PROTOCOL

High-resolution human papillomavirus genotyping

by MALDI-TOF mass spectrometry
Sun Pyo Hong1, Soo-Kyung Shin1, Eun Hee Lee2, Eun Ok Kim1, Seung Il Ji1, Hyun Jae Chung1, Sun Nie Park3,
Wangdon Yoo1, William R Folk4 & Soo-Ok Kim1
1R&D Center, GeneMatrix Inc, Yongin 446-913, Korea. 2Department of Laboratory Medicine, Green Cross Reference Laboratory, Yongin 446-913, Korea. 3Department of
Toxicological Research, Korea Food and Drug Administration, National Institute of Toxicological Research, Seoul 122-704, Korea. 4Department of Biochemistry,
University of Missouri–Columbia, Columbia, Missouri 65201-5149, USA. Correspondence should be addressed to S.-O.K. (sookim@genematrix.net).

Published online 28 August 2008; doi:10.1038/nprot.2008.136

© 2008 Nature Publishing Group http://www.nature.com/natureprotocols

We describe a matrix-assisted laser desorption/ionization–time of flight (MALDI-TOF) mass spectrometry (MS)-based assay for human
papillomavirus (HPV) genotyping—the restriction fragment mass polymorphism (RFMP) assay, which is based on mass measurement
of genotype-specific oligonucleotide fragments generated by TypeIIS restriction endonuclease cleavage after recognition sites have
been introduced by PCR amplification. The use of a TypeIIS restriction enzyme makes the RFMP assay independent of sequence and
applicable to a wide variety of HPV genotypes, because these enzymes have cleavage sites at a fixed distance from their recognition
sites. After PCR amplification, samples are subjected to restriction enzyme digestion with FokI and BtsCI and desalting using Oasis
purification plates, followed by analysis by MALDI-TOF MS. Overall, the protocol is simple, takes B4–4.5 h and can accurately detect
and identify at least 74 different HPV genotypes.

INTRODUCTION
Human papillomavirus (HPV) infection is the primary cause of they are labor intensive and unsuitable both for identification of
cervical cancer, and with the advent of genotype-specific vaccines, genotype variants or genotype mixtures and for screening large
there is increased need for accurate, broad-spectrum and high- numbers of samples because of the complex protocols involved19.
throughput methods for HPV genotyping1–5. More than 100 Another main drawback of these approaches can be the require-
different HPV genotypes have been identified, of which B40 can ment for multiple primers or probes that overlap one another, and
infect the mucosa of the anogenital tract and have been subdivided the requirement for subtle and complex assay optimization pro-
into low-risk types, found mainly in genital warts; high-risk types, cesses for analyzing a quantity of variations in close proximity.
frequently associated with invasive cervical cancer; and probable The restriction fragment mass polymorphism (RFMP) assay is
high-risk types. There is potential benefit of incorporating HPV based on PCR amplification and precise mass detection of oligo-
genotyping into screening programs to identify women at risk of nucleotides excised by FokI and BtsCI (or other TypeIIS enzymes)
developing invasive cervical cancer and to manage those with slight with genotype-specific base variations20 (Fig. 1). This protocol
or equivocal cytological abnormalities6–9. represents an improvement over previous methods because the
The most frequently used methods for genotyping are based
either on fluorescence or on mass spectrometry (MS) of genotype-
specific base-extended primers10–15. MS directly assesses the mole- Genotype-specific sequences
cular mass of the PCR products, whereas other technologies only
indirectly measure PCR products, either through hybridization or
by sequencing of PCR products as templates. Procedures using PCR PCR
products as templates to which oligonucleotide primers are hybri-
dized, extended and then analyzed by MS have been widely used16;
however, these fail to employ one of key strengths of MS—the
FokI
direct mass analysis of PCR products. Assays based on hybridiza-
5′…GGATG(N)9 …3′
tion also have been used as surrogate genotyping methods17,18, but 3′…CCTAC(N)13 …5′
Enzyme digestion
BtsCI
5′…GGATG(N)2 …3′
Figure 1 | General procedures for the restriction fragment mass polymorphism 3′…CCTAC …5′
genotyping assay. PCR was performed with primers designed to introduce a 7mer 12mer 13mer
TypeIIS restriction endonuclease recognition sequence (GGATG; FokI) ahead of 13mer 12mer 7mer
the genotype-specific motif on amplification. The enzymatic digestion of the Desalting by Oasis plate
products released a pair of 7mer, 12mer, 13mer fragments representing
nucleotide sequences shown in red, and then the resulting oligonucleotide
fragments were desalted by C18 reverse phase microcolumn chromatography
(Oasis) and analyzed by matrix-assisted laser desorption/ionization–time of MALDI-TOF MS
flight (MALDI-TOF) mass spectrometry (MS). The samples were analyzed in the
negative-ion mode with 3-hydroxypicolinic acid as the matrix. Cleavage sites
r.i.

