Evidence of Coexistence of C3 and C4 Photosynthetic

Pathways in a Green-Tide-Forming Alga, Ulva prolifera

Jianfang Xu1., Xiao Fan2., Xiaowen Zhang2, Dong Xu2, Shanli Mou1, Shaona Cao3, Zhou Zheng1,
Jinlai Miao1, Naihao Ye2*
1 Key Laboratory of Marine Bioactive substance, The First Institute of Oceanography, State Oceanic Administration, Qingdao, China, 2 Yellow Sea Fisheries Research
Institute, Chinese Academy of Fishery Sciences, Qingdao, China, 3 Qingdao Agricultural University, Qingdao, China

Abstract
Ulva prolifera, a typical green-tide-forming alga, can accumulate a large biomass in a relatively short time period, suggesting
that photosynthesis in this organism, particularly its carbon fixation pathway, must be very efficient. Green algae are known
to generally perform C3 photosynthesis, but recent metabolic labeling and genome sequencing data suggest that they may
also perform C4 photosynthesis, so C4 photosynthesis might be more wide-spread than previously anticipated. Both C3 and
C4 photosynthesis genes were found in U. prolifera by transcriptome sequencing. We also discovered the key enzymes of C4
metabolism based on functional analysis, such as pyruvate orthophosphate dikinase (PPDK), phosphoenolpyruvate
carboxylase (PEPC), and phosphoenolpyruvate carboxykinase (PCK). To investigate whether the alga operates a C4-like
pathway, the expression of rbcL and PPDK and their enzyme activities were measured under various forms and intensities of
stress (differing levels of salinity, light intensity, and temperature). The expression of rbcL and PPDK and their enzyme
activities were higher under adverse circumstances. However, under conditions of desiccation, the expression of rbcL and
ribulose-1, 5-biphosphate carboxylase (RuBPCase) activity was lower, whereas that of PPDK was higher. These results
suggest that elevated PPDK activity may alter carbon metabolism and lead to a partial operation of C4-type carbon
metabolism in U. prolifera, probably contributing to its wide distribution and massive, repeated blooms in the Yellow Sea.

Citation: Xu J, Fan X, Zhang X, Xu D, Mou S, et al. (2012) Evidence of Coexistence of C3 and C4 Photosynthetic Pathways in a Green-Tide-Forming Alga, Ulva
prolifera. PLoS ONE 7(5): e37438. doi:10.1371/journal.pone.0037438
Editor: Vasu D. Appanna, Laurentian University, Canada
Received February 14, 2012; Accepted April 22, 2012; Published May 16, 2012
Copyright: ß 2012 Xu et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by Shandong Science and Technology plan project (2011GHY11528), the Specialized Fund for the Basic Research Operating
expenses Program (20603022012004), National Natural Science Foundation of China (41176153), Natural Science Foundation of Shandong Province
(2009ZRA02075), Qingdao Municipal Science and Technology plan project (11-3-1-5-hy), Qingdao Municipal Science and Technology plan project (10-3-4-11-1-
jch), National Marine Public Welfare Research Project (200805069). The funders had no role in study design, data collection and analysis, decision to publish, or
preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: yenh@ysfri.ac.cn
. These authors contributed equally to this work.

Introduction
Carbon fixation is an important biological process in all
photosynthetic organisms. C4 plants are characterized by high
rates of photosynthesis and efficient use of water and nitrogen
resources [1]. High photosynthetic rates are achieved by addition
of a new metabolic pathway, the C4 cycle, in which the initial
product of CO2 fixation is a four-carbon (C) organic acid rather
than a three-carbon (C) acid. C4 plants show drastically reduced
rates of photorespiration because CO2 is concentrated at the site of
Rubisco and is able to outcompete molecular oxygen, which, when
used by Rubisco, results in photorespiration [2]. The C4
photosynthetic carbon cycle is an elaborated addition to the C3
photosynthetic pathway, which ensures high rates of photosyn-
thesis even when CO2 concentrations are low. C4 photosynthesis
evolved several times independently during the evolution of higher
plants. It originated at least 32 times in eudicots and 16 times in
monocots [3]. It had evolved from ancestral C3 plants via a series
of anatomical and physiological adaptations to high light
intensities, high temperatures, low pCO2, and dryness [4].
In aquatic environments, [CO2] can be a primary limitation for
photosynthesis because of the low capacity of water to hold
gaseous CO2 and the slow diffusion rate of dissolved molecules
[5,6]. It has been demonstrated that many aquatic photosynthetic
organisms can take up both CO2 and HCO32 from the
surrounding media, and this capacity is greatly strengthened
under CO2-limiting conditions, including the atmospheric pres-
sure of CO2. This system is generally known as the inorganic
carbon-concentrating mechanism (CCM) [7]. Cyanobacteria,
algae, and some angiosperms evolved multiple mechanisms to
actively accumulate inorganic carbon around Rubisco by use of
membrane transporters and carbonic anhydrases [8]. The aquatic
environment is home to as great a diversity of photosynthetic
pathways as terrestrial environments, and there exist C3, C4,
CAM, and C3–C4 photosynthetic pathways [9]. Although
apparently lacking Kranz anatomy, aquatic Orcuttia californica (an
aquatic embryophyte) could also conduct C4 photosynthesis [9].
Some species, such as Chara contraria (a charophyte green algae),
Marsilea vestita (an embryophyte), Eleocharis acicularis (an embryo-
phyte) and Pilularia Americana (an embryophyte), have both C3 and
C4 fixation in aquatic habitats [9]. Alterations of photosynthetic
pathways under environmental stress have been suggested to
contribute to the adaptation of plants to environmental stress [10].
For example, Hydrilla verticillata, a submerged aquatic plant,

