Protist, Vol.

167, 32–50, February 2016

http://www.elsevier.de/protis
Published online date 19 December 2015

ORIGINAL PAPER

Morphological and Molecular

Phylogenetic Position of Prorocentrum
micans sensu stricto and Description of
Prorocentrum koreanum sp. nov. from
Southern Coastal Waters in Korea and
Japan
Myung-Soo Hana,1,2 , Pengbin Wanga,1 , Jin Ho Kima,1 , Soo-Yeon Choa,3 , Bum Soo Parka ,
Joo-Hwan Kima , Toshiya Katanob,4 , and Baik-Ho Kima

aDepartment of Life Science, College of Natural Sciences, Hanyang University,

222 Wangsimni-ro, Seongdong-gu, Seoul 133-791, Korea
bInstitute of Lowland and Marine Research, Saga University, Honjo 1,
Saga City 840-8502, Japan
Submitted March 20, 2015; Accepted December 5, 2015
Monitoring Editor: Mona Hoppenrath

Prorocentrum micans is an extremely variable dinoflagellate species, with many different local forms
reported worldwide. Because of this morphological diversity, it is important to establish whether
these various forms belong to P. micans sensu stricto. For this study, P. micans-like specimens were
isolated from several localities in the southern coastal waters of Korea and Japan. The morphological
characteristics and the molecular signatures of P. micans were re-examined. Moreover, a new Proro-
centrum species, Prorocentrum koreanum sp. nov. was established through detailed light microscopy
and scanning electron microscopy observations. Examination of the periflagellar platelets revealed
that P. koreanum sp. nov. differs from P. micans. Furthermore, P. koreanum and P. micans exhibited
different distribution patterns of trichocyst pores. Through molecular phylogeny analysis of small
subunit (SSU) rRNA, internal transcribed spacer (ITS), and large subunit (LSU) rRNA sequence, we
found P. koreanum to be more closely related to P. mexicanum and P. rhathymum than to P. micans.
Additionally, ITS2 compensatory base changes also provide strong evidence to support P. koreanum
and P. micans being separate species.
© 2015 Elsevier GmbH. All rights reserved.

Key words: Prorocentrum; molecular phylogeny; morphology; new species; southern coastal waters of Korea
and Japan.
1
These authors contributed equally as co-first authors
2
Corresponding author; fax +82-2-2296-1471
3
Present address: Marine Ecosystem Management Team, Korea Marine Environment Management Corporation, Haegong Bldg.,
Samseong-ro 610, Gangnam-gu, Seoul 135-870, Korea
4
Present address: Graduate School of Marine Science and Technology, Tokyo University of Marine Science and Technology,
Tokyo 108-8477, Japan
e-mail hanms@hanyang.ac.kr (M.-S. Han).

http://dx.doi.org/10.1016/j.protis.2015.12.001
1434-4610/© 2015 Elsevier GmbH. All rights reserved.
 Prorocentrum micans s. str. and Prorocentrum koreanum sp. nov.
Introduction
The dinoflagellate genus Prorocentrum is one
group of red tide organisms, which was estab-
lished by Ehrenberg (1834), with Prorocentrum
micans Ehrenberg as the type species. Prorocen-
trum is a cosmopolitan genus; most of the species
are marine organisms, although some freshwa-
ter species have also been reported (Croome and
Tyler 1987). At least eighty accepted species have
been reported in this genus to date (Guiry and
Guiry 2014). Taxonomic research on this harmful
algal bloom organism has been continually con-
ducted worldwide (Dickey et al. 1990; Dodge and
Bibby 1973; Dodge 1975; Han and Furuya 2000;
Herrera-Sepúlveda et al. 2015; Hoppenrath 2000;
Hoppenrath et al. 2013; Lu and Goebel 2001; Wood
1954), including in Korea (Han et al. 1991; Han and
Yoo 1983; Lee and Han 2007; Lim et al. 2013; Yoo
and Lee 1986). The invention of new sampling tools
and the increased application of molecular tech-
niques to the study of Prorocentrum have allowed
the revision of species and the description of new
species in this genus. However, many morpho-
logical and molecular characteristics have not yet
been well matched with species in Prorocentrum
(Henrichs et al. 2013).
Morphologically, P. micans is similar to P. gracile,
P. sigmoides, and P. texanum, although P. sig-
moides has been treated as a synonym of P.
gracile (Cohen-Fernandez et al. 2006). Because
the morphological characteristics of P. micans over-
lap with those of P. gracile, it is often difficult
to differentiate these species from one another,
except by observing the posterior mucron of P.
gracile (Cohen-Fernandez et al. 2006). Moreover,
P. micans shows considerable morphological vari-
ation at the intraspecific level (Cohen-Fernandez
et al. 2006; Steidinger and Tangen 1997). Even
early monograph drawings of individual P. micans
organisms show varying cell shapes (Schiller
1933). The extremely variable morphology of this
species has been previously described (Dodge
1975), and many local types appear to have been
described as unique species. In addition, many
previous studies have provided unclear descrip-
tions and blurred images of P. micans, which might
have led to erroneous identifications of this species
(Taylor 1976; Yamaji 1962, 1966). For example, the
illustration of P. micans shown by Taylor (1976)
depicts a rounded posterior, whereas P. micans
sensu stricto should exhibit an acute posterior,
at least according to the first description of this
species (Ehrenberg 1834). The illustrations of P.
micans shown by Yamaji (1962, 1966) depicted a
33
thin organism whose cell shape is mostly drop-
like, rather than an oval as described earlier by
Ehrenberg (1834). These various illustrations of P.
micans have added an element of confusion to the
true description of P. micans. To resolve this con-
fusion, it was proposed that the various forms be
assessed to determine whether they truly belong
to P. micans sensu stricto (Dodge 1975). Although
Cohen-Fernandez et al. (2006) described the exter-
nal morphology of several P. micans organisms
and provided several micrographs of these, they
reported neither the morphology of the periflagel-
lar region nor any molecular-based phylogenetic
information.
P. micans organisms have typically been identi-
fied based on early descriptions. This approach is
of limited use when distinguishing different species
from one another. In addition, P. micans-like species
could occupy different phylogenetic positions and
be part of a different clade (Henrichs et al. 2013).
More detailed morphological information is needed
to differentiate the various P. micans-like species
from one another. As one example, the periflagellar
region of P. texanum exhibits a uniquely distinguish-
ing morphology (Henrichs et al. 2013).
The majority of Prorocentrum-related phyloge-
netic studies have been based on rRNA-encoding
gene sequences (Chomérat et al. 2010; Grzebyk
et al. 1998; Herrera-Sepúlveda et al. 2015; Hong
et al. 2008; Murray et al. 2009; Saldarriaga et al.
2004). In studies of small subunit (SSU) rRNA
gene phylogenetic trees, Prorocentrum was often
found to form two clades; however, the SSU region
exhibits low variability and is sometime not that
useful for differentiating different species, espe-
cially on planktonic species (Henrichs et al. 2013;
Murray et al. 2009). In contrast, the large sub-
unit (LSU) and internal transcribed spacer (ITS)
rRNA regions of Prorocentrum show high variation
and thus enable sensitive discrimination of differ-
ent species (Chomérat et al. 2010; Henrichs et al.
2013; Murray et al. 2009). Some phylogenetic stud-
ies have used the cox 1 and cob markers for species
identification. However, the lack of sequence data
for those markers has meant that most studies
could not use them.
With the aim of conducting a comprehensive mor-
phological study and genomic DNA analysis of P.
micans and P. micans-like species, specimens were
collected from several localities in the southern
coastal waters of Korea and Japan. We examined
the morphological characteristics and molecular
signatures of P. micans and P. micans-like species
and here report a new planktonic Prorocentrum
species, Prorocentrum koreanum sp. nov. The new
34 M.-S. Han et al.
species was characterized using light microscopy
and scanning electron microscopy, and its phylo-
genetic position was established using molecular
techniques.
Figure 1. Sampling sites for collection of Prorocen-
trum spp.
Results
Species Descriptions
Specimens of Prorocentrum were collected from
natural water at several stations in coastal waters
ranging from Korea to Japan (Fig. 1). From these
specimens, a number of different Prorocentrum
strains were established, among which P. micans
and P. koreanum sp. nov. were investigated in this
study (Supplementary Material Table S1).
Prorocentrum micans Ehrenberg 1834 (Fig. 2)
Figure 2. Prorocentrum micans (Strain: HYMS-1211-1). (A) General view. (B) Right valve. (C) Left valve.
(D) DAPI-stained posterior heart-shaped nucleus (blue) with UV excitation. A: light microscopy; B–C: scanning
electron microscopy; D: fluorescence microscopy. Scale bars = 10 ␮m (A–C).
LOCALITY: Masan, Korea.
MOLECULAR CHARACTERIZATION: The
nucleotide sequences of the SSU, ITS1–5.8S–
ITS2, and D1–D3 regions of the LSU rDNA of strain
“HYMS-1211-1” were deposited in GenBank under
the accession numbers KP711341, KP711342,
and KP711343, respectively.
HABITAT: Marine, planktonic.
MORPHOLOGY: Cells are pyriform to heart-
shaped, 32.6–38.1 ␮m in length, and 23.5–29.1 ␮m
in width (n = 40) (Table 1). Each cell has asym-
metrical valve margins with a rounded anterior
and a pointed posterior and is broadest at the
middle or towards the anterior end (Fig. 2A).
Yellow-brown chloroplasts containing a large inter-
nal pyrenoid were found below the two valves
and can presumably conduct photosynthesis for
the cell (Fig. 2A). Pusules and fibrous vesicles
are not visible by light microscopy. The cell is
dorsoventrally flattened (Fig. 2B-C). The right valve
forms a moderately excavated, V-shaped triangular
depression in the periflagellar region (Fig. 2B). A
strong winged spine is present in the apical region
with length 3.1–5.4 ␮m (Fig. 2B-C). The posterior
angle is 93.8–124.4◦ . The valve surface is covered
with numerous thecal pores and trichocyst pores
(Fig. 2B-C). Trichocyst pores form radiating tangen-
tial rows; each valve has 7–9 rows (Fig. 5A-B). A
posterior semicircle formed by posterior trichocyst
pores is present at the posterior end of the valves,
but in some cells the pores are more irregular
(Fig. 2B-C). Above the posterior pores on each
side of the valves are 3–4 rows of trichocyst pores,
each of which is lined with 3–6 pores on each
side of both valves. A few trichocyst pores are
found at the center of the valve, with several pores
 Prorocentrum micans s. str. and Prorocentrum koreanum sp. nov. 35