of FokI and BstF5I, an isoschizomer for FokI, are indicated by solid and open
triangles, respectively. m/z, mass-to-charge ratio; r.i., relative peak intensity.
m/z

1476 | VOL.3 NO.9 | 2008 | NATURE PROTOCOLS


mass of PCR products is determined directly, rather than their
identity being interpreted on the basis of fluorescent or radioactive
reporter tags. Both DNA strands can be analyzed in parallel20,21,
providing a level of internal confirmation not achievable by other
methods. The use of a TypeIIS restriction enzyme22 makes the assay
independent of restriction sites within the HPV genome and
suitable for many different viral genotypes because these enzymes
cleave DNA at a fixed distance from the recognition sites incorpo-
rated into the amplification primers.
The RFMP assay has proven to genotype hepatitis C virus21, drug
resistant hepatitis B virus19,20,23–26, HPV27,28 and human genomic
variations in an accurate and reliable manner29–31. RFMP was shown
© 2008 Nature Publishing Group http://www.nature.com/natureprotocols
to enable sensitive and semi-quantitative detection of mixtures of
multiple genotype viruses without need for population-based cloning
and subsequent sequencing in hepatitis C virus genotyping21. The
RFMP assay for HPV genotyping showed superior concordance with
sequencing methods and better sensitivity and specificity than Digene
hybrid capture or microarray-based methods27,28. In this protocol,
we describe a RFMP assay for high-resolution HPV genotyping that
detects differences among 74 HPV genotypes in the molecular masses
of oligonucleotides derived from 22-bp genotype-specific motifs in
the HPV L1 gene. It enables efficient differentiation of 42 anogenital
HPV types including 14 high-risk, 15 low-risk and 3 probable high-
risk types, and 32 nonanogenital virus types. Following primary
target amplification, it includes nested PCR followed by one restric-
tion enzyme reaction in a second vessel. Generally, the RFMP
genotyping assay can be designed without employing a nested
PCR; however for HPV genotyping assay, two rounds of PCRs are
employed to amplify any HPV present in the samples tested.
Assay design and optimization
The RFMP assay is based on MS analysis of small DNA fragments
containing genotype-specific motifs (Fig. 1). The first step requires
PCR amplification using primers flanking the genotype-specific
motifs. From the alignment of the reference sequences of the L1
major capsid gene of all available genotypes from the Los Alamos
National Laboratories (LANL) HPV database (http://hpv-web.
lanl.gov), nucleotide sequences corresponding to nucleotides
6604–6625 (numbered according to the HPV 16; GenBank acces-
sion number AY686584), surrounded by conserved regions were
chosen as genotype-specific motifs. Primers flanking the variable
regions, PV-rfmpF/PV-rfmpR, were designed and modified to
introduce upon amplification a TypeIIS restriction endonuclease
recognition sequence 5¢ of the variable motif. PV-rfmpF/PV-rfmpR
primers were designed to introduce a FokI site (a neoschizomer of
BtsCI) in the amplified product by substituting the restriction
recognition sequence GGATG for T (nucleotide 6598) and ATCC
for T (nucleotide 6634), respectively (see the PCR section for
primer sequences). The short inserted sequences in general are
not expected to base pair to the template strand, but rather to loop
out when the primers are bound to the template. When the
complementary strands are copied, the inserted sequences are
incorporated into the amplicon. TypeIIS restriction enzymes such
as FokI and BtsCI cleave DNA outside the recognition sequence:
FokI, 9 bases 3¢ to the recognition site on one strand and 13 bases
from the recognition site on the other strand, leaving a four base
overhang protruding 5¢-end; BstF5I, 2 bases 3¢ to the recognition