PLoS ONE | www.plosone.org 1 May 2012 | Volume 7 | Issue 5 | e37438


changes its photosynthetic pathway from C3 to C4 under
conditions of CO2 deficiency [11]. Therefore, environmental
factors are of critical importance in the change of photosynthetic
pathways.
From many studies on primary photosynthetic carbon metab-
olism, it is believed that the operation of the Calvin–Benson cycle
(C3 cycle) is predominant in algae [12,13]. However, recent papers
have reported evidence for the operation of C4 photosynthesis as
an alternative CCM in the marine diatom Thalassiosira weissflogii
[14–17]. The case for C4 photosynthesis has been further
strengthened by the occurrence of relevant genes in recently
sequenced marine phytoplankton genomes, including the diatoms
Thalassiosira pseudonana and Phaeodactylum tricornutum and the green
alga Ostreococcus tauri and Micromonas [18–22]. Ostreococcus has all the
machinery necessary to perform C4 photosynthesis. This includes
a plastid-targeted NADP(1)-dependent malic enzyme and a
phosphoenolpyruvate carboxylase [22]. However, conflicting
experimental data shedding doubt on C4 photosynthesis in
diatoms have been reported [16,17], and genomic data do not
fully clarify the presence and localization of the enzymes that may
drive this mechanism [23,24]. No clear evidence for such C4-like
processes have been found in the marine diatoms P. tricornutum and
T. pseudonana, for which whole genome sequences are available
[25]. The general occurrence of C4-like mechanisms in diatoms is
therefore still in question [7,16].
As a special type of harmful algal blooms (HABs), green tides
have been increasing in severity and geographic range and are
now of growing concern globally. Green tides are vast accumu-
lations of unattached green macroalgae usually associated with
eutrophied marine environments [26,27]. The great majority of
green tides are reported to consist of members of just one genus,
Ulva (some of the species formerly known as Enteromorpha) [28,29].
Ulva prolifera, a representative green-tide-forming macroalga [26],
is the dominant Ulva species along the coastline of the Yellow Sea
between June and August [30,31]. U. prolifera, as an intertidal
macroalga, can tolerate various kinds of abiotic stresses, including
desiccation, changes in temperature and salinity, and exposure to
high levels of solar radiation during low tide [32]. Furthermore,
the evolutionary status of intertidal pluricellular green algae is
between the unicellular green algae and lower land plants, which is
an important stage during evolution [33].
It has been proved that marine algae contain C4-Pathway,
including Ulva species [34]. Kremer and Küppers (1977) found
that the percentage of malate and aspartate usually accounts for
distinctly less than 10% of the total 14C-labelling in three Ulva
species, and these findings were consistent with data from
enzymatic analyses, since 86–90% of the carboxylation capacity
was due to ribulose-l.5-biphosphate carboxylase in those green
algae [34]. Moreover, the occurrence of PEP-C besides RubP-C
has been reported from Ulva using 14C-labelling technique [35,36].
One of the most standard comparisons of differences in isotopic
ratios is the comparison of 13C to 12C in plants to determine
photosynthetic pathway of plants. C3 and C4 plants have different
d13C values, 228.162.5%, 213.561.5% respectively [37].
Among C3 and C4 plants, d13C variation can range from 2–5%.
Previous research approved that Ulva are C4 species since there
d13C values are in the range of 21464% [38,39].
In this study we used next generation sequencing (NGS)
technology confirmed the existence of genes necessary for a C4
pathway in U. prolifera, and we then chose to compare transcript
abundance of U. prolifera with that of the closest relative, U. linza,
which has been confirmed to possess the C4 pathway (unpublished
data). Subsequently, we focused on the expression profile of two
key enzymes, namely RuBPCase and PPDK. Ribulose-1, 5-
PLoS ONE | www.plosone.org
C3 and C4 Pathways in Ulva prolifera
biphosphate carboxylase, a key enzyme of the C3 pathway,
catalyzes the first major step in carbon fixation. Pyruvate
orthophosphate dikinase, a cardinal enzyme of the C4 pathway,
catalyzes the regeneration of phosphoenolpyruvate (PEP), the
primary carboxylation substrate from pyruvate, Pi, and ATP [40].
The rate of PEP formation by PPDK is the lowest in the C4
pathway; therefore, this reaction is considered to be the rate-
limiting step in the C4 pathway [41]. Our results demonstrate that
U. prolifera may be either a C3–C4 intermediate species or a C3
species displaying C4 metabolic characteristics. The involvement
of C4 metabolism in U. prolifera might account for the boom of
green tide.
Materials and Methods
Sample collection and culture conditions
Floating specimens of U. prolifera were collected in the Yellow
Sea during the green tide bloom in 2011. In the laboratory, the
intact samples were washed several times with sterile seawater,
sterilized with 1% sodium hypochlorite for 2 min, and then rinsed
with autoclaved seawater. The sterilized material was then placed
into an aquarium (d = 40 cm, h = 30 cm) containing enriched and
continually aerated seawater (500 mM NaNO3 and 50 mM
NaH2PO4) and maintained at 15uC under a 12:12 h LD
photoperiod with 50 mmol photons m22 s21 provided by cool-
white fluorescent tubes.
Stress treatments
U. prolifera was exposed to different kinds of stress, namely
desiccation and differing levels of salinity, light intensity, and
temperature. For desiccation stress, the alga were cultured at
50 mmol photons m22 s21 for different durations (0, 1, 2, 3, 4, and
5 h). Salinity stress consisted of subjecting the organism for 3 h to
different salt concentrations (0%, 15%, 30%, 45%, and 60%); In
light intensity treatment, the samples were exposure to 0, 50, 100,
300, 600, 1000, and 2000 mmol photons m22 s21 for 3 h. For the
three forms of stress, temperature was constant at 15uC, and light
intensity during the salinity treatment and the temperature
treatment was maintained at 50 mmol photons m22 s21. For
temperature stress, the materials were cultured at 5, 10, 15, 20, 25,
30 and 35uC for 3 h. Following each stress treatment, rbcL and
PPDK mRNA expression level was measured using qPCR,
RuBPCase and PPDK activity assessed, and Fv/Fm and Y(II)
determined using Dual-PAM-100 (Walz GmbH, Germany).
Light and transmission electron microscopy
The sample preparation was finished according to the methods
mentioned by Chen et al. [42] It consisted of the following steps:
collecting the algal; fixing with 1% (v/v) glutaraldehyde and
postfixing with 1%(v/v) osmium tetroxide both in sterilizing
seawater; dehydration in a series of acetone solutions; suspension
in the mixture of epoxy resin (Epon812) and acetone; embedded in
100% Epon812; polymerized and sectioned using a LeicaUC6
ultra microtome; picked up on 200-mesh copper grids and post-
stained with urinal acetate. Finally, the sections were examined
under an optical microscope (Nikon Eclipse 80i) and a transmis-
sion electron microscopy (Hitachi H-7650) at an accelerating
voltage of 60 kv.
Transcriptome sequencing
The alga were treated with different stress conditions, such as
low temperature (6uC, 2 h), high temperature (42uC, 1 h), high
light (1000 mmol photons m22 s21, 1 h), high salt (93%, 3 h) and
UV-B stress (60 mw cm22, 3 h). Total RNA of all treated samples
2 May 2012 | Volume 7 | Issue 5 | e37438