Table 1. Morphological characteristics of Prorocentrum spp.

Prorocentrum Prorocentrum Prorocentrum Prorocentrum Prorocentrum

micans koreanum koreanum koreanum texanum
Korean strain Korean strain CCMP 2794 HYSG-1312-1
Shape Pyriform to Drop shaped Drop shaped Drop shaped Spheroid to
heart-shaped pyriform
Valve One convex One convex One convex One convex One convex
side and one side and one side and one side and one side and one
arched side little one arched little one little one arched side
side arched side arched side
Anterior winged Obvious Obvious Obvious Obvious not Obvious
spines
Posterior Point Point Point Point Round to
point
Trichocyst pore Exist the pore No pore at the No pore at Nearly not divers type
at the valve valve central the valve exist the pore
central central at the valve
central
No.of observations 40 34 36 35 -
Cell Length (␮m) 32.6-38.1 30.4-44.6 39.5-45.2 35.6-44.6 -
(35.1)*a (39.0)b (42.31)c (41.5)b
Cell Width (␮m) 23.5-29.1 21.8-31.5 24.1-29.0 23.3-28.9 -
(27.1)b (26.7)a,b (26.4)a,b (26.0)a
Spine Length (␮m) 3.1-5.4 (4.4)a 4.9-9.4 (6.9)b 3.8-8.3 (6.9)b 5.0-8.5 (7.0)b -
Posterior Angle (◦ ) 93.8-124.4 71.5-101.7 70.8-95.0 58.7-93.8 -
(111.2)c (87.4)b (82.0)a (81.6)a
* Value in () is average of all data of each item on different species.
a, b, c were marked as different groups from the results of ANOVA (P<0.05).

lining the margin and some forming small rows of
2–4 pores. At the anterior end of each valve, sev-
eral pores are found along the margin, some of
which are in pairs or form small rows of 2–3 pores.
Approximately two recessed trichocyst pores are
found on the right valve below the periflagellar area,
whereas on the left valve only one trichocyst pore
is found beneath the periflagellar area (Fig. 2B-
C). The periflagellar area is covered by 8 platelets
(Fig. 6A, C, Supplementary Material Fig. S1A-J).
The flagellar pore (FP) is nearly oblong, and is
adjacent to platelets 3, 5, 6, and 8, whereas the
accessory pore (AP) is similar in size to the FP
and is surrounded by platelets 2, 7, and 8. Two
flagella emerge from the flagellar pores (Fig. 6A,
C). The winged spine, supported by periflagellar
platelet 1, and an opposing short flange are evi-
dent on platelet 4 when viewed from the right valve.
A large heart-shaped nucleus is present in the
center to the posterior part of the cell (Fig. 2D).
Young cultures of P. micans swim actively, like other
planktonic dinoflagellates, and also produce a large
amount of mucus that remains embedded in old
cultures.
Prorocentrum koreanum M.-S. Han, S. Y. Cho et
P. Wang sp. nov. (Fig. 3 and Fig. 4)
DIAGNOSIS: Photosynthetic prorocentroid
dinoflagellate. Drop shaped cell, length 30.4–
45.2 ␮m and width 21.8–31.5 ␮m. Valve convex
with a rounded anterior, pointed posterior, and
numerous trichocyst pores. The broad, shallow,
V-shaped periflagellar area has 8 platelets: 1, 2,
3, 4, 5, 6, 7, and 8. The straight, long, and strong
winged spine extends from periflagellar platelet
1, and an opposing short flange is evident on
platelet 4.
TYPE LOCALITY: Jangmok, Korea.
HOLOTYPE: A slide of isolate “LMBEV9” was
deposited in the Laboratory for Water Environmen-
tal Ecology and Restoration of Hanyang University
(slide number HY-PK-S1).
ISOTYPE: Fixed material of “LMBEV9” was
deposited at the Laboratory for Water Environmen-
tal Ecology and Restoration of Hanyang University
(slide number HY-PK-F1).
MOLECULAR CHARACTERIZATION: The
nucleotide sequences of SSU rDNA, ITS1–5.8S–
ITS2, and D1–D3 of LSU rDNA of the “LMBEV9”
36 M.-S. Han et al.

Figure 3. Prorocentrum koreanum (Korean strain: LMBEV9; A–H). (A) General view. (B) Right valve. (C) Left
valve. (D) DAPI-stained posterior heart-shaped nucleus (blue) under UV excitation. (E) Posterior part of the
right valve. (F) Anterior part of the right valve and winged spine. (G) Posterior part of the left valve. (H) Anterior
part of the left valve and winged spine. Prorocentrum koreanum (American strain: CCMP 2794; I–P). (I) General
view. (J) Right valve. (K) Left valve. (L) DAPI-stained posterior heart-shaped nucleus (blue) under UV excitation.
 Prorocentrum micans s. str. and Prorocentrum koreanum sp. nov. 37

Figure 4. Prorocentrum koreanum (Japanese strain: HYSG-1311-1). (A) General view of a cell fixed with
Lugol’s solution. (B) Right valve. (C) Left valve. (D) Dorsal view. (E) Posterior area of the left valve. (F) Ante-
rior part of the left valve and winged spine. (G) DAPI-stained posterior heart-shaped nucleus (blue) under
UV excitation. A: Light microscopy; B–F: Scanning electron microscopy; G: Fluorescence microscopy. Scale
bars = 10 ␮m (A–D, F), 5 ␮m (E), or 20 ␮m (G).