site on one strand and immediately 3¢ to the recognition site on the
opposite strand, leaving a two base overhang. As outlined in
PROTOCOL
Figure 1, cleavage of an 80-bp amplified segment with FokI and
BtsCI leads to excision of two sets of 7mer/12mer/13mer fragments
reflecting the pattern of sequence variations in the 22-bp-genotype-
specific motif. As the RFMP assay determines only molecular mass,
the assay should be designed so that mass patterns obtained from
multiple fragments would enable exact genotype differentiation.
Masses of restriction fragments are calculated by Oligo II Mass
Calculator v1.0 with an option of adding one phosphate group
(http://library.med.utah.edu/masspec/oligoii.htm).
The RFMP assay is easily adaptable for the detection of diverse
type of genetic variations including polymorphisms, deletion,
addition as well as motifs with multiple variations because the
range and size of the restriction fragments analyzed by matrix-
assisted laser desorption/ionization–time of flight (MALDI-TOF)
MS can be varied according to the investigator’s need. Adoption of
other TypeIIS restriction enzyme recognition sites could be con-
sidered for novel targets. For such assays, it is desirable to design the
modified primer so that the number of inserted nucleotides is
minimized. The optimal range in nucleotide length of 5¢- and 3¢-
arm sequences across the inserted loop in the engineered primer
has been observed to be within 16–19 and 6–8 bases, respectively.
Peak heights are dependent on the concentration of the effective
restriction fragments that are influenced by PCR yield. Thus PCR
optimization with samples with wide dynamic ranges of target
DNA, such as clinical specimens, is a prerequisite for good results.
For samples with unknown target concentrations, we recommend
preparing two MALDI plates, varying the ratio of desalted DNA
fragment and the matrix solution and repetition of MS analyses to
improve the success rate. The presence of metal cations produces salt
adducts, leading to reduced resolution and low sensitivity. Various
desalting procedures have been established for DNA analyses by
MALDI-TOF MS32–34. We used C18 reverse phase microcolumn
chromatography as an effective and inexpensive method for desalting
oligonucleotides because it can be recycled by repeated washing with
isopropanol without remarkable loss of efficiency. 3-Hydroxypico-
linic acid is a widely used matrix for DNA analysis because it provides
limited fragmentation35. However, nonhomogeneous crystallization
is obtained with the classic dried droplet preparation, and a search for
a ‘sweet spot’ is required36. Recrystallization of sample DNAs on
matrix-prespotted anchorchip plates allowed robust formation of
small single crystals. Theoretically, a limitation of the RFMP assay is
that it determines only molecular mass and, therefore, may fail to
detect alterations in sequences that do not lead to a change in
molecular mass. The presence of a novel genotype variant with
sequence alterations that do not cause a deviation from the molecular
mass pattern predicted from up-to-date HPV databases is possible,
but we believe this would be extremely rare, as corroborated by the
fact that we found no such case in more than thousands of specimens
subjected to both RFMP and sequencing assays. To minimize such a
possibility, it is desirable to design the assay so that combinational
mass patterns obtained from multiple DNA fragment juxtaposed one
another would enable exact genotype identification.
PCR
HPV DNA was amplified with PGMY09/11, composed of two
nondegenerate pools of L1 consensus primers37. For the second
round, we used nested PCR primer pairs; a sense primer PV-rfmpF
specific to bases 6584–6603 (5¢-GCMCAGGGHCAYAAGGATG
AATGG-3¢; M ¼ A/C, H ¼ A/C/T, Y ¼ C/T) and an antisense
NATURE PROTOCOLS | VOL.3 NO.9 | 2008 | 1477
 PROTOCOL