was extracted and purified, followed by synthesis and purification
of double-stranded cDNA and sequencing of cDNA using a Roche
GS FLX Titanium platform. To reconstruct the metabolic
pathways in U. prolifera, high-quality reads were assigned to the
Kyoto Encyclopedia of Genes and Genomes (KEGG) using the
software package MEGAN (version 4.0) [43].
Sequence Analysis
The partial rbcL cDNA sequence acquired from GenBank and
the cDNA open reading frame (ORF) sequence of PPDK obtained
from transcriptome sequencing, were examined for homology with
other known sequences using the BLAST X program available at
the website of the National Center for Biotechnology Information
,www.ncbi.nlm.nih.gov/blast.. We used the Six Frame Trans-
lation of Sequence system ,http://searchlauncher.bcm.tmc.edu/
seq-util/Options/sixframe.html. analyzing deduced amino acid
sequence. Multiple sequence alignments were generated using the
program CLUSTAL X and then analyzed using the program
BioEdit [44,45]. A phylogenetic tree was constructed using the
neighbor-joining algorithm of the MEGA 4.0 program [46,47].
Real-time quantitative PCR
Total RNA of U. prolifera exposed to each form and level of
stress was extracted using TRIzol reagent (Invitrogen, Carlsbad,
CA, USA) as specified in the user manual and dissolved in
diethypyrocarbonate (DEPC)-treated water. The cDNA used for
real-time quantitative PCR was synthesized from the total RNA
using Moloney murine leukemia virus reverse transcriptase
(Promega Biotech Co., Madison, Wisconsin, USA).
The real-time quantitative PCR reactions were performed with
the ABI StepOne Plus Real-Time PCR System (Applied
Biosystems, USA) using SYBR Green fluorescence (TaKaRa)
according to the manufacturer’s instructions. To normalize the
relative expression of the selected genes, an 18S rDNA gene was
used as reference. Three pairs of gene-specific primers (Table 1)
were designed according to the rbcL cDNA, PPDK cDNA, and
18S rDNA sequences using Primer Express 3.0. For each selected
gene, three biological replicates were assayed independently. The
qPCR amplifications were carried out in a total volume of 20 mL
containing 10 ml of 26 SYBR Premix Ex TaqTM II (TaKaRa
Biotech Co., Dalian, China), 0.6 ml (10 mM) of each primer, 2.0 ml
of the diluted cDNA mix, and 6.8 ml de-ionized water. The qPCR
amplification profile was obtained as follows: 95uC for 30 s
followed by 40 cycles of 95uC for 5 s, 60uC for 10 s, and 72uC for
40 s. The 22DDCT method [48] was used to analyze the
quantitative real-time PCR data.
Enzyme assays
The activity of RuBP carboxylase and PPDK in U. prolifera
exposed to the treatments was measured, RuBP carboxylase
activity by the method described by Gerard and Driscoll and
PPDK activity by that described by Sayre et al. [49,50]; both
methods were modified as required.
For measuring RuBP carboxylase activity, each sample was
ground to a fine powder in liquid nitrogen and homogenized in
pre-cooled rubisco extraction solution (1 ml g21 fresh weight),
pH 7.6, containing 40 mM Tris-HCl buffer with 10 mM MgCl2,
0.25 mM EDTA, and 5 mM reduced glutathione. The homog-
enate was centrifuged at 10 000 g for 10 min at 4uC. The activity
was measured in a 4.5 ml cuvette by adding 3 ml of a reaction
mixture containing 0.2 ml NADH (5 mM), 0.2 ml ATP (50 mM),
0.1 ml enzyme extract, 0.2 ml creatine phosphate (50 mM),
0.2 ml NaHCO3 (0.2 mM), 1.4 ml reaction buffer (0.1 M Tris-
HCl buffer, pH 7.8, with 12 mM MgCl2 and 0.4 mM EDTA),
PLoS ONE | www.plosone.org
C3 and C4 Pathways in Ulva prolifera
Table 1. Primers used in the qPCR assay.
Name Primers Sequence (59-39)
rbcL F TACAAATCTCAAGCCGAAACTG
R AATCTTTAGCAAATTGACCACG
PPDK F CACGAACGACCTTACGCAGA
R ACGGATCAAACGCCATCAC
18S rDNA F ATTAGATACCGTCGTAGTCTCAACC
R TCTGTCAATCCTTCCTATGTCTGG
doi:10.1371/journal.pone.0037438.t001
0.1 ml creatinephosphokinase (160 units ml21), 0.1 ml phospho-
glycerate kinase (160 units ml21), 0.1 ml glyceraldehyde-3-
phosphate dehydrogenase (160 units ml21), and 0.3 ml distilled
water. The reaction was initiated by adding 0.1 mL ribulose-1, 5-
bisphosphate (RuBP) to the reaction cuvette and OD values were
recorded every 20 seconds for 3 min by a spectrophotometer at
340 nm. The enzyme activity was expressed in terms of
micromoles per gram of fresh weight per minute (mmol g21 FW
min21).
For measuring PPDK activity, the samples were ground to a
fine powder in liquid nitrogen and homogenized in pre-cooled
PPDK extraction solution at pH 8.3 (1 ml g21 fresh weight)
containing 100 mM Tris-HCl buffer with 5 mM mercaptoethanol
and 2 mM EDTA. The homogenate was centrifuged at 10 000 g
for 10 min at 4uC. The activity was measured in a 4.5 ml cuvette
by adding 3 ml of a reaction mixture containing 0.1 ml Tris-HCl
buffer (150 mM, pH 8.3, with 18 mM MgSO4), 0.1 ml DTT
(300 mM), 0.1 ml PEP (30 mM), 0.1 ml NADH (4.5 mM), 0.1 ml
AMP (30 mM), 0.1 ml lactic dehydrogenase (60 units ml21),
0.1 ml enzyme extract, and 1.3 ml distilled water. The reaction
was initiated by adding 0.1 mL pyrophosphate natrium to the
reaction cuvette and the OD values were recorded every
20 seconds for 3 min at 340 nm. The PPDK activity was also
expressed in terms of micromoles per gram of fresh weight per
minute (mmol g21 FW min21).
Chlorophyll uorescence measurements
Photosynthetic performance of U. prolifera subjected to the
different treatments was measured using Dual-PAM-100. The
maximal photochemical efficiency of PS II (Fv/Fm) and the
effective PS II quantum yield (Y II) were measured by the method
of Fleming et al. [51]. Before measurement, samples were dark
adapted for 20 min. Optimal chlorophyll fluorescence quantum
yield was calculated according to the following equation: Fv/
Fm = (Fm2F0)/Fm. Fo and Fm refer to the minimal fluorescence
and the maximal fluorescence from dark adapted samples,
respectively. Fv is the difference between Fm and Fo. The culture
experiments were repeated four times.
Results
Transcriptome sequencing
We analyzed the carbon fixation pathway in detail and
discovered some key genes of enzymes involved in the carbon
fixation pathway in U. prolifera, such as phosphoenolpyruvate
carboxylase, aspartate aminotransferase, ribulose bisphosphate
carboxylase, phosphoglycerate kinase, phosphoribulokinase, phos-
phoenolpyruvate carboxykinase, alanine transaminase, malate
dehydrogenase (NADP+), pyruvate orthophosphate dikinase, and
pyruvate kinase (Fig. 1), which provided unequivocal molecular
3 May 2012 | Volume 7 | Issue 5 | e37438