strain were deposited in GenBank under the are present (Fig. 3A), but no pyrenoids, pusules,
accession numbers KP711350, KP711351, and or fibrous vesicles are visible by light microscopy.
KP711352, respectively. The cell is dorsoventrally flattened (Figs 3B-C, J-
HABITAT: Marine, planktonic. K, 4B-C) and widest in the middle of the valve.
ETYMOLOGY: Latin; refers to the geographic The right valve forms a moderately excavated, U-
locality of the dinoflagellate, which is off the coast shaped triangular depression in the periflagellar
of Korea. region (Figs 3B, J, Fig. 4B). A long, straight, and
MORPHOLOGY: Cells are solitary and drop strong winged spine is present in the apical region,
shaped, 30.4–45.2 ␮m in length, and 21.8–31.5 ␮m and a small collar is evident by scanning electron
in width (n = 105) (Table 1). The cell has asym- microscopy (Figs 3B-C, F, J-K, M, Fig. 4B-C). The
metrical valve margins with a convex ventral posterior angle is 58.7–101.7◦ . The valve surface is
side, a rounded anterior, and a pointed posterior covered with numerous thecal pores and trichocyst
(Figs 3A, I, 4A). Two yellow-brown chloroplasts pores (Figs 3B-C, J-K, 4B-C). The trichocyst pores
➛
(M) Anterior part of the right valve. (N) Posterior part of the right valve and winged spine. (O) Anterior area of
the left valve. (P) Posterior part of the left valve and winged spine. A, I: Light microscopy; B, C, E–H, J, K, M–P:
Scanning electron microscopy; D, L: Fluorescence microscopy. Scale bars = 10 ␮m (A–F, I–K) or 5 ␮m (G–H,
M–P).
38 M.-S. Han et al.
Figure 5. Schematic diagrams of the right and left
valves of Prorocentrum spp. showing the various
trichocyst pore fields. All drawings are to scale.
(A) P. micans (Korean strain: HYMS-1211-1), left
valve. (B) P. micans (Korean strain: HYMS-1211-1),
right valve. (C) P. koreanum (Korean strain: LMBEV9),
left valve. (D) P. koreanum (Korean strain: LMBEV9),
right valve. (E) P. koreanum (American strain: CCMP
2794), left valve. (F) P. koreanum (American strain:
CCMP 2794), right valve. (G) P. koreanum (Japanese
strain: HYSG-1312-1), left valve. (H) P. koreanum
(Japanese strain: HYSG-1312-1), right valve. More
than 20 cells were observed for each species.
form radiating tangential rows, and each valve has
5–8 rows (Fig. 5C-H). At the posterior end of each
valve, a posterior semi-circle of trichocyst pores is
present (Figs 3B-C, E, G, J-K, N, P, 4B-C, E). A
row of 4–7 trichocyst pores is located above these
posterior pores on each side of each valve (Figs 3B-
C, E, G, J-K, N, P, 4B-C, E). There nearly not exist
the trichocyst pore at the valve center; moreover,
several pores line the margin, with some forming
short rows. Several pores are located along the
margin at the anterior end of each valve. Some are
found in pairs or form small rows consisting of 3
pores. The right valve has 2–4 recessed trichocyst
pores below the periflagellar area, whereas the left
valve has only one trichocyst pore below the peri-
flagellar area (Figs 3B-C, F, H, J-K, M, O, 4B-C, F).
The U-shaped periflagellar area is covered by 8
platelets (Fig. 6B, D, Supplementary Material Fig.
S1K-1B). The FP is irregular-form and is located
adjoining platelets 3, 5, 6, and 8; the oblong-form
AP is adjacent to platelets 2, 7, and 8. Two fla-
gella emerge from the FP (Fig. 6B, D). The straight,
long, and strong winged spine extends from per-
iflagellar platelet 1, and an opposing short flange
is evident on platelet 4 when viewed from the right
Figure 6. (A–B) Schematic diagram of the periflag-
ellar area of Prorocentrum; the periflagellar area
numbering system follows the labeling system of
Hoppenrath et al. (2013). (A) Periflagellar platelets of
P. micans (drawing based on Korean strain: HYMS-
1211-1). (B) Periflagellar platelets of P. koreanum
(drawing based on Korean strain: LMBEV9). (C–D)
Scanning electron microscope images of the periflag-
ellar area of Prorocentrum spp. (C) P. micans (Korean
strain: HYMS-1211-1). (D) P. koreanum (Korean
strain: LMBEV9). FP: flagellar pore; AP: accessory
pore.
valve. A heart-shaped nucleus is present in the cen-
tral to posterior part of the cell (Figs 3D, L, 4G).
In young cultures, P. koreanum cells swim actively
and produce large amounts of mucus that remain
embedded in old cultures.
Molecular Analysis
The SSU, ITS/5.8S, and LSU rRNA gene regions
of P. koreanum and P. micans were amplified
and sequenced. Sequences were deposited in
GenBank under the accession numbers listed in
Table 2. An initial BLAST search revealed that
the sequences of P. koreanum have very high
degrees of similarity to those of P. micans. The
ITS and LSU genes of strain CCMP2794 were
sequenced and found them to be identical to those
of P. koreanum. The CCMP2794 isolate, kept at
the Provasoli-Guillard National Center for Marine
Algae and Microbiota derived from the Gulf of
Mexico and had been identified as P. micans.
The phylogenetic tree for the SSU rDNA regions
(Fig. 7) exhibited a topology similar to those
reported in previous studies. Specifically, it is dif-
ficult to distinguish P. koreanum from the P. micans
clade based on this tree. However, P. koreanum and
P. micans were clearly distinguished as different
species according to the ITS and LSU phylogenetic
trees (Fig. 8 and Fig. 9), which show them to be
in different clades. On those trees, P. koreanum is
 Prorocentrum micans s. str. and Prorocentrum koreanum sp. nov. 39

Table 2. GenBank accession numbers of Prorocentrum spp.

Species Strain DNA Region Accession number

Prorocentrum micans HYMS-1211-1 SSU KP711341
Prorocentrum micans HYMS-1211-1 ITS1-5.8S-ITS2 KP711342
Prorocentrum micans HYMS-1211-1 D1-D3 of LSU KP711343
Prorocentrum koreanum HYSG-1312-1 SSU KP711344
Prorocentrum koreanum HYSG-1312-1 ITS1-5.8S-ITS2 KP711345
Prorocentrum koreanum HYSG-1312-1 D1-D3 of LSU KP711346
Prorocentrum koreanum HYSG-1312-2 SSU KP711347
Prorocentrum koreanum HYSG-1312-2 ITS1-5.8S-ITS2 KP711348
Prorocentrum koreanum HYSG-1312-2 D1-D3 of LSU KP711349
Prorocentrum koreanum LMBEV9 SSU KP711350
Prorocentrum koreanum LMBEV9 ITS1-5.8S-ITS2 KP711351
Prorocentrum koreanum LMBEV9 D1-D3 of LSU KP711352
Prorocentrum koreanum CCMP 2794 SSU KP711353
Prorocentrum koreanum CCMP 2794 ITS1-5.8S-ITS2 KP711354
Prorocentrum koreanum CCMP 2794 D1-D3 of LSU KP711355