primer PV-rfmpR specific to bases 6657–6626 (5¢-GTACTDCKD
GTRGTATCHACMACGGATGTAACAAA-3¢; D ¼ A/G/T, K ¼ G/T, R
¼ A/G). As illustrated in Figure 1, sequences underlined in each
primer were modified to insert FokI restriction recognition site in the
PCR products. Nucleotide sequence positions were numbered accord-
ing to HPV genotype 16 (GenBank accession number AY686584).
Controls and quality assurance
Positive and negative controls consisting of confirmed positive and
negative swab samples or a plasmid-containing HPV16 whole genome
(ATCC 45113D) and distilled water must be included in all reactions
from the extraction step. To avoid carry-over contamination, the
© 2008 Nature Publishing Group http://www.nature.com/natureprotocols
procedures recommended by Kwok and Higuchi were strictly fol-
lowed38. Each sample with a peak pattern that differs from the predicted
mass patterns was sequenced to verify the exact nucleotide change. In
case of a failure in data interpretation due to the low signal or lack of
peaks in MALDI-TOF MS for genotype assignment, two independent
replicate experiments were performed to confirm the results.
MATERIALS
REAGENTS
. 10 PCR buffer (Invitrogen)
. dNTPs (Invitrogen)
. Oligonucleotide primers (HPLC-purified or PAGE-purified; Bioneer)
. Platinum Taq DNA Polymerase (Invitrogen/BRL, cat. no. 10966-034)
m CRITICAL It is important to use an antibody-inactivated hot start enzyme
for PCR yield and specificity.
. 50 TAE buffer (Eppendorf)
. UltraPure Agarose (GIBCO/BRL)
. QIAamp DNA Blood Mini Kit (Qiagen)
. 10 New England Biolabs (NEB) buffer 4 (NEB) and FokI (NEB)
. BtsCI (NEB)
. Adhesive film (Corning)
. Acetic acid (HPLC-grade; Sigma-Aldrich, Merck, Fluka)
. Acetonitrile (HPLC-grade; Sigma-Aldrich, Merck, Fluka) ! CAUTION This
very toxic reagent should be handled appropriately.
. Oasis HLB mElution plate, including 96 Oasis resins (Waters) or custom-
built 384 well plate (Waters)
. Methanol (Sigma-Aldrich, Merck, Fluka) ! CAUTION Highly flammable
and toxic.
. Acetone (HPLC-grade; Sigma-Aldrich, Merck, Fluka) ! CAUTION This
harmful, flammable reagent should be handled appropriately.
. Plasticware (96- and 384-well polypropylene plates; Eppendorf) m CRITICAL
It is important to use an oil-free plasticware for good matrix crystals.
. 3-Hydroxypicolinic acid (Bruker Daltonics, cat. no. 203070) m CRITICAL We
recommend storing the substance in the dark at 4 1C.
. Ammonium citrate (498%; Sigma-Aldrich, Merck, Fluka)
. Triethylammonium acetate (TEAA, 1 M solution; Calbiochem)
EQUIPMENT
. PTC 225 Peltier thermo cycler (MJ Research)
. GeneAmp PCR system 9700 (Applied Biosystems)
. Biflex IV TOF mass spectrometer equipped with a Scout MTP ion source
with delayed extraction
. XACQ software (Bruker Daltonics)
. XMASS software (Bruker Daltonics)
. MTP AnchorChip 400/384 TF and adapter (Bruker Daltonics)
. GenoTools manager software (Bruker Daltonics)
. Ultrasonic bath (Tomtec)
. Oasis HLB purification (Waters)
. Microlab 4200 (Hamilton)
. 96-well centrifuge (Hannil)
. Vacuum manifold UniVac 3 (Whatman)
. Gel pump (Savant)
REAGENT SETUP
Oligonucleotides Oligonucleotides for PCR priming or standard oligomers
for MS should be HPLC or PAGE purified.
1478 | VOL.3 NO.9 | 2008 | NATURE PROTOCOLS
MALDI-TOF instrumentation and calibration
Mass spectra were acquired on a Biflex IV linear MALDI-TOF MS
(Bruker Daltonics) workstation equipped with a 337-nm nitrogen
laser and a nominal ion flight path length of 1.25 m. The samples
were analyzed in the negative-ion mode with a total acceleration
voltage of 20 kV, extraction voltage of 18.25 kV, laser attenuation of
55, and delayed extraction of long time delay. Typically, TOF data
from 20 to 50 individual laser pulses were recorded and averaged on
a transient digitizer with a time base of 2 ns and delay of 24,000 ns,
