Quantitative PCR Analysis of Mitochondrial

DNA Content in Patients with

Mitochondrial Disease
REN-KUI BAI, CHERNG-LIH PERNG, CHANG-HUNG HSU, AND
LEE-JUN C. WONG
Institute for Molecular and Human Genetics, Georgetown University Medical Center,
Washington DC 20007, USA

ABSTRACT: Molecular diagnosis of mitochondrial DNA disorder is usually

focused on point mutations and large deletions. In the absence of detectable
mtDNA mutations, abnormal amounts of mtDNA, either depletion or
elevation, can be indicative of mitochondrial dysfunction. The amount of
mitochondrial DNA (mtDNA), however, varies among individuals of different
ages and among different tissues within the same individual. To establish a
range of mtDNA levels, we analyzed 300 muscle and 200 blood specimens from
patients suspected of having a mitochondrial disorder by real-time quan-
titative polymerase chain reaction (PCR) method. Copy numbers were calcu-
lated from the standard curve and threshold cycle number using TaqMan
probes; 6FAM 5′TTACCGGGCTCTGCCATCT3′-TAMRA and VIC-
5′AGCAATAACAGGTCTGTGATG3′-TAMRA for mtDNA and 18S rRNA
gene (nDNA), respectively. The copy number ratio of mtDNA to nDNA was
used as a measure of mtDNA content in each specimen. The mtDNA content in
muscle increases steadily from birth to about 5 years of age; thereafter, it stays
about the same. On the contrary, the mtDNA content in blood decreases with
age. The amount of mtDNA in skeletal muscle is about 5–20 times higher than
that in blood. About 7% of patients had mtDNA levels in muscle below 20% of
the mean of the age-matched group, and about 10% of patients had muscle
mtDNA levels 2- to 16-fold higher than the mean of the age-matched group.
Patients with abnormal levels of mtDNA, either depletion or proliferation, had
significant clinical manifestations characteristic of mitochondrial disease in
addition to abnormal respiratory enzymes and mitochondrial cytopathies.
Cardiomyopathy, lactic acidosis, abnormal brain MRI findings, hypotonia,
developmental delay, seizures, and failure to thrive are general clinical pictures
of patients with mtDNA depletion. The average age of patients with mtDNA
depletion is 4.1 years, compared to 23.6 years in patients with mtDNA prolifer-
ation. Mutations in nuclear genes involved in mtDNA synthesis and deoxy-
nucleotide pools are probably the cause of mtDNA depletion. Our results
demonstrate that real time quantitative PCR is a valuable tool for molecular
screening of mitochondrial diseases.

KEYWORDS: mtDNA depletion; quantitative analysis of mtDNA; real-time

PCR analysis; mitochondrial DNA copy number

Address for correspondence: Lee-Jun C. Wong, Ph.D., Institute for Molecular and Human
Genetics, Georgetown University Medical Center, M4000, 3800 Reservoir Rd., NW, Washington,
DC 20007. Voice: 202-784-0760; fax: 202-784-1770.
wonglj@georgetown.edu

Ann. N.Y. Acad. Sci. 1011: 304–309 (2004). © 2004 New York Academy of Sciences.
doi: 10.1196/annals.1293.029

304
BAI et al.: PCR ANALYSIS IN MITOCHONDRIAL DISEASE 305

INTRODUCTION

Point mutations and large deletions in mtDNA account for the molecular defects
in a small portion of patients with mitochondrial respiratory deficiency.1–3 Possibly
the respiratory defects in some of these patients are caused by a quantitative defi-
ciency in mtDNA content rather than specific mutations. Previous studies indicate
that mtDNA depletion due to mutations in the thymidine phosphorylase (TP) gene
are responsible for the mitochondrial neurogastrointestinal encephalomyopathy
(MNGIE) syndrome.4–6 Mutations in nuclear genes that are involved in mtDNA
synthesis or maintenance of deoxynucleotide pools may affect the biogenesis of
mitochondria and therefore affect the mtDNA content. On the other hand, defective
mitochondria are often proliferated. Thus, mtDNA amplification could be a compen-
satory mechanism in response to inefficient mitochondrial respiratory function.
Here, we report the use of a real-time quantitative PCR assay to determine the
mtDNA content in muscle and blood. Quantitative alterations in mtDNA may have
implications in molecular defects of nuclear or mitochondrial genes.