closely related to P. mexicanum and P. rhathymum
and located far from the P. micans clade. In addition,
P. koreanum and the CCMP2794 isolate occupy the
same phylogenetic position in the ITS phylogenetic
tree.
The uncorrected genetic distances (p) between
different Prorocentrum species calculated based
on the ITS1–5.8S–ITS2 (ITS region) rDNA
sequences revealed that P. koreanum was signifi-
cantly different from P. mexicanum, P. micans, P.
minimum, P. rhathymum, and P. texanum (Table 3).
All distances were p>0.04, whereas, within-species
differences exhibited p values <0.02.
That P. koreanum and P. micans are different taxa
is further supported by the presence of compen-
satory base changes (CBCs) in the ITS2 region
(Fig. 10, Supplementary Material Table S2). There
is a CBC in helix II, which provides strong evidence
supporting that P. koreanum and P. micans are sep-
arate species (Fig. 10).
Discussion
Morphology
Morphological analysis clearly indicates that
P. koreanum belongs to the genus Prorocentrum.
We did not find an apparent difference between
different strains from Korea, America, and Japan
(Figs 3, 4). In this study, we did not find addi-
tional variability except for some abnormal cells
being reported in old cultures. Thus, in the present
study, we used healthy cultures in the exponen-
tial growth stage to prevent the appearance of
abnormal cells. The morphology of P. koreanum is
very similar to that of P. mexicanum, P. rhathymum,
P. texanum, and P. micans, with the similarity
being greatest with the latter. P. mexicanum has
an anterior serrated winged spine with 2–3 crests
and a large round nucleus (Cortés-Altamirano and
Sierra-Beltrán 2003). In contrast, P. rhathymum
has a simple, non-serrated winged spine, no tri-
chocyst pores around the periflagellar area on
the right valve, and a smaller posterior nucleus.
P. koreanum has a long conspicuous winged spine,
a greater number of trichocyst pores around the
periflagellar area, and a heart-shaped nucleus in
the central to the posterior part of the cell. Although
P. texanum and P. micans are similar to P. kore-
anum, those species differ in their shape, size,
features of the periflagellar plates and winged
spine, valve pore patterns, and surface ornamen-
tation (Ehrenberg 1834; Henrichs et al. 2013;
Steidinger and Tangen 1997). P. texanum cells are
round to oval shaped and have a short serrated
winged spine and a U-shaped nucleus. In contrast,
P. micans is medium-sized, has a pyriform to heart-
shaped cell with a short winged spine extending
from the valve edge, a large heart-shaped nucleus,
and a more prominent arched side compared with
P. koreanum. Indeed, P. mexicanum, P. rhathy-
mum, and P. texanum (Henrichs et al. 2013) all
have rounded posterior ends (Cortés-Altamirano
and Sierra-Beltrán 2003). In contrast, the poste-
rior end of P. micans is almost an obtuse angle
(Fig. 5A-B), whereas the posterior end of P. kore-
anum is pointed (Fig. 5C-H). ANOVA analysis did
not reveal any significant differences with respect to
cell length or cell width between P. koreanum and
40 M.-S. Han et al.

Figure 7. Maximum likelihood tree of the SSU dataset (1590 bp). Alexandrium tamarense was included as
an out-group. The best model, as chosen by MrModel-Test2.3, was GTR+I+G. Support values shown are
maximum likelihood/Bayesian inference/maximum parsimony values. Only values > 50% (MP, ML) and 0.50
(BI) are shown.

P. micans; however, the spine length and posterior
angle can distinguish P. koreanum from P. micans
(Table 1). In addition, the trichocyst pore patterns
around the periflagellar area and on the valve sur-
face are very different between P. koreanum and
P. micans (Figs 2B-C, 3B-C, J-K, 4B-C). Further-
more, the distinct periflagellar plates differ between
the two species (Fig. 6).
The morphological characteristics of P. arcua-
tum, P. gracile, P. triestinum, and P. scutellum are
also similar to those of P. koreanum, and P. micans.
P. arcuatum is elongated and lanceolate, with a
rounded anterior end and tapering posterior end
that terminates in a short point. The cells are broad-
est at a third of the length from the anterior end, and
the anterior spine is very long with a wide base.
In contrast, P. gracile is elongated and lanceolate,
with a rounded anterior end and a pointed posterior
end. The anterior spine is long, sharp, and narrow
in the plate view, whereas it is broad-lanceolate in
 Prorocentrum micans s. str. and Prorocentrum koreanum sp. nov. 41

Figure 8. Maximum likelihood tree of the ITS1–5.8S–ITS2 dataset (491 bp). Karenia brevis was included as an
out-group. The best model, as chosen by MrModel-Test2.3, was GTR+G. Support values shown are maximum
likelihood/Bayesian inference/maximum parsimony values. Only values > 50% (MP, ML) and 0.50 (BI) are
shown. *: It was named as “P. micans” in GenBank.

the side view. P. triestinum is rounded at the ante-
rior end, pointed at the posterior end, and about
twice as long as it is wide. The anterior end exhibits
a short apical spine. P. scutellum is broadly heart-
shaped with a rounded or pointed posterior end;
the anterior end has a slight indentation and two
spines, to the larger of which is attached a delicate
broad wing.
Phylogenetic and CBC Analysis
The cultured strain CCMP2794 was found to
have high sequence and morphological similarity
to P. koreanum, suggesting that this isolate is
P. koreanum rather than P. micans. We confirmed
this finding by phylogenetic analyses using ITS
(Fig. 8) and the LSU rRNA gene (Fig. 9). In addi-
tion, the P. micans AY863008 isolate had the same
phylogenetic position as P. koreanum in the LSU
phylogenetic tree (Fig. 9). Although we did not have
access to a sample of the P. micans AY863008
isolate for morphological assessment, the LSU phy-
logenetic tree reported by Howard et al. (2009) and
data from the present study (Fig. 9) indicate that
P. micans AY863008 is not a P. micans species.
Rather, P. micans AY863008 is likely to be a strain
42 M.-S. Han et al.

Figure 9. Maximum likelihood tree of the LSU dataset (475 bp). Alexandrium tamarense was included as an
out-group. The best model, as chosen by MrModel-Test2.3, was GTR+G. Support values shown are maximum
likelihood/Bayesian inference/maximum parsimony values. Only values > 50% (MP, ML) and 0.50 (BI) are
shown.

of P. koreanum; P. micans AY863008 was present
in a P. mexicanum clade and thus separate from
the P. micans clade (AF260377, AY032654, and
AF042814) in both the Neighbor joining and max-
imum parsimony phylogenetic trees reported by
Howard et al. (2009). In a similar manner, we found
in the present study that P. micans AY863008 was
separate from other clades containing P. micans,
P. mexicanum, P. texanum, and P. triestinum
(Fig. 9). Thus, many identification errors have
Table 3. Uncorrected (“p”) distance matrix based on ITS1+5.8S+ITS2 dataset.

1 2 3 4 5 6 7 8 9 10 11
1 P. micans HYMS-1211-1 -
2 P. koreanum HYSG-1312-1 0.0937 -
3 P. koreanum HYSG-1312-2 0.0917 0.0020 -
4 P. koreanum LMBEV9 0.0876 0.0143 0.0122 -
5 P. koreanum EU927529 CCMP2794* 0.0876 0.0143 0.0122 0.0041 -
6 P. micans DQ485145 0.0122 0.0937 0.0917 0.0917 0.0917 -
7 P. micans AF370879 0.0204 0.1018 0.0998 0.0998 0.0998 0.0102 -
8 P. micans AF370878 0.0000 0.0937 0.0917 0.0876 0.0876 0.0122 0.0204 -
9 P. micans FJ823584 0.0041 0.0896 0.0876 0.0876 0.0876 0.0082 0.0163 0.0041 -
10 P. micans EU780638 0.0122 0.0957 0.0937 0.0937 0.0937 0.0061 0.0163 0.0122 0.0082 -
11 P. micans EU927533 0.0061 0.0917 0.0896 0.0896 0.0896 0.0061 0.0163 0.0061 0.0020 0.0061 -
12 P. micans EU927531 0.0183 0.0896 0.0876 0.0876 0.0876 0.0224 0.0306 0.0183 0.0143 0.0204 0.0163

Prorocentrum micans s. str. and Prorocentrum koreanum sp. nov.