after which the averaged spectra were automatically converted
to mass by the accompanying data-processing softwares. With
such settings, the instrument usually provides mass accuracy of
40–80 p.p.m. (10
6), mass resolution of 1,500–2,000 and sensitivity
of 10–50 fmol in the 2–6-kDa mass range for oligonucleotides.
Oligonucleotide standards of 6mer (5¢-ACGTAC-3¢; 1,762.2 Da)
and 16mer (5¢-ACGTACGTACGTACGT-3¢; 4,881.2 Da) with
no terminal phosphate are used for mass calibration of the
instrument.
Specimen collection Cervical cell specimens were classified according to the
new Bethesda System39 as follows: within normal limits, atypia of squamous cells
of undetermined significance, low-grade squamous intraepithelial lesions, and
high-grade squamous intraepithelial lesions, cancer and atypia of glandular cells of
undetermined significance. Cervical samples from patients with histologically
confirmed cervical cancers and a positive test for HPV DNA or a plasmid DNA
containing HPV16 whole genome (45113D) were purchased from the ATCC and
used for positive controls. Cervical samples from subjects with normal cytology
and a negative test for HPV DNA or DW were used for negative controls.
HPV DNA extraction The cervical scrape samples were collected using
cytobrush and the cells collected in 15 ml of sterile PBS (pH 8.0). After vortexing
the 15-ml tube to dissociate cells, and then centrifugation at 1,000–1,200g for
5 min, the cell pellet was resuspended in 200 ml of PBS. DNA was extracted
from the entire cervical sample by QIAamp DNA Blood Mini Kit according to
the manufacturer’s instructions and dissolved in 200 ml of distilled water.
Mass spectrometer external calibration External calibration is sufficient to
generate reliable MS results with RFMP genotyping methods. The ion flight
times were determined from accurate centroids of the calibrant ions and utilized
to produce a multi-point calibration equation. We recommend using 6mer
(1,762.2 Da)- and 16mer (4,881.2 Da)-unmodified oligonucleotides with masses
spanning the mass range of the analyte DNA.
EQUIPMENT SETUP
Liquid-handling robot All the liquid-dispensing steps including addition of
‘master mixes’ can be performed by hand or by liquid-handling robots.
Depending on the number of DNA samples to be analyzed, automatic-handling
robot may be used to ensure accurate pipetting and successive addition of
reagent in a proper order, avoiding human errors and contamination.
Oasis purification 96-well plates packed with 5 mg Oasis HLB resins in each
well were used; the solid-phase extraction procedure can be performed using the
manifold kit for Oasis HLB purification.
Mass analysis by MALDI-TOF Mass spectra are recorded with a Bruker Biflex
IV TOF mass spectrometer. Alternative mass spectrometers such as the Autoflex
or Ultraflex mass spectrometer (Bruker Daltonics) or other MALDI mass
spectrometers can also be used for our applications after optimization. For
optimization of detection parameters with alternative instruments, we recommend
using the standard oligonucleotides described earlier for external calibration.
The Biflex IV TOF mass spectrometer is equipped with a Scout MTP ion source.
Use either the MTP AnchorChip 400/384 TF targets or the microarray slides as
target plates and appropriate adapters that fit into the Scout MTP ion source. We
use MTP AnchorChip 400/384 TF targets for Oasis-purified samples. These
devices have 384 hydrophilic spots (400 mm in diameter). Data interpretation
and spectra acquisition were performed with the assistance of Genotools
software, used for administering sample preparation, defining critical data-
processing settings for peak picking and the calibration, and evaluating
reliability of spectra. A single offline genotyping event takes 2–3 s; accordingly
the spectra from a complete 384-well target can be analyzed in 13–20 min.
 PROTOCOL