MATERIAL AND METHODS

Specimens and DNA Isolation

Patients were referred to the Molecular Genetics Laboratory, Institute for Molec-
ular and Human Genetics at Georgetown University Medical Center for molecular
diagnosis of mitochondrial disorders. Total DNA was isolated from 300 muscle
specimens using proteinase K digestion followed by standard phenol/chloroform
extraction and ethanol precipitation.7 Blood DNA was extracted by a salting-out
method8 from peripheral blood lymphocytes from 200 patients.

Primers and Probes

The primers for RT Q-PCR analysis of mtDNA are mtF3212

(5′CACCCAAGAACAGGGTTTGT3′) and mtR3319 (5′TGGCCATGGGTATGTT-
GTTAA3′), those for the nuclear DNA (nDNA), 18S rRNA gene are 18S1546F
(5′TAGAGGGACAAGTGGCGTTC3′) and 18S1650R (5′CGCTGAGCCAGTCA-
GTGT3′).9 The TaqMan probes; 6FAM-5′TTACCGGGCTCTGCCATCT3′-
TAMRA and VIC-5′AGCAATAACAGGTCTGTGATG3′-TAMRA, were labeled at
the 5′ end with a fluorescent reporter, 6FAM and VIC, for the mtDNA and the nDNA
18S rRNA gene, respectively, whereas the 3′ ends were labeled with a quencher
TAMRA. The 10 µL PCR reaction contains 1× TaqMan Universal PCR Master Mix
(ABI P/N 4304437), 500 nM of each primer, 200 nM of TaqMan probe, and 0.2–2
ng of total genomic DNA extract. PCR conditions are 2 min at 50°C, 10 min at 95°C,
followed by 40 cycles of 15 s of denaturation at 95°C and 60 s of annealing/extension
at 60°C. Real-time quantitative analysis was performed on the Sequence Detector
System ABI-Prism 7700.9
306 ANNALS NEW YORK ACADEMY OF SCIENCES

FIGURE 1. Real-time PCR analysis. Standard curve of the mtDNA and the 18S rRNA
gene. The cloned PCR products from both the mtDNA and the 18S rDNA were serially
diluted for real-time PCR. The copy number in each dilution was calculated from the actual
DNA concentration. The threshold cycle number (CT) was plotted against the copy number
of the DNA template at the start of PCR. DNA samples of unknown copy numbers were
analyzed using the same conditions. The copy number of mtDNA and nDNA was calculated
from the CT number and by use of the standard curve.
BAI et al.: PCR ANALYSIS IN MITOCHONDRIAL DISEASE 307

TABLE 1. Comparison between the two groups of patients with mtDNA depletion
and mtDNA proliferation
mtDNA proliferation mtDNA depletion
(>twofold of mean) (<30% of mean)
Total number 29/300 27/300
Average age 23.6 years 4.1 years
Male/female 12/17 11/16
<10-year-old 15 (9/15 >3.6-fold) 24
Major clinical Muscle weakness Cardiomyopathy
manifestation Exercise intolerance Low plasma carnitine
Fatigability Failure to thrive
Ophthalmoplegia Abnormal MRI
Lactic acidosis Lactic acidosis
Seizure Seizure
Hypotonia Hypotonia
Developmental delay Developmental delay
Abnormal histochemistry Abnormal histochemistry
Abnormal respiratory enzyme Abnormal respiratory enzyme
Ophthalmoplegia
Elevated CSF protein

Standard Curve
Standard DNA solutions for the mitochondrial genome and the nuclear 18S rRNA
gene (nDNA) were generated from PCR products cloned in a vector of pCR2.1-
TOPO. Serial dilutions were made and RT Q-PCR reactions were performed as just
described to construct the standard curve from the CT values and the number of
copies of the standard plasmid DNA (FIG. 1A).

Determination of mtDNA/nDNA Ratio as a Measure of mtDNA Content

FIGURE 1B illustrates a sample run. The copy number of the mtDNA and the
nDNA is calculated using the threshold cycle number (CT) and intrapolating from
the standard curve. The ratio of the copy number of mtDNA to the copy number of
nDNA is the measurement of mtDNA content. FIGURE 1B shows four specimens
with mtDNA/nDNA ratio from 0.32 to 239.