evidence that most of the C3 pathway, C4 pathway, and CAM
pathway genes were actively transcribed in U. prolifera. Figure 1
shows that both U. linza (unpublished) and U. prolifera have most of
the genes that are indispensable to C3 and C4 pathways, and the
relative enzymes are all the same in both algae. However, the
abundances of C3 and C4 pathway genes in U. linza and U. prolifera
are different. The results suggest the possibility of the existence of
two photosynthetic pathways in U. prolifera, the Calvin cycle (C3)
and the Hatch-Slack (C4) carbon fixation pathway.
cDNA Sequence Analysis
The partial rbcL cDNA sequence (FJ042888) was acquired from
GenBank with a 1305 bp sequence encoding 435 amino acid
residues. The PPDK cDNA sequence (JN936854) of ORF was
obtained from the U. prolifera transcriptome database with a
2700 bp sequence encoding 889 amino acid residues. Phylogenetic
analysis was conducted using the amino acid sequences of rbcL and
PPDK (Fig. 2). The phylogenetic tree of rbcL indicated a species
clustering that was basically consistent with the evolution of the
species, and that of PPDK revealed that the C4 pathway had
multiple independent origins. In the phylogenetic tree of rbcL, the
clade of green algae diverged into two clusters: a C3–C4 cluster
including both U. prolifera and O. tauri, which have all the genes
involved in the C4 pathway, and a C3 cluster including C. reinhardtii
and V. carteri. However, PPDK of O. tauri was clustered with the
genes from land plants, and PPDK of O. tauri and E. vivipara
appears to be more ancient than that of higher land plants. PPDK
in U. prolifera was clustered with the genes found in the C3 green
algae (C. reinhardtii and V. carteri.) and in the C3–C4 brown alga T.
pseudonana, and PPDK in T. pseudonana appears to be more ancient
Figure 1. Carbon fixation pathway in U. linza and U. prolifera generated by KEGG. The numbers within the small boxes are enzyme codes.
doi:10.1371/journal.pone.0037438.g001
PLoS ONE | www.plosone.org
C3 and C4 Pathways in Ulva prolifera
than that in green algae. Overall, PPDK in green algae also has
multiple independent origins as that in land plants.
Analysis of rbcL and PPDK gene expression under various
forms of stress
Relative quantitative PCR were carried out to determine the
differences in expression levels of rbcL and PPDK genes under the
different stress treatments. Figures 3A and 3B show the profiles of
expression of rbcL and PPDK as affected by desiccation for varying
lengths of time. The expression levels of rbcL and PPDK under
normal conditions were taken as 1. The expression levels of rbcL
decreased slowly with time, whereas those of PPDK increased
steadily at first, peaking (a 4.9-fold increase) at 2 h, and decreased
thereafter. Levels of salinity affected the expression markedly
compared to that under normal salinity (30%), which was taken as
1. The transcript levels of both rbcL and PPDK increased at lower
and higher levels of salinity but then decreased at very high and
very low salinity (Fig. 3C and 3D). Changes in expression levels
under different light intensities are shown in Figures 3E and 3F.
For each gene, the expression under 50 mmol m22 s21 was taken
as 1. The expression level of rbcL in the dark was similar to that
under normal light intensity, whereas that of PPDK was up-
regulated 1.5-fold in the dark. The expression level of rbcL peaked
at 300 mmol photons m22 s21, while that of PPDK peaked at
600 mmol photons m22 s21. Although the expression of PPDK
decreased under high light intensity, it was still higher than it was
under normal light intensity. Moreover, the effect of light
intensities on PPDK was significantly higher than it was on rbcL.
The expression of rbcL and PPDK at normal temperature (15uC)
was taken as 1. The expression levels of rbcL reached the lowest
point at 20uC, whereas those of PPDK were reached at 25uC. The
4 May 2012 | Volume 7 | Issue 5 | e37438
 C3 and C4 Pathways in Ulva prolifera

Figure 2. Phylogenetic analysis of rbcL and PPDK. The phylogenetic tree was constructed by the neighbor-joining (NJ) method using Mega
(version 4.0). Bootstrap analysis was computed with 1000 replicates and bootstrap values below 50% were omitted. C3–C4 refers to species that
possessed the genes for both C3 and C4 photosynthesis with C3 photosynthesis being the primary pathway. (A) Phylogenetic analysis of rbcL.
GenBank accession numbers of the sequences used for constructing the phylogenetic tree of rbcL were as follows: Ulva prolifera (FJ042888),
Thalassiosira pseudonana (YP_874498), Flaveria bidentis (ADW80649), Flaveria trinervia (ADW80661), Flaveria pringlei (ADW80648), Zea mays
(NP_043033), Sorghum bicolor (ABK79504), Oryza sativa (CAG34174), Saccharum officinarum (YP_054639), Arabidopsis thaliana (AAB68400), Volvox
carteri (ACY06055), Chlamydomonas reinhardtii (ACJ50136), Ostreococcus tauri (YP_717262), Ectocarpus siliculosus (CBH31935), Populus tremula
(CAD12560), and Eleocharis vivipara (CAQ53780). (B) Phylogenetic analysis of PPDK. GenBank accession numbers of the sequences used for
constructing the phylogenetic tree of PPDK were as follows: Ulva prolifera (JN936854), Thalassiosira pseudonana (XP_002290738), Flaveria bidentis
(AAA86941), Flaveria trinervia (CAA55703), Flaveria pringlei (CAA53223), Zea mays (ADC32810), Sorghum bicolor (AAP23874), Oryza sativa (CAA06247),
Saccharum officinarum (AAF06668), Arabidopsis thaliana (AEE83621), Volvox carteri (XP_002955807), Chlamydomonas reinhardtii (XP_001702572),
Ostreococcus tauri (XP_003075283), Ectocarpus siliculosus (CBN74442), Populus tremula (CAX83740), and Eleocharis vivipara (BAA21654).
doi:10.1371/journal.pone.0037438.g002

expression of both rose at both higher and lower temperatures decreased rapidly under prolonged desiccation and high light
(Fig. 3G and 3H). intensities.