13 P. micans EU927524 0.0020 0.0957 0.0937 0.0896 0.0896 0.0143 0.0224 0.0020 0.0061 0.0143 0.0082
14 P. micans EU927522 0.0061 0.0917 0.0896 0.0855 0.0855 0.0183 0.0265 0.0061 0.0102 0.0183 0.0122
15 P. micans EU927521 0.0204 0.0917 0.0896 0.0896 0.0896 0.0244 0.0326 0.0204 0.0163 0.0224 0.0183
16 P. micans EU927520 0.0020 0.0917 0.0896 0.0896 0.0896 0.0102 0.0183 0.0020 0.0020 0.0102 0.0041
17 P. micans EU244467 0.0020 0.0917 0.0896 0.0855 0.0855 0.0143 0.0224 0.0020 0.0061 0.0143 0.0082
18 P. micans AF208245 0.0020 0.0957 0.0937 0.0896 0.0896 0.0143 0.0224 0.0020 0.0061 0.0143 0.0082
19 P. texanum JQ390505 0.0428 0.0937 0.0937 0.0937 0.0937 0.0468 0.0550 0.0428 0.0387 0.0468 0.0407
20 P. micans EU927530 0.0468 0.0937 0.0937 0.0917 0.0917 0.0509 0.0591 0.0468 0.0428 0.0509 0.0448
21 P. micans EU927528 0.0448 0.0957 0.0957 0.0937 0.0937 0.0489 0.0570 0.0448 0.0407 0.0489 0.0428
22 P. rhathymum JQ638938 0.0672 0.1039 0.1039 0.1079 0.1039 0.0672 0.0754 0.0672 0.0631 0.0713 0.0652
23 P. mexicanum EU927554 0.0713 0.1039 0.1039 0.1079 0.1039 0.0713 0.0794 0.0713 0.0672 0.0754 0.0693
24 P. rhathymum FJ155840 0.0733 0.1039 0.1018 0.1018 0.0998 0.0754 0.0835 0.0733 0.0713 0.0754 0.0733
25 P. rhathymum JQ616822 0.0733 0.1059 0.1039 0.1018 0.1018 0.0754 0.0835 0.0733 0.0713 0.0754 0.0733
26 P. rhathymum JN020163 0.0754 0.1079 0.1059 0.1039 0.1039 0.0774 0.0855 0.0754 0.0733 0.0774 0.0754
27 P. rhathymum EU927561 0.0733 0.1039 0.1018 0.1018 0.0998 0.0754 0.0835 0.0733 0.0713 0.0754 0.0733
28 P. rhathymum EU244466 0.0733 0.1059 0.1039 0.1018 0.1018 0.0754 0.0835 0.0733 0.0713 0.0754 0.0733
29 P. minimum FJ823587 0.1955 0.2220 0.2220 0.2240 0.2220 0.1915 0.1955 0.1955 0.1915 0.1915 0.1894
30 P. minimum FJ823586 0.1955 0.2220 0.2220 0.2240 0.2220 0.1915 0.1955 0.1955 0.1915 0.1915 0.1894
31 P. minimum EU927546 0.1955 0.2220 0.2220 0.2240 0.2220 0.1915 0.1955 0.1955 0.1915 0.1915 0.1894
32 P. minimum EU927545 0.1955 0.2220 0.2220 0.2240 0.2220 0.1915 0.1955 0.1955 0.1915 0.1915 0.1894
33 P. minimum EU927544 0.1976 0.2200 0.2200 0.2220 0.2200 0.1935 0.1976 0.1976 0.1935 0.1935 0.1915

43
 44
M.-S. Han et al.
Table 3. ( Continued )

12 13 14 15 16 17 18 19 20 21 22
1 P. micans HYMS-1211-1
2 P. koreanum HYSG-1312-1
3 P. koreanum HYSG-1312-2
4 P. koreanum LMBEV9
5 P. koreanum EU927529 CCMP2794*
6 P. micans DQ485145
7 P. micans AF370879
8 P. micans AF370878
9 P. micans FJ823584
10 P. micans EU780638
11 P. micans EU927533
12 P. micans EU927531 -
13 P. micans EU927524 0.0204 -
14 P. micans EU927522 0.0244 0.0041 -
15 P. micans EU927521 0.0020 0.0224 0.0265 -
16 P. micans EU927520 0.0163 0.0041 0.0082 0.0183 -
17 P. micans EU244467 0.0204 0.0041 0.0041 0.0224 0.0041 -
18 P. micans AF208245 0.0204 0.0041 0.0082 0.0224 0.0041 0.0041 -
19 P. texanum JQ390505 0.0367 0.0448 0.0489 0.0387 0.0407 0.0448 0.0448 -
20 P. micans EU927530 0.0407 0.0489 0.0530 0.0428 0.0448 0.0489 0.0489 0.0041 -
21 P. micans EU927528 0.0387 0.0468 0.0509 0.0407 0.0428 0.0468 0.0468 0.0020 0.0020 -
22 P. rhathymum JQ638938 0.0693 0.0693 0.0693 0.0713 0.0652 0.0693 0.0693 0.0713 0.0754 0.0733 -
23 P. mexicanum EU927554 0.0733 0.0733 0.0733 0.0754 0.0693 0.0733 0.0733 0.0754 0.0794 0.0774 0.0082
24 P. rhathymum FJ155840 0.0794 0.0754 0.0794 0.0815 0.0733 0.0754 0.0754 0.0754 0.0794 0.0774 0.0672
25 P. rhathymum JQ616822 0.0794 0.0754 0.0794 0.0815 0.0733 0.0754 0.0754 0.0754 0.0794 0.0774 0.0693
26 P. rhathymum JN020163 0.0815 0.0774 0.0815 0.0835 0.0754 0.0774 0.0774 0.0774 0.0815 0.0794 0.0713
27 P. rhathymum EU927561 0.0794 0.0754 0.0794 0.0815 0.0733 0.0754 0.0754 0.0774 0.0815 0.0794 0.0693
28 P. rhathymum EU244466 0.0794 0.0754 0.0794 0.0815 0.0733 0.0754 0.0754 0.0754 0.0794 0.0774 0.0693
29 P. minimum FJ823587 0.1874 0.1935 0.1976 0.1894 0.1935 0.1976 0.1976 0.1915 0.1955 0.1935 0.1935
30 P. minimum FJ823586 0.1874 0.1935 0.1976 0.1894 0.1935 0.1976 0.1976 0.1915 0.1955 0.1935 0.1935
31 P. minimum EU927546 0.1874 0.1935 0.1976 0.1894 0.1935 0.1976 0.1976 0.1915 0.1955 0.1935 0.1935
32 P. minimum EU927545 0.1874 0.1935 0.1976 0.1894 0.1935 0.1976 0.1976 0.1915 0.1955 0.1935 0.1935
33 P. minimum EU927544 0.1894 0.1955 0.1996 0.1915 0.1955 0.1996 0.1996 0.1935 0.1976 0.1955 0.1955
1 P. micans HYMS-1211-1
2 P. koreanum HYSG-1312-1
3 P. koreanum HYSG-1312-2
4 P. koreanum LMBEV9
5 P. koreanum EU927529 CCMP2794*
6 P. micans DQ485145
7 P. micans AF370879
8 P. micans AF370878
9 P. micans FJ823584
10 P. micans EU780638
11 P. micans EU927533
12 P. micans EU927531
13 P. micans EU927524
14 P. micans EU927522

Prorocentrum micans s. str. and Prorocentrum koreanum sp. nov.

15 P. micans EU927521
16 P. micans EU927520
17 P. micans EU244467
18 P. micans AF208245
19 P. texanum JQ390505
20 P. micans EU927530
21 P. micans EU927528
22 P. rhathymum JQ638938
23 P. mexicanum EU927554 -
24 P. rhathymum FJ155840 0.0652 -
25 P. rhathymum JQ616822 0.0672 0.0041 -
26 P. rhathymum JN020163 0.0693 0.0061 0.0020 -
27 P. rhathymum EU927561 0.0693 0.0041 0.0082 0.0102 -
28 P. rhathymum EU244466 0.0672 0.0041 0.0000 0.0020 0.0082 -
29 P. minimum FJ823587 0.1955 0.2016 0.2016 0.2037 0.2037 0.2016 -
30 P. minimum FJ823586 0.1955 0.2016 0.2016 0.2037 0.2037 0.2016 0.0000 -
31 P.minimum EU927546 0.1955 0.2016 0.2016 0.2037 0.2037 0.2016 0.00000.0000 -
32 P.minimum EU927545 0.1955 0.2016 0.2016 0.2037 0.2037 0.2016 0.00000.0000 0.0000 -
33 P.minimum EU927544 0.1976 0.2016 0.2016 0.2037 0.2037 0.2016 0.00200.0020 0.0020 0.0020 -

45
46 M.-S. Han et al.