RESULTS

The ratio of mtDNA/nDNA in muscle varies from 0.1 to 1700, and in blood varies
from 0.05 to 23. Evidently, some patients had markedly elevated mtDNA and some
had severely depleted mtDNA, particularly in muscle. The average mtDNA content
was calculated for each age group by excluding the samples in the highest and lowest
10%. The results show that the mtDNA content increases from birth to about 5 years
of age and remains at about the same level after that (FIG. 2A). On the contrary, the
mtDNA content in blood decreases with age (FIG. 2B). The amount of mtDNA in
skeletal muscle is about 5–20 times higher than that in blood. About 7% of patients
308 ANNALS NEW YORK ACADEMY OF SCIENCES

FIGURE 2. mtDNA content in muscle and blood of various age groups of patients mea-
sured by mtDNA/18Sr DNA copy number ratios. (A) Muscle specimens; (B) blood specimens.

had mtDNA levels in muscle below 20% of the age-matched mean, and about 10%
of patients had muscle mtDNA levels 2- to 16-fold higher than that of the age-
matched mean. Patients with an abnormally high or low level of mtDNA shared
some significant clinical features of mitochondrial disease as well as abnormal res-
piratory enzymes and mitochondrial cytopathies (TABLE 1). Cardiomyopathy, lactic
acidosis, abnormal brain MRI, hypotonia, developmental delay, seizure, and failure
to thrive are general clinical manifestations that seem to be associated with young
patients (<10) with mtDNA depletion (<30% of age-matched mean). However,
muscle weakness, exercise intolerance, ophthalmoplegia, and lactic acidosis seem to
be the predominant clinical symptoms of patients with elevated mtDNA content. The
average age, 4.1 and 23.6 years for patients with mtDNA depletion and mtDNA pro-
liferation, respectively, is significantly different (TABLE 1).
BAI et al.: PCR ANALYSIS IN MITOCHONDRIAL DISEASE 309

DISCUSSION AND CONCLUSION

Most patients with severe mtDNA depletion are young children, with an average
age of 4.1 years. We sequenced the TP gene of these patients and found mutations in
only 1 patient (data not shown) who was 20 years old. Although mutations in the TP
gene are the main cause of mtDNA depletion in adult patients with MNGIE, TP gene
mutations do not seem to be the reason for mtDNA depletion in children <10 based
on these results. It is very likely that mutations in other nuclear genes involved in
mtDNA synthesis or deoxynucleotide pools, such as polymerase gamma, DNA heli-
case, nucleotide translocase, or thymidine kinase, are responsible for the mtDNA
depletion in these patients. The patients who had mtDNA proliferation were much
older, and their muscle biopsies showed evidence of ragged-red fibers. The increase
in mtDNA content in these cases correlates with mitochondrial proliferation and this
is probably a compensatory mechanism for defective mitochondria. Knowing the
mtDNA content in muscle tissue will facilitate the search for the molecular defects
responsible for the mitochondrial disease.

REFERENCES

1. LIANG, M.H. & L.-J.C. WONG. 1998. Yield of mtDNA mutation analysis in 2000
patients. Am. J. Med. Genet. 77: 385–400.
2. WONG, L.-J.C. 2001. Recognition of mitochondrial DNA deletion syndrome with non-
neuromuscular multisystemic manifestation. Genet. Med. 3: 399–404.
3. WONG, L.-J.C., M.-H. LIANG, H. KWON, et al. 2002. Comprehensive scanning of the
whole mitochondrial genome for mutations. Clin. Chem. 48: 1901–1912.
4. NISHINO, I., A. SPINAZZOLA & M. HIRANO. 1999. Thymidine phosphorylase gene muta-
tions in MNGIE, a human mitochondrial disorder. Science 283: 689–692.
5. NISHINO, I., A. SPINAZZOLA, A. PAPADIMITRIOU, et al. 2000. Mitochondrial neurogas-
trointestinal encephalomyopathy: an autosomal recessive disorder due to thymidine
phosphorylase mutations. Ann. Neurol. 47: 792–800.
6. HIRANO, M., R. MARTI, C. FERREIRO-BARROS, et al. 2001. Defects of intergenomic
communication: autosomal disorders that cause multiple deletions and depletion of
mitochondrial DNA. Semin. Cell Dev. Biol. 12: 417–427.
7. WONG, L.-J.C. & C. LAM. 1997. Alternative, noninvasive tissues for quantitative
screening of mutant mitochondrial DNA. Clin. Chem. 43: 1241–1243.
8. LAHIRI, D. & J. NURNBERGER, JR. 1991. A rapid non-enzymatic method for the prepara-
tion of HMW DNA from blood for RFLP studies. Nucleic Acids Res. 19: 5444.
9. WONG, L.-J.C. & R. BAI. 2002. Real-time quantitative PCR analysis of mitochodnrial
DNA in patients with mitochondrial disease. Am. J. Hum. Genet. Suppl. 71: 501.