Activity of RuBP carboxylase and PPDK Discussion

The activity of RuBP carboxylase decreased significantly with
the duration of desiccation, whereas that of PPDK increased with
the duration up to 2 h, the peak value being 1.4 times the normal
value, and decreased thereafter (Fig. 4A). The effects of salinity
level on RuBP carboxylase activity and PPDK activity were
consistent (Fig. 4B): enzyme activity increased at low and high
levels of salinity but then decreased at very low and very high
values. Different light intensities clearly influenced the activity of
both enzymes in a similar direction: the activity began to rise
initially, peaked at 300 or 600 mmol photons m22 s21, and
decreased thereafter as light intensity increased further (Fig. 4C).
There was almost no difference in the activity of RuBP
carboxylase and PPDK between the level under darkness and
that under normal light intensity. Temperature also affected both
enzymes significantly and similarly (Fig. 4D): RuBP carboxylase
reached minimum activity at 20uC and PPDK at 25uC. The
activity of both rose with increasing and decreasing temperatures.
Assay of photosynthetic rate
The optimum quantum yield (Fv/Fm) and effective PSII
quantum yield (Y II) reached higher levels under normal
conditions (15uC, 50 mmol photons m22 s21) and achieved the
maximum values at 25uC, 100 mmol photons m22 s21 (Fig. 5).
Neither was markedly affected by salinity or temperature, but both
Studies of photosynthetic pathways of marine macroalgae are
scanty, and we have a very limited understanding of the
mechanisms controlling the altered cell biology and morphology
associated with C4 Ulva species. In the present study, we found that
almost all transcripts encoding the proteins required for the core
C4 cycle have higher steady-state mRNA levels, suggesting that the
C4 pathway does exist and that the activity of the C4 cycle
enzymes is controlled at least partially at the level of transcript
abundance (Fig. 1). The different expression profiles and product
accumulations of rbcL and PPDK indicated that these two genes
had respectively taken part in C3 and C4 core cycles under
different conditions. We acquired a full-length cDNA sequence of
PPDK, a key enzyme of the C4 pathway, to gain insights into the
evolutionary optimization of C4 biochemistry in Ulva. The
combination of photosynthetic, anatomical, and molecular
datasets enabled us to isolate some of the steps in C4 evolution
and provides fertile new ground for developing hypotheses about
anatomical and ecological conditions that promote the evolution
of this complex trait.
C4 photosynthesis is a series of anatomical and biochemical
modifications that concentrate CO2 around the carboxylating
enzyme Rubisco, thereby increasing photosynthetic efficiency in
conditions promoting high rates of photorespiration. C4 plants are
believed to have evolved gradually from C3 plants through several
intermediate stages of C3–C4 plants [52]. However, the evolu-

PLoS ONE | www.plosone.org 5 May 2012 | Volume 7 | Issue 5 | e37438

 C3 and C4 Pathways in Ulva prolifera

Figure 3. Real-time quantitative PCR analysis for the relative expression level of rbcL and PPDK gene in U. prolifera subjected to
different forms and intensities of stress. Data are means of three independent experiments (6SD). Relative mRNA expression of rbcL and PPDK
exposed to different stress conditions: (A, B) desiccation for different durations up to 5 h, (C, D) different salt concentrations for 3 h, (E, F) different
light intensities for 3 h, (G, H) different temperatures for 3 h.
doi:10.1371/journal.pone.0037438.g003

tionary processes giving rise to C3–C4 intermediates and C4 plants
are yet to be elucidated. Phylogenetic analysis of PPDK revealed
that C4-like photosynthesis in green algae has multiple indepen-
dent origins (Fig. 2), a result that is consistent with the results from
diatoms [19,53,54]. Relative studies on diatoms reveal that they
have obtained a redundant set of carboxylation and decarboxyl-
ation enzymes during complicated endosymbiosis events, which
could potentially constitute C4-type pathways including lateral-
gene transfer (LTG) [54]. Higher plants were exposed to much
higher pCO2 at the beginning of evolutional history but then
became starved for CO2 by a steep decrease of CO2 and increase
of O2. These changes were a major driving force for land plants to

PLoS ONE | www.plosone.org 6 May 2012 | Volume 7 | Issue 5 | e37438

 C3 and C4 Pathways in Ulva prolifera

Figure 4. Activity of RuBP carboxylase and PPDK in U. prolifera exposed to different forms and intensities of stress: (A) desiccation for
different durations up to 5 h, (B) different salt concentrations for 3 h, (C) different light intensities for 3 h, (D) different temperatures for 3 h.
doi:10.1371/journal.pone.0037438.g004

Figure 5. Optimum quantum yield (Fv/Fm) and effective PS II quantum yield (Y II) in U. prolifera under different forms and
intensities of stress: (A) desiccation for different durations up to 5 h, (B) different salt concentrations for 3 h, (C) different light intensities for 3 h,
(D) different temperatures for 3 h.
doi:10.1371/journal.pone.0037438.g005

