virol. 69, 3605–3614.
Tsai, C. H., Cheng, C. P., Peng, C. W., Lin, B. Y., Lin, N. S., and Hsu, Y. H.
(1999). Sufficient length of a poly(A) tail for the formation of a potential
pseudoknot is required for efficient replication of bamboo mosaic
potexivirus RNA. J. Virol. 73, 2703–2709.
Walter, A. E., and Turner, D. H. (1994). Sequence dependence of stability
for coaxial stacking of RNA helixes with Watson-Crick base paired
interfaces. Biochemistry 33, 12715–12719.
Wong, D. C., Purcell, R. H., Sreenivasan, M. A., Prasad, S. R., and Pauri,
K. M. (1980). Epidemic and endemic hepatitis in India: Evidence for a
non A, non B hepatitis virus aetiology. Lancet 2, 876–879.
Yen, J. H., Chang, S. C., Hu, C. R., Chu, S. C., Lin, S. S., Hsieh, Y. S., and
Chang, M. F. (1995). Cellular proteins specifically bind to the 5⬘
noncoding region of hepatitis C virus RNA. Virology 208, 723–732.
Yu, W., and Leibowitz, J. L. (1995a). A conserved motif at the 3⬘ end of
mouse hepatitis virus genomic RNA required for host protein binding
and viral RNA replication. Virology 214, 128–138.
Yu, W., and Leibowitz, J. L. (1995b). Specific binding of host cellular
proteins to multiple sites within the 3⬘ end of mouse hepatitis virus
genomic RNA. J. Virol. 69, 2016–2023.
Zabel, P., Weenen-Swaans, H., and van Kammen, A. (1974). In vitro
replication of cowpea mosaic virus RNA. I. Isolation and properties of
the membrane-bound replicase. J. Virol. 14, 1049–1055.
Zafrullah, M., Ozdener, M. H., Panda, S. K., and Jameel, S. (1997). The
ORF3 protein of hepatitis E virus is a phosphoprotein that associates
with the cytoskeleton. J. Virol. 71, 9045–9053.
Zietkiewicz, E., Ciesiolka, J., Krzyzosiak, W. J., and Slomski, R. (1990).
The secondary structure model of mouse U1, snRNA as determined
from the results of Pb 2⫹ induced hydrolysis. In “Nuclear Structure and
Function” (J. R. Harris and J. B. Zbraski, Eds.), pp. 453–457. Plenum,
New York.
Zuker, M. (1989). On finding all suboptimal foldings of an RNA molecule.
Science 244, 48–52.