PROCEDURE

PCR TIMING 60–90 min
1| Prepare the first round PCR mixture as follows:

Reagent Volume (ll)

10 PCR buffer 1.8
2 mM dNTPs 1.8
Forward primer mix (each 10 mM) 0.72
Reverse primer mix (each 2.5 mM) 0.94
ddH2O 10.0
Taq polymerase (5 U ml
1) 0.2
Template 4.0
© 2008 Nature Publishing Group http://www.nature.com/natureprotocols

m CRITICAL STEP To avoid potential contamination, use cotton-plugged tips, wear disposable gloves and aliquot all PCR reagents.
’ PAUSE POINT Products may be stored at this point at
20 1C for at least 1 month.
2| Transfer the reaction mixture to a thermocylcer programmed as described below.

Cycle number Denaturation Annealing Extension

1 5 min at 94 1C — —
2–39 15 s at 94 1C 15 s at 60 1C 30 s at 72 1C
40 — 5 min at 72 1C —

3| Add 1 ml of the first PCR product into a tube or a 96- or 384-well plates for the next second round PCR steps. The
remaining first PCR product can be stored at
20 1C for at least 1 month.

Reagent Volume (ll)

10 PCR buffer 1.8
2 mM dNTPs 1.8
PV-rfmpF primer (10 mM) 0.72
PV-rfmpR primer (10 mM) 0.72
ddH2O 11.76
Taq polymerase (5 U ml
1) 0.2
First PCR product 1.0

4| Transfer the reaction mixture to a thermocylcer and proceed as follows:

Cycle number Denaturation Annealing Extension

1 5 min at 94 1C — —
2–39 10 s at 94 1C 10 s at 45 1C 30 s at 72 1C
40 — 5 min at 72 1C —

Perform agarose gel electrophoresis to verify successful PCR amplification (optional).

’ PAUSE POINT Products may be stored at this point at
20 1C for at least 1 month.
? TROUBLESHOOTING


Restriction enzyme digestion TIMING 60 min
5| For enzyme digestion, prepare the reaction mixture as follows:

Reagent Volume (ll)

Second PCR product 18
ddH2O 8.7
10 NEB buffer 4 1
FokI (4 U ml
1) 0.25
BtsCI (20 U ml
1) 0.05

NATURE PROTOCOLS | VOL.3 NO.9 | 2008 | 1479

 PROTOCOL

6| Transfer the reaction mixture to a thermocycler and proceed as follows:

Cycle number Temperature

1 1 h at 37 1C
2 hold at 4 1C

’ PAUSE POINT Products may be stored at this point at
20 1C for a week.
? TROUBLESHOOTING

Preparation of prespotted MTP AnchorChip 400/384 TF targets  TIMING 40 min

7| Prepare a matrix stock solution as follows:
© 2008 Nature Publishing Group http://www.nature.com/natureprotocols

Reagent Volume and quantity

3-Hydroxypicolinic acid 35 mg
Ammonium citrate 7.14 mg
Acetonitrile (10% vol/vol) 1.0 ml

m CRITICAL STEP The matrix stock solution should be aliquoted and stored in the freezer for later use. Use fresh aliquots daily.
? TROUBLESHOOTING
8| Prepare a stock solution of oligonucleotide calibrant as follows:

Reagent Volume (ll)

6mer (200 mM, HPLC grade) 2
16mer (200 mM, HPLC grade) 10
HPLC-grade water 788

9| Prepare a matrix/calibrant mixture solution as follows:

Reagent Volume (ll)

Matrix stock solution 1.5
Calibrant stock solution 0.5
HPLC-grade water 1

10| Dispense 2.5 ml of matrix/calibrant mixture solution onto the hydrophilic anchors of the target by pipette or by a liquid
handler and let it dry for at least 30 min.


Desalting with Oasis HLB lElution plate TIMING 30 min
11| Equilibrate Oasis column with 300 ml acetonitrile, 900 ml of 0.1 M TEAA, pH 7.0, apply a vacuum and remove acetonitrile
and TEAA.
12| Add 70 ml of 0.1 M TEAA, pH 7.0, to the restriction digested sample to a final volume of 100 ml.

13| Load the sample onto the Oasis resins, applying a vacuum.
14| Wash the sample with 2.1 ml of 0.1 M TEAA, pH 7.0, applying a vacuum.

15| Wash the sample with 900 ml of demineralized water, applying a vacuum.
16| Elute samples with 100 ml of 70% (vol/vol) acetonitrile, applying a vacuum. Sample the eluates using 96-well plates.

17| Dry the elution plate at 115 1C for 75 min.

18| Resuspend the dried elutes in 10 ml of demineralized water.
19| Dispense 2 ml out of 10 ml of the solution onto the prespotted anchor chip plate prepared in Step 7.