PLoS ONE | www.plosone.org 7 May 2012 | Volume 7 | Issue 5 | e37438


develop C4 metabolism for suppression of photorespiration.
Analogous evolutionary events might have taken place in the
marine environment without loss of biophysical CCM [55].
Information about C4-related enzyme variations under various
treatments is considerable. In Egeria densa, transfer from low
temperature and light to high temperature and light conditions
induced increases in the activities and amounts of both PEPC and
NADP-ME. After 3 d of treatment, PEPC specific activity
increased about 1.7 times relative to values in plants at LTL,
whereas NADP-ME activity increased 1.26 times [56]. The
submersed monocot Hydrilla verticillata is a facultative C4 NADP-
malic enzyme (NADP-ME) plant in which the C4 and C3 cycles
co-exist in the same cell. The transcript expression of PEPC in H.
verticillata was substantially up-regulated during light stress [57]. In
U. prolifera, both C3 and C4 pathway enzymes exist under normal
conditions (Fig. 4). The expression levels of rbcL and PPDK
increased under stress conditions, such as high salinity, low
salinity, high temperature, and low temperature, but the levels of
PPDK were higher than those of rbcL by 3.25, 4.25, 2.8 and 4.5
times, respectively (Fig. 3). The expression levels of rbcL decreased
slowly with desiccation time, whereas those of PPDK increased
steadily at first and decreased thereafter. These results indicate
that both C3 and C4 cycles may function under normal conditions
in U. prolifera, while C4 photosynthesis may play a more significant
role under stress conditions.
Ulva prolifera is a green macroalga with single-layered tubular
thalli (Fig. 6A). It differs from most other multi-cellular C4 land
plants, in which, with few exceptions [58–62], the assimilation of
CO2 is distributed over two cell types, the mesophyll cells (MCs)
and the bundle sheath cells (BSCs) [63]. The distribution of CO2
assimilation over two distinct cell types requires a massive flux of
metabolites between MCs and BSCs [2,64]. Bienertia sinuspersici, a
land plant, is a recently discovered species with a unique form of
C4 photosynthesis. In this single-cell C4 species (SCC4), the carbon
concentrating mechanism does not depend on cooperation
between M and BS cells, as it does in Kranz-type C4 species.
Rather, it possesses a unique chlorenchyma with two functional
and biochemically different chloroplast types within photosynthet-
ic cells. Peripheral chloroplasts are spatially separated by a large
vacuole from chloroplasts clustered in a central compartment (C-
CP). This structural arrangement allows for enrichment of CO2 in
the Rubisco-containing C-CP, ultimately repressing photorespira-
tion, similar to the mechanism in Kranz-type C4 plants. In U.
prolifera, chloroplasts aggregate lucipetally along the outer side of
the layer, and there are apparently no functionally or biochem-
ically different chloroplast types (Fig. 6B), so the chloroplast
differentiation mechanism is not fit for this species. Indeed,
information about the mechanisms controlling the altered cell
biology and morphology associated with C4 photosynthesis is very
limited. The C4 cycle likely affects not only the relatively small
number of enzymes and transport proteins needed to perform the
core reactions but, given the consequences to the ecological
performance of the plants, also a range of other processes [65].
In the present study, the results showed that the expression of
PPDK in U. prolifera was higher under some daily-encountered
stress conditions, such as desiccation, high light intensity, high
temperature, and low temperature (Figs. 3, 4). High temperature is
a major environmental requirement for C4 evolution because it
directly stimulates photorespiration and dark respiration in C3
plants [66,67]. The availability of CO2 as a substrate also declines
at elevated temperature because of the reduced solubility of CO2
relative to O2 [68]. Aridity and salinity are important because they
promote stomatal closure and thus reduce intercellular CO2 levels,
again stimulating photorespiration and aggravating a CO2
PLoS ONE | www.plosone.org
C3 and C4 Pathways in Ulva prolifera
Figure 6. Longitudinal and transverse section view of U.
prolifera. A, Transmission electron microscopy of transverse section.
EX, external of cavity; IN, inner of cavity. Bar, 5 mm. B, Longitudinal and
transverse section view with an optical microscope. TS, transverse
section; LS, longitudinal section. Bar, 20 mm.
doi:10.1371/journal.pone.0037438.g006
substrate deficiency [3]. C4 photosynthesis has been found in
some marine algae. The implications of marine C4 photosynthesis
are very significant. The presence of the C4 pathway is likely to
influence algal sensitivity to changes in CO2 concentrations. As in
terrestrial ecosystems, C4 photosynthesis may therefore be a factor
that is shaping species distribution and succession if it occurs in
only some members of the phytoplankton. It could operate both
on geological timescales and in response to the present rise in
atmospheric CO2 concentrations. If C4 photosynthesis can
account for a significant portion of marine carbon fixation in
some species, it will affect various aspects of marine ecology and
biogeochemistry [69]. C4 photosynthesis is a complex biological
trait that enables plants to either accumulate biomass at a much
faster rate or live in adverse environments compared with
‘‘ordinary’’ plants [40,70]. Our results suggest that photosynthetic
organisms may have evolved a unique mechanism for coping with
environmental transition, before losing CCM, and the C4 pathway
may have first formed in intertidal pluricellular green algae before
plants colonized terrestrial habitats. An added benefit of the C4
syndrome is improved nitrogen- and water-use efficiencies that
have likely contributed to their global distribution and high rates of
productivity [71–73]. Therefore, the manmade environmental
changes, such as CO2 rise and eutrophication, stimulate the
expression of the C4 pathway, while the cooperation of CCM and
the C4 pathway may enhance the capacity of photosynthesis,
which may be one of the most important factors leading to the
rapid accumulation of the vast biomass of U. prolifera in the green
tide that has occurred in the Yellow Sea in four consecutive years
since 2008 [27,31].
Author Contributions
Conceived and designed the experiments: JX NY XZ. Performed the
experiments: JX XF SM SC. Analyzed the data: JX DX ZZ JM.
Contributed reagents/materials/analysis tools: XF XZ NY. Wrote the
paper: JX.
8 May 2012 | Volume 7 | Issue 5 | e37438