Figure 10. Secondary structure of ITS2 region of rRNA for Prorocentrum micans (Korean strain:
HYMS-1211-1), based on model of type strain P. micans CCMP1589. Helices I–IV are shown. The boxed
part: highlighted partial sequence and the compensatory base change detected in helix II for P. micans and
P. koreanum.

presumably occurred because of the similar and
easily confused shapes of P. koreanum and P.
micans sensu stricto. Although several studies
have reported the polyphyletic characteristics of P.
micans species (Howard et al. 2009; Munir et al.
2013; Murray et al. 2009), this information was
perhaps insufficient to demonstrate that different
P. micans specimens exhibiting similar morpholo-
gies and different phylogenetic positions were not
P. micans sensu stricto. These species have often
been treated as local forms of P. micans and have
even been raised to specific ranks, which compli-
cates the literature (Dodge 1975).
Overall, the phylogenetic trees of Prorocentrum
spp. (Figs 7–9) based on SSU, ITS/5.8S, and LSU
sequence analysis are similar to those in previ-
ous reports (Chomérat et al. 2010; Henrichs et al.
2013; Hong et al. 2008; Murray et al. 2009). The
SSU phylogenetic tree (Fig. 7) reveals the dif-
ficulty in distinguishing P. koreanum, P. micans,
 Prorocentrum micans s. str. and Prorocentrum koreanum sp. nov.
and P. texanum from one another based on this
marker alone. However, the ITS/5.8S and LSU
sequences provide sufficient information to dis-
tinguish these P. micans-like species from one
another. In addition, the ITS and LSU phyloge-
netic trees (Figs 8–9) indicate that P. koreanum
is more closely related to P. mexicanum and
P. rhathymum than to P. micans and P. texanum.
Also, the genetic distances obtained from the
ITS1–5.8S–ITS2 dataset demonstrate that P. kore-
anum is clearly different from P. micans, P. texanum,
P. mexicanum, P. rhathymum, and P. minimum.
Specifically, all differences were > 0.04 substitut-
ions per site (Table 3), and p ≥ 0.04 can be used
to delineate most free-living dinoflagellate species
(Litaker et al. 2007). Furthermore, CBCs were
detected in helix II of P. koreanum and P. micans
that can prove that they are different species based
on previous studies (John et al. 2014; Pröschold
et al. 2011). Thus, genetic differences were clearly
observed between P. koreanum and P. micans in
this study.
In conclusion, the data presented here show that
P. micans-like species are not a single species. A
combination of morphological analysis and genetic
sequence information supports the designation of
P. koreanum as a new species of dinoflagellate.
Methods
Isolation and cultures: Several strains of Prorocentrum were
established from coastal water in various geographical regions
of Korea and Japan (Fig. 1). The clonal cultures we used in
this study were derived either from a net sample (20 ␮m mesh
size) or from surface seawater samples that were gently con-
centrated with a 20 ␮m mesh filter. Single cells were isolated
by the capillary method (Andersen 2005) using a Zeiss Axio-
plan 100 inverted microscope (Carl Zeiss, Jena, Germany)
and cultured them in 96-well plates containing 200 ␮l of f/2-
Si medium (Guillard and Ryther 1962). Cultures of isolated
strains were subcultured into fresh f/2-Si medium at approxi-
mately 20-day intervals to maintain culture health. All isolates
and cultures were maintained at 20 ◦ C on a 12:12-h light:dark
cycle (100–150 ␮mol m–2 s–1 ; cool white fluorescent tubes). All
strains are available upon request.
Light microscopy: Observations of live and fixed cells
were made using an inverted microscope (IX 71, Olympus,
Japan) and a stereomicroscope (Axioplan microscope, Zeiss,
Germany) equipped with epifluorescence and Nomarski differ-
ential interference contrast (DIC) optics. Natural and cultured
samples were fixed for at least 8 h at 4 ◦ C in Lugol’s solu-
tion (Throndsen 1978; final concentration approximately 2%)
or glutaraldehyde solution (Sigma-Aldrich, St. Louis, MO, USA;
final concentration approximately 1%). The fixed samples were
either observed directly or rinsed with distilled water to com-
pletely remove all fixation reagents and sea salt. Samples
were mounted in glycerol gelatin (Sigma-Aldrich) for slide
preparation. All slides are archived in the Laboratory for
Water Environmental Ecology and Restoration at Hanyang
47
University. Light microscopy images were recorded using a
cooled charge-coupled device (CCD) camera (XC10, Olym-
pus, Japan) and analyzed using cellSens Standard 1.8 software
(Olympus, Japan). The shape and position of the nucleus was
determined by staining glutaraldehyde-fixed cells for 10 min in
4 -6-diamidino-2-phenylindole (DAPI; 0.1 ␮g mL–1 final concen-
tration).
Scanning electron microscopy (SEM): For SEM examina-
tion of the pore patterns on the valves and the periflagellar plate
structures of Prorocentrum, cells from growing cultures were
fixed in glutaraldehyde solution (Sigma-Aldrich) or osmium
tetroxide (Ted Pella, St. Louis, CA, USA) at final concentra-
tions of approximately 1%. The specimens were rinsed with
distilled water to completely remove all fixation reagents and
sea salt and then dehydrated them with a graded ethanol series
treatment (30, 50, 70, 90 and 100%; 30 min per concentration).
Samples (50 ␮l) of the dehydrated specimens were directly
mounted onto a 3 ␮m TSTP Millipore filter membrane (Millipore
Filter Corporation, Cork, Ireland), dried them at room tempera-
ture for 12 h (Wang et al. 2014), coated them with gold for 150
s under a 40 mA current (BAL-TEC SCD 005 Super Coater,
Liechtenstein, Germany), and examined them using a scan-
ning electron microscope (Hitachi S-2380n, Japan, and Nova
NanoSEM 450, FEI, Netherlands).
Identification of organisms and statistical analysis: Cell
length, width, spine length, and posterior angle measurements
were determined by light microscopy. All results are based on
measurements of more than 30 randomly selected cells. Cell
length was estimated from the anterior end to the posterior
end in the valve view, and cell width was estimated as the
trans-diameter in the lateral view (Faust et al. 2008). Trichocyst
distribution and periflagellar area structure from at least 10 cells
were observed under a SEM. The periflagellar area numbering
system followed the labeling system proposed by Hoppenrath
et al. (2013). All tested strains were examined at the expo-
nential growth stage. Species groupings based on cell length,
cell width, spine length, and posterior angle were analyzed
by ANOVA with the SPSS software program (IBM). A p value
< 0.05 was considered significant.
DNA extraction, PCR amplification, and sequencing:
Clonal cultures in the mid-logarithmic growth phase (3 ml) were
harvested by centrifugation at 8000 × g for 5 min. Pelleted cells
were transferred to 1.5 ml Eppendorf tubes containing 100 ␮l
of TE buffer [10 mM Tris-HCl (pH 8.0) and 1 mM ethylenedi-
aminetetraacetic acid] and stored at –20 ◦ C until DNA extraction
(Wang et al. 2014). Genomic DNA was extracted from cells
using the DNeasy Plant Mini Kit (Qiagen, USA).
For PCR amplification, primers (Table 4) were combined with
nuclear SSU, ITS, and LSU rDNA. PCR reactions were per-
formed using TaKaRa EX TaqTM (TaKaRa, Japan) in a total
volume of 50 ␮l. Positive bands were excised following gel elec-
trophoresis and purified with a QIAquick PCR Purification Kit
(Qiagen, Germany) according to the manufacturer’s instruc-
tions. DNA sequencing reactions were performed using an ABI
PRISM® BigDyeTM Terminator v 3.1 Kit (Applied Biosystems,
Foster City, CA, USA) with the primers listed in Table 4. Labeled
DNA fragments were analyzed by capillary electrophoresis on
an ABI 3730xl Genetic Analyzer (Applied Biosystems). Editing
and contig assembly of rDNA sequence fragments were carried
out using Sequencher 4.7 (Gene Codes, USA).
DNA sequence comparisons: Full multiple alignments of
the sequences obtained in our study (Table 2) with NCBI
sequences were generated using the Clustal W1.8 (Thompson
et al. 1994) portion of the Bioedit program v7.0.9.0 (North Car-
olina State University). All aligned nuclear rDNA sequences
were trimmed to the same length, and the gaps were deleted.
DNA similarities were calculated using Bioedit.
48 M.-S. Han et al.