References
1. Gowik U, Brautigam A, Weber KL, Weber APM, Westhoff P (2011) Evolution
of C4 photosynthesis in the genus Flaveria: how many and which genes does it
take to make C4? Plant Cell 23: 2087–2105.
2. Weber APM, von Caemmerer S (2010) Plastid transport and metabolism of C3
and C4 plants – comparative analysis and possible biotechnological exploitation.
Curr Opin Plant Biol 13: 257–265.
3. Sage RF (2004) The evolution of C4 photosynthesis. New Phytologis 161:
341–370.
4. Gowik U, Westhoff P (2011) The Path from C3 to C4 Photosynthesis. Plant
Physiol 155: 56–63.
5. Beer S, Israel A, Drechsler Z, Cohen Y (1990) Photosynthesis in Ulva fasciata V.
Evidence for an Inorganic Carbon Concentrating System, and Ribulose-1,5-
Bisphosphate Carboxylase/Oxygenase CO2 Kinetics. Plant Physiol 94:
1542–1546.
6. Drechsler Z, Beer S (1991) Utilization of Inorganic Carbon by Ulva lactuca. Plant
Physiol 97: 439–1444.
7. Tachibana M, Allen AE, Kikutani S, Endo Y, Bowler C (2011) Localization of
putative carbonic anhydrases in two marine diatoms, Phaeodactylum tricornutum
and Thalassiosira pseudonana. Photosynth. Res 109: 205–221.
8. Edwards GE, Franceschi VR, Voznesenskaya EV (2004) Single-cell C4
photosynthesis versus the dual-cell (Kranz) paradigm. Annu Rev Plant Biol
55: 173–196.
9. Keeley JE (1999) Photosynthetic pathway diversity in a seasonal pool
community. Funct Ecol 13: 106–118.
10. Ehleringer JR, Cerling TE, Helliker BR (1997) C4 photosynthesis, atmospheric
CO2, and climate. Oecologia 112: 285–299.
11. Reiskind JB, Madsen TV, Vanginkel LC, Bowes G (1997) Evidence that
inducible C4-type photosynthesis is a chloroplatic CO2-concentrating mecha-
nism in Hydrilla, a submersed monocot. Plant, Cell and Environment 20:
211–220.
12. Tsuji Y, Suzuki I, Shiraiwa Y (2009) Photosynthetic carbon assimilation in the
coccolithophorid Emiliania huxleyi (Haptophyta): evidence for the predominant
operation of the C3 cycle and the contribution of b -carboxylases to the active
anaplerotic reaction. Plant Cell Physiol 50: 318–329.
13. Beer S, Israel A (1986) Photosynthesis of Ulva sp. III. 02 effects, carboxylase
activities, and the CO2 incorporation pattern. Plant Physiol 81: 937–938.
14. Reinfelder JR, Kraepiel AML, Morel FMM (2000) Unicellular C4 photosyn-
thesis in a marine diatom. Nature 407: 996–999.
15. Reinfelder JR, Milligan AJ, Morel FMM (2004) The role of the C4 pathway in
carbon accumulation and fixation in a marine diatom. Plant Physiol 135:
2106–2111.
16. Roberts K, Granum E, Leegood RC, Raven JA (2007) C3 and C4 pathways of
photosynthetic carbon assimilation in marine diatoms are under genetic, not
environmental, control. Plant Physiol 145: 230–235.
17. McGinn PJ, Morel FMM (2008) Expression and Inhibition of the carboxylating
and decarboxylating enzymes in the photosynthetic C4 pathway of marine
diatoms. Plant Physiol 146: 300–309.
18. Armbrust EV, Berges JA, Bowler C, Green BR, Martinez D, et al. (2004) The
genome of the diatom Thalassiosira pseudonana: ecology, evolution, and
metabolism. Science 306: 79–86.
19. Montsant A, Jabbari K, Maheswari U, Bowler C (2005) Comparative genomics
of the pennate diatom Phaeodactylum tricornutum. Plant Physiol 137: 500–513.
20. Derelle E, Ferraz C, Rombauts S, Rouze P, Worden AZ, et al. (2006) Genome
analysis of the smallest free-living eukaryote Ostreococcus tauri unveils many unique
features. Proc Nati Acad Sci USA 103: 11647–11652.
21. Worden AZ, Lee JH, Mock T, Rouze P, Simmons MP, et al. (2009) Green
evolution and dynamic adaptations revealed by genomes of the marine
picoeukaryotes Micromonas. Science: 324: 268–272.
22. Leliaert F, Smith DR, Moreau H, Herron MD, Verbruggen H, et al. (2012)
Phylogeny and molecular evolution of the green algae. Crit Rev Plant Sci 31:
1–46.
23. Kroth PG, Chiovitti A, Gruber A, Martin-Jezequel V, Mock T, et al. (2008) A
model for carbohydrate metabolism in the diatom Phaeodactylum tricornutum
deduced from comparative whole genome analysis. PLoS One 3: e1426.
24. Parker MS, Mock T, Armbrust EV (2008) Genomic insights into marine
microalgae. Annu Rev Genet 42: 619–645.
25. Bowler C, Vardi A, Allen AE (2010) Oceanographic and biogeochemical
insights from diatom genomes. Ann Rev Mar Sci 2: 333–365.
26. Charlier RH, Morand P, Finkl CW, Thys A (2007) Green tides on the Brittany
coasts. Environ Res Eng Manage 3: 52–59.
27. Ye NH, Zhang XW, Mao YZ, Liang CW, Xu D, et al. (2011) ‘Green tides’ are
overwhelming the coastline of our blue planet: taking the world’s largest
example. Ecol Res 26: 477–485.
28. Leliaert F, Zhang X, Ye N, Malta EJ, Engelen AH, et al. (2009) Research note:
Identity of the Qingdao algal bloom. Phycol Res 57: 147–151.
29. Hayden H, Blomster J, Maggs CA, Silva PC, Stanhope MJ, et al. (2003)
Linnaeus was right all along: Ulva and Enteromoropha are not distinct genera.
Eur J Phycol 38: 277–294.
30. Dong M, Zhang X, Zhuang Z, Zou J, Ye N, et al. (2011) Characterization of the
LhcSR gene under light and temperature stress in the green alga Ulva linza. Plant
Mol Biol Rep doi:10.1007/s11105-011-0311-8.
PLoS ONE | www.plosone.org
C3 and C4 Pathways in Ulva prolifera
31. Zhang X, Xu D, Mao Y, Li Y, Xue S, et al. (2011) Vegetative fragments of Ulva
prolifera in settlement confirmed as an important seed source for succession of a
large-scale green tide bloom. Limnol Oceanogr 56: doi:10.4319/
lo.2011.56.1.0000.
32. Bischof K, Krabs G, Wiencke C, Hanelt D (2002) Solar ultraviolet radiation
affects the activity of ribulose-1,5-bisphosphate carboxylase-oxygenase and the
composition of photosynthetic and xanthophyll cycle pigments in the intertidal
green alga Ulva lactuca L.. Planta 215: 502–509.
33. Aquino RS, Grativol C, Mourao PAS (2011) Rising from the Sea: correlations
between sulfated polysaccharides and salinity in plants. PLoS One 6: e18862.
34. Kremer BP, Küppers U (1977) Carboxylating enzymes and pathway of
photosynthetic carbon assimilation in different marine algae - Evidence for
the C4-Pathway? Planta 133: 191–196.
35. Karekar MD, Joshi GV (1973) Photosynthetic carbon metabolism in marine
algae. Bot Marina 16: 216–220.
36. Joshi GV, Karekar MD, Gowda CA, Bhosale L (1974) Photosynthetic carbon
metabolism and carboxylating enzymes in algae and mangrove under saline
conditions. Photosynthetica 8: 51–52.
37. Troughton JH, Card KA, Hendy CH (1974) Photosynthetic pathways and
carbon isotope discrimination by plants. Carnegie Institution of Washington
Yearbook 73: 768–80.
38. Wang WL, Yeh HW (2003) d13C values of marine macroalgae from Taiwan.
Bot. Bull. Acad. Sin. 44: 107–112.
39. Mercado JM, Santos CB, Perez-Llorens JL, Vergara JJ (2009) Carbon isotopic
fractionation in macroalgae from Cadiz Bay (Southern Spain): Comparison with
other bio-geographic regions. Estuar Coast Shelf S 85: 449–458.
40. Hatch MD (1987) C4 photosynthesis: a unique blend of modified biochemistry,
anatomy and ultrastructure. Biochem. Biophys. Acta 895: 81–106.
41. Ishimaru K, Ohkawa Y, Ishige T, Tobias DJ, Ohsugi R (1998) Elevated
pyruvate orthophosphate dikinase (PPDK) activity alters carbon metabolism in
C3 transgenic potatoes with a C4 maize PPDK gene. Physiol Plantarum 103:
340–346.
42. Chen M, Liu T, Chen X, Chen L, Zhang W, et al. (2011) Subcritical co-solvents
extraction of lipid from wet microalgae pastes of Nannochloropsis sp. Eur J Lipid
Sci Technol doi: 10.1002/ejlt.201100120.
43. Huson DH, Auch AF, Qi J, Schuster SC (2007) Megan Analysis of Metagenome
Data. Genome Res 17: 377–386.
44. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The
CLUSTAL_X windows interface: flexible strategies for multiple sequence
alignment aided by quality analysis tools. Nucleic Acids Res 25: 4876–4882.
45. Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, et al. (2003) Multiple
sequences alignment with the clustal series of programs. Nucleic Acids Res 31:
3497–3500.
46. Liu XM, Anderson JM, Pijut PM (2010) Cloning and characterization of Prunus
serotina AGAMOUS, a putative flower homeotic gene. Plant Mol Biol Rep 28:
193–203.
47. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular evolutionary
genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution
24: 1596–1599.
48. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using
real-time quantitative PCR and the 22DDCT method. Methods 25: 402–408.
49. Gerard VA, Driscoll T (1996) A spectrophotometric assay for RuBisCO activity:
application to the kelp Laminaria saccharina and implications for radiometric
assays. J Phycol 32: 880–884.
50. Sayre RT, Kennedy RA, Pringnitz DJ (1979) Photosynthetic enzyme activities
and localization in Mollugo verticillata population differing on the leaves of C3 and
C4 cycle operations. Plant Physiol. 64: 293–299.
51. Fleming ED, Bebout BM, Castenholz RW (2007) Effects of salinity and light
intensity on the resumption of photosynthesis in rehydrated cyanobacterial mats
from Baja California Sur, Mexico. J Phycol 43: 15–24.
52. Ueno O (2011) Structural and biochemical characterization of the C3–C4
intermediate Brassica gravinae and relatives, with particular reference to cellular
distribution of Rubisco. J Exp Bot. pp 1–9.
53. Bowler C, Allen AE, Badger JH, Grimwood J, Jabbari K, et al. (2008) The
Phaeodactylum genome reveals the evolutionary history of diatom genomes.
Nature 456: 239–244.
54. Moustafa A, Beszteri B, Maier UG, Bowler C, Valentin K, et al. (2009) Genomic
footprints of a cryptic plastid endosymbiosis in diatoms. Science 324:
1724–1726.
55. Matsuda Y, Nakajima K, Tachibana M (2011) Recent progresses on the genetic
basis of the regulation of CO2 acquisition systems in response to CO2
concentration. Photosynth. Res 109: 191–203.
56. Casati P, Lara MV, Andreo CS (2000) Induction of a C4-like mechanism of CO2
fixation in Egeria densa, a submersed aquatic Species. Plant Physiol 123:
1611–1621.
57. Rao S, Reiskind J, Bowes G (2006) Light Regulation of the Photosynthetic
Phosphoenolpyruvate Carboxylase (PEPC) in Hydrilla verticillata. Plant Cell
Physiol 47: 1206–1216.
58. Reiskind JB, Berg RH, Salvucci ME, Bowes G (1989) Immunogold localization
of primary carboxylases in leaves of aquatic and a C3–C4 intermediate species.
Plant Sci 61: 43–52.
9 May 2012 | Volume 7 | Issue 5 | e37438