Table 4. Primers sequences used to amplify SSU, ITS and LSU rDNA regions in Prorocentrum species.

Primer name* Target rDNA Nucleotide sequence (5 to 3 ) Reference

EUKA-F SSU AACCTGGTTGATCCTGCCAGT (Medlin et al. 1988)
EUKB-R SSU TGATCCTTCTGCAGGTTCACCTAC (Medlin et al. 1988)
SR4-F 548-566 SSU AGGGCAAGTCTGGTGCCAG (Hong et al. 2007)
SR5kaw-R 630-611 SSU ACTACGAGCTTTTTAACCGC (Hong et al. 2007)
SR6-F 891-910 SSU GTCAGAGGTGAAATTCTTGG (Hong et al. 2007)
SR7-R 951-932 SSU TCCTTGGCAAATGCTTTCGC (Hong et al. 2007)
SR9-R 1286-1267 SSU AACTAAGAACGGCCATGCAC (Hong et al. 2007)
ITS1-F ITS TCCGTAGGTGAACCTGCGG (White et al. 1990)
ITS4-R ITS TCCTCCGCTTATTGATATGC (White et al. 1990)
LSU D1R-F LSU ACCCGCTGAATTTAAGCATA (Scholin et al. 1994)
LSU D2C-R LSU CCTTGGTCCGTGTTTCAAGA (Scholin et al. 1994)
*F is the forward primer and R is the reverse primer.

For maximum likelihood (ML) phylogenetic tree analysis, the
best model was selected by MrModelTest2.3 and PAUP*4.0b10
(Swofford 2003). The best-fit model for the PhyML 3.0 settings
(Guindon et al. 2010) was selected from 24 tested models.
Bootstrap values (branch support) were obtained from 1000
replicates. Bootstrap values > 50 are indicated at each branch
node.
For Bayesian inference (BI) analysis, the optimal model of
nucleotide substitution was selected and used it in the ML
analysis. The best-fit model was selected from 24 tested mod-
els using MrBayes 3.2.1 (Ronquist et al. 2012). The Markov
Chain Monte Carlo (MCMC) process was set at two chains
and 5,000,000 generations were performed. The sampling fre-
quency was 100 generations. Following analysis, the standard
deviation of frequencies was confirmed to be < 0.01, the first
25% of all trees were deleted as burn-ins, and a consensus
tree was constructed. Bayesian posterior probabilities (BI) >
0.50 are indicated at each branch node.
Maximum parsimony (MP) branch and bound searches were
performed in PAUP*4.0b10 (Swofford 2003) using the hierar-
chical likelihood ratio tests (hLRTs) settings. Bootstrap values
(branch support) were based on 1000 replicates. Bootstrap val-
ues > 50 are indicated at each branch node.
The uncorrected genetic distances (p) between different Pro-
rocentrum species were analyzed with PAUP*4.0b10 (Swofford
2003) using the ITS1–5.8S–ITS2 (ITS region: 491 bp) rDNA
sequences.
ITS2 rRNA secondary structure modeling: The beginning
and end of the ITS2 region in these strains were identified
via the homology with P. micans given in the ITS2 database
(Koetschan et al. 2010). The ITS2 region consisted of approxi-
mately 182 bp in our Prorocentrum strains. The ITS2 secondary
structure was predicted using the existing structural model of
the type strain P. micans (CCMP1589) ITS2 region in the ITS2
database (Koetschan et al. 2010). Structures were visualized
using VARNA (Darty et al. 2009). The compensatory base
changes were identified using the software 4SALE (Seibel et al.
2006).
Acknowledgements
This research was supported by a grant from
the Marine Biotechnology Program Funded
by the Ministry of Oceans and Fisheries.
We thank Dr. Øjvind Moestrup (Biological Institute,
Section of Phycology, University of Copenhagen)
and Dr. R. Wayne Litaker (NOAA, Center for
Coastal Fisheries and Habitat Research) for their
critical comments and revision of this manuscript.
Appendix A. Supplementary Data
Supplementary data associated with this arti-
cle can be found, in the online version, at
http://dx.doi.org/10.1016/j.protis.2015.12.001.
References
Andersen RA (2005) Algal culturing techniques. Academic
Press, USA, 578p
Chomérat N, Sellos DY, Zentz F, Nézan E (2010) Morphol-
ogy and molecular phylogeny of Prorocentrum consutum sp.
nov.(Dinophyceae), a new benthic dinoflagellate from South
Brittany (Northwestern France). J Phycol 46:183–194
Cohen-Fernandez EJ, Meave Del Castillo E, Salgado Ugarte
I, Pedroche FF (2006) Contribution of external morphology in
solving a species complex: The case of Prorocentrum micans,
Prorocentrum gracile and Prorocentrum sigmoides (Dinoflagel-
lata) from the Mexican Pacific Coast. Phycol Res 54:330–340
Cortés-Altamirano R, Sierra-Beltrán AP (2003) Morphology
and taxonomy of Prorocentrum mexicanum and reinstate-
ment of Prorocentrum rhathymum (Dinophyceae). J Phycol
39:221–225
Croome R, Tyler P (1987) Prorocentrum playfairi and Pro-
rocentrum foveolata, two new dinoflagellates from Australian
freshwaters. Brit Phycol J 22:67–75
Darty K, Denise A, Ponty Y (2009) VARNA: Interactive draw-
ing and editing of the RNA secondary structure. Bioinformatics
25:1974–1975
Dickey RW, Bobzin SC, Faulkner DJ, Bencsath FA, Andrze-
jewski D (1990) Identification of okadaic acid from a Caribbean
dinoflagellate. Prorocentrum concavum. Toxicon 28:371–377
 Prorocentrum micans s. str. and Prorocentrum koreanum sp. nov.
Dodge JD (1975) The Prorocentrales (Dinophyceae). II. Revi-
sion of the taxonomy within the genus Prorocentrum. Bot J Linn
Soc 71:103–125
Dodge J, Bibby B (1973) The Prorocentrales (Dinophyceae):
I. A comparative account of fine structure in the genera Proro-
centrum and Exuviaella. Bot J Linn Soc 67:175–187
Ehrenberg CG (1834) Dritter Beitrag zur Erkenntniss grosser
Organisation in der Richtung des kleinsten Raumes. Abhand-
lungen der Königlichen Akademie der Wissenschaften zu Berlin
1833:145–336
Faust MA, Vandersea MW, Kibler SR, Tester PA, Litaker
RW (2008) Prorocentrum levis, a new benthic species (Dino-
phyceae) from a mangrove island, twin cays, Belize. J Phycol
44:232–240
Grzebyk D, Sako Y, Berland B (1998) Phylogenetic analysis
of nine species of Prorocentrum (Dinophyceae) inferred from
18S ribosomal DNA sequences, morphological comparisons,
and description of Prorocentrum panamensis, sp. nov. J Phycol
34:1055–1068
Guillard R, Ryther J (1962) Studies of marine planktonic
diatoms. I. Cyclotella nana Hustedt, and Detonula confervacea
(Cleve) Gran. Can J Microbiol 8:229–239
Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W,
Gascuel O (2010) New algorithms and methods to estimate
maximum-likelihood phylogenies: assessing the performance
of PhyML 3.0 performance of PhyML 3.0. Sys Biol 59: 307–321.
Guiry MD, Guiry GM (2014) AlgaeBase, World-wide elec-
tronic publication, National University of Ireland, Galway,
http://www.algaebase.org; accessed on 22 December 2014.
Han M-S, Furuya K (2000) Size and species-specific primary
productivity and community structure of phytoplankton in Tokyo
Bay. J Plankton Res 22:1221–1235
Han M-S, Yoo K (1983) A taxonomical study on the dinoflagel-
lates in Jinhae Bay. 1. Armored and unarmored dinoflagellates.
Bull KORDI 5:37–47
Han M-S, Kim S-W, Kim Y-O (1991) Influence of discontinuous
layer on plankton community structure and distribution in Masan
Bay, Korea. Bull Korean Fish Soc 24:459–471
Henrichs DW, Scott PS, Steidinger KA, Errera RM, Abraham
A, Campbell L (2013) Morphology and phylogeny of Prorocen-
trum texanum sp. nov.(dinophyceae): a new toxic dinoflagellate
from the gulf of mexico coastal waters exhibiting two distinct
morphologies. J Phycol 49:143–155
Herrera-Sepúlveda A, Medlin LK, Murugan G, Sierra-
Beltrán AP, Cruz-Villacorta AA, Hernández-Saavedra NY
(2015) Are Prorocentrum hoffmannianum and Prorocentrum
belizeanum (Dinophyceae, Prorocentrales), the same species?
An integration of morphological and molecular data. J Phycol
51:173–188
Hong DD, Thu NTH, Nam HS, inli Hien HM (2007) The
phylogenetic tree of Alexandrium, Prorocentrum and Pseudo-
nitzschia of harmful and toxic algae in vietnam coastal waters
based on sequences of 18s rDNA, ITS1-5. 8S–ITS2 gene frag-
ments and single cell-pcr method. MRI Marine Research in
Indonesia 32:203
Hong DD, Hien HTM, Thu NH, Anh HL, Luyen QH (2008)
Phylogenetic analyses of Prorocentrum spp. and Alexandrium
49
spp. isolated from Northern coast of Vietnam based on 18S
rDNA sequence. J Environ Biol 29:535–542
Hoppenrath M (2000) A new marine sand-dwelling Prorocen-
trum species, P. clipeus sp. nov. (Dinophyceae, Prorocentrales)
from Helgoland, German Bight, North Sea. Eur J Protistol
36:29–33
Hoppenrath M, Chomérat N, Horiguchi T, Schweikert M,
Nagahama Y, Murray S (2013) Taxonomy and phylogeny of
the benthic Prorocentrum species (Dinophyceae)—A proposal
and review. Harmful Algae 27:1–28
Howard MD, Smith GJ, Kudela RM (2009) Phylogenetic rela-
tionships of yessotoxin-producing dinoflagellates, based on the
large subunit and internal transcribed spacer ribosomal DNA
domains. Appl Environ Microbiol 75:54–63
John U, Litaker RW, Montresor M, Murray S, Brosnahan
ML, Anderson DM (2014) Formal revision of the Alexan-
drium tamarense species complex (Dinophyceae) taxonomy:
the introduction of five species with emphasis on molecular-
based (rDNA) classification. Protist 165:779–804
Koetschan C, Förster F, Keller A, Schleicher T, RuderischB,
Schwarz R, Müller T, Wolf M, Schultz J (2010) The ITS2
Database III-sequences and structures for phylogeny. Nucleic
Acids Res 38:275–276
Lee J-Y, Han M-S (2007) Change of blooming pattern and pop-
ulation dynamics of phytoplankton in Masan Bay, Korea. The
Sea 12:147–158
Lim AS, Jeong HJ, Jang TY, Kang NS, Lee SY, Du Yoo Y,
Kim HS (2013) Morphology and molecular characterization of
the epiphytic dinoflagellate Prorocentrum cf. rhathymum in tem-
perate waters off Jeju Island, Korea. Ocean Sci J 48:1–17
Litaker RW, Vandersea MW, Kibler SR, Reece KS, Stokes
NA, Lutzoni FM, Yonish BA, West MA, Black MN, Tester
PA (2007) Recognizing Dinoflagellate species using its rDNA
sequences. J Phycol 43:344–355
Lu D-D, Goebel J (2001) Five red tide species in genus
Prorocentrum including the description of Prorocentrum dong-
haiense Lu sp. nov. from the East China Sea. Chin J Oceanol
Limn 19:337–344
Medlin L, Elwood HJ, Stickel S, Sogin ML (1988) The
characterization of enzymatically amplified eukaryotic 16S-like
rRNA-coding regions. Gene 71:491–499
Munir S, Naz T, Siddiqui P, Morton SL (2013) Morphotax-
onomy and seasonal distribution of planktonic and benthic
Prorocentrales in Karachi waters, Pakistan Northern Arabian
Sea. Chin J Oceanol Limn 31:267–281
Murray S, Ip CL-C, Moore R, Nagahama Y, Fukuyo Y (2009)
Are prorocentroid dinoflagellates monophyletic? A study of 25
species based on nuclear and mitochondrial genes. Protist
160:245–264
Pröschold T, Darienko T, Silva PC, Reisser W, Krienitz L
(2011) The systematics of Zoochlorella revisited employing an
integrative approach. Environ Microbiol 13:350–364
Ronquist F, Teslenko M, van der Mark P, Ayres DL, Dar-
ling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck
JP (2012) MrBayes 3. 2: Efficient Bayesian Phylogenetic Infer-
ence and Model Choice across a Large Model Space. Syst Biol
61:539–542
50 M.-S. Han et al.
Saldarriaga JF, Cavalier-Smith T, Menden-Deuer S, Keel-
ing PJ (2004) Molecular data and the evolutionary history of
dinoflagellates. Eur J Protistol 40:85–111
Schiller J (1933) Dinoflagellatae (Peridineae). In Rabenhorst L
(ed), Kryptogamen-Flora von Deutschland, Österreich und der
Schweiz. Band 10/3, Teil 1, 2. Aufl, Akademische Verlagsge-
sellschaft,. Leipzig, 255p
Scholin CA, Herzog M, Sogin M, Anderson DM (1994) Identi-
fication of group-and strain-specific genetic markers for globally
distributed Alexandrium (Dinophyceae). ii. Sequence analysis
of a fragment of the LSU rRNA gene. J Phycol 30:999–1011
Seibel PN, Müller T, Dandekar T, Schultz J, Wolf M (2006)
4SALE – A tool for synchronous RNA sequence and sec-
ondary structure alignment and editing. BMC Bioinformatics
7:498 http://www.biomedcentral.com/1471-2105/7/498
Steidinger KA, Tangen K (1997) Dinoflagellates. In Tomas
CR (ed) Identifying Marine Phytoplankton. St. Peterburg, Acad
Press, pp 387–585
Swofford DL (2003) PAUP*. Phylogenetic Analysis Using Par-
simony (and Other Methods). Version 4.
Taylor F (1976) Dinoflagellates from the International Indian
Ocean Expedition. Bibl Bot 132:1–234
Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL
W: Improving the sensitivity of progressive multiple sequence
Available online at www.sciencedirect.com
ScienceDirect
alignment through sequence weighting, position-specific gap
penalties and weight matrix choice. Nucleic Acids Res
22:4673
Throndsen J (1978) Preservation and Storage. In Sournia A
(ed) Phytoplankton Manual. UNESCO, Paris, pp 69–74
Wang P, Park BS, Kim JH, Kim J-H, Lee H-O, Han M-S (2014)
Phylogenetic position of eight Amphora sensu lato (Bacillario-
phyceae) species and comparative analysis of morphological
characteristics. Algae 29:57–73
White TJ, Bruns T, Lee S, Taylor JW (1990) Amplification
and Direct Sequencing of Fungal Ribosomal RNA Genes for
Phylogenetics. In Innis MA, Gelfand DH, Sninsky JJ, White TJ
(eds) PCR Protocols: A Guide to Methods and Applications.
Academic Press, Inc, New York, pp 315–322
Wood EF (1954) Dinoflagellates in the Australian region. Mar
Freshwater Res 5:171–352
Yamaji I (1962) The Plankton of Japanese Coastal Waters:
Hoikusha, Osaka, Japan, 238 p
Yamaji I (1966) Illustrations of the marine plankton of Japan.
Hoikusha, Osaka, Japan, 369 p
Yoo K, Lee J (1986) Taxonomical studies on dinoflagellates in
Masan Bay. 1. Genus Prorocentrum Ehrenberg. J Oceanol Soc
Korea 21:46–55