59. Keeley JE (1998) C4 photosynthetic modifications in the evolutionary transition
from land to water in aquatic grasses. Oecologia 116: 85–97.
60. Voznesenskaya EV, Franceschi VR, Kiirats O, Freitag H, Edwards GE (2001)
Kranz anatomy is not essential for terrestrial C4 plant photosynthesis. Nature
414: 543–546.
61. Voznesenskaya EV, Franceschi VR, Kiirats O, Artyusheva EG, Freitag H, et al.
(2002) Proof of C4 photosynthesis without Kranz anatomy in Bienertia
cycloptera (Chenopodiaceae). Plant J 31: 649–662.
62. Voznesenskaya EV, Edwards GE, Kiirats O, Artyusheva EG, Franceschi VR
(2003) Development of biochemical specialization and organelle partitioning in
the single-cell C4 system in leaves of Borszczowia aralocaspica (Chenopodia-
ceae). Am J Bot 90: 1669–1680.
63. von Caemmerer S, Furbank RT (2003) The C4 pathway: an efficient CO2
pump. Photosynth. Res 77: 191–207.
64. Bräutigam A, Hofmann-Benning S, Weber APM (2008) Comparative
proteomics of chloroplast envelopes from C3 and C4 plants reveals specific
adaptations of the plastid envelope to C4 photosynthesis and candidate proteins
required for maintaining C4 metabolite fluxes. Plant Physiol 148: 568–579.
PLoS ONE | www.plosone.org
C3 and C4 Pathways in Ulva prolifera
65. Brautigam A, Kajala K, Wullenweber J, Sommer M, Gagneul D, et al. (2011)
An mRNA blueprint for C4 photosynthesis derived from comparative
transcriptomics of closely related C3 and C4 species. Plant Physiol 155: 142–156.
66. Brooks A, Farquhar GD (1985) Effect of temperature on the CO2/O2 specificity
of ribulose-1,5-bisphosphate carboxylase/oxygenase and the rate of respiration
in the light. Planta 165: 397–406.
67. Sharkey TD (1988) Estimating the rate of photorespiration in leaves. Physiol.
Plantarum 73: 147–152.
68. Jordan DB, Ogren WL (1984) The CO2/O2 specificity of ribulose 1,5-
bisphosphate carboxylase/oxygenase. Planta 161: 308–313.
69. Riebesell U (2000) Carbon fix for a diatom. Nature 407: 959–960.
70. Osborne CP, Freckleton RP (2009) Ecological selection pressures for C4
photosynthesis in the grasses. Proc R Soc Lond B Biol Sci 276: 1753–1760.
71. Tilman D, Hill J, Lehman C (2006) Carbon-negative biofuels from low-input
high-diversity grassland biomass. Science 314: 1598–1600.
72. Edwards EJ, Osborne CP, Strömberg CAE, Smith SA, Bond WJ, et al. (2010)
The origins of C4 grasslands: integrating evolutionary and ecosystem science.
Science 328: 587–591.
73. Brutnell TP, Wang L, Swartwood K, Goldschmidt A, Jackson D, et al. (2010)
Setaria viridis: a model for C4 photosynthesis. Plant Cell 22: 2537–2544.
10 May 2012 | Volume 7 | Issue 5 | e37438