1480 | VOL.3 NO.9 | 2008 | NATURE PROTOCOLS

 PROTOCOL

20| Let samples dry at 37 1C for 30 min and keep at room temperature (20–25 1C) for a while to cool down.
’ PAUSE POINT Anchor chip may be stored at this point at desiccator for 2 weeks.
21| Perform MALDI-TOF analysis.
? TROUBLESHOOTING


MALDI-TOF analysis TIMING B30 min per 384 samples
22| Apply the following operating voltages to MALDI-TOF MS workstation for signal collection: IS1 ¼ 20,000 kV, IS2 ¼ 18,250
kV, lens ¼ 9,400 kV, detector ¼ 1,550 kV.

23| Load XACQ program.

24| Place the probe in target plate and insert into the ion source.
© 2008 Nature Publishing Group http://www.nature.com/natureprotocols

25| Execute the desired XACQ parameter file with following setting points: 20–50 laser pulses and averaged transient digitizing.
26| Load XMASS program and execute GenoTools manager file.

27| Set the shot numbers at 10–15 times to be fired in the designated spot and laser attenuation at 40–60%, and fire the laser
using the commands in XACQ control panel. Move the laser on the other spots unless signal is satisfactory.

28| Save the data by XACQ control panel.

29| Click on the singleplex button of GenoTools manager for peak picking and calibration.

30| Print the result for data interpretation and visual inspection.
? TROUBLESHOOTING


Cleaning MALDI target plates TIMING 30 min
31| The AnchorChip target can be reused 50 times after wash. We recommend the following washing procedure before each
preparation: (i) wipe the target with a suitable solvent on a tissue (e.g., acetone); (ii) sonicate with 50% (vol/vol) methanol
for 5 min; (iii) rinse with methanol; (iv) rinse with ddH2O and (v) let the target dry before use. Though we found the cleaning
procedure very effective, we recommend specifying the positions of negative/positive controls and experimental samples in the
regenerated target plates.
! CAUTION Never use bases or acids, they can destroy the coating.

2,162.4 3,796.4 2,162.4 3,692.4 3,790.4

4,006.6
3,997.6 4,010.6
2,200.4 3,661.4 2,206.4
4,050.6

3,764.4
2,177.4 3,740.4 2,177.4
2,176.4
3,991.6
4,022.6
r.i.
r.i.

3,691.4
2,222.4 3,715.4 4,034.6
4,018.6

3,746.4
3,796.4
3,708.4
2,177.4 2,162.4
2,215.4 3,997.6 4,034.6
3,692.4 4,003.6
2,191.4 4,006.6
2,000 2,500 3,000 3,500 4,000 4,500
2,000 2,500 3,000 3,500 4,000 4,500 m/z
m/z
Figure 3 | Matrix-assisted laser desorption/ionization mass spectra of the
Figure 2 | Matrix-assisted laser desorption/ionization mass spectra of the restriction fragment mass polymorphism assays of three nonhigh-risk type
restriction fragment mass polymorphism assays of three high-risk type human human papillomaviruses (HPVs) in negative-ion mode. Top, analysis of HPV11
papillomaviruses (HPVs) in negative-ion mode. Top, analysis of HPV52; (probable high risk); middle, analysis of HPV53 (low risk); bottom, analysis
middle, analysis of HPV18; bottom, analysis of HPV16 (see Table 2 for of HPV MM8 (not established risk) (see Table 2 for interpretation of results).
interpretation of results). x and y axes represent relative peak intensity (r.i.) x and y axes represent relative peak intensity (r.i.) and mass-to-charge ratio
and mass-to-charge ratio (m/z), respectively. (m/z), respectively.

NATURE PROTOCOLS | VOL.3 NO.9 | 2008 | 1481

 PROTOCOL

? TROUBLESHOOTING
Troubleshooting advice can be found in Table 1.

TABLE 1 | Troubleshooting table.

Problem Solution
DNA extraction: no PCR products, as assessed by agarose gel electrophoresis Check the quality of the DNA preparations by PCR using b-globin
primers40. If the DNA preparations are b-globin PCR-negative, repeat
DNA extraction

PCR: desired band is weak or is not the dominant product, as assessed Optimization of annealing temperatures must be done to resolve
by agarose gel electrophoresis problems. Check the integrity of primers by mass spectrometry or
other analytical tools such as HPLC; if bad, acquire new primers. Try
© 2008 Nature Publishing Group http://www.nature.com/natureprotocols

using different lots of DNA polymerases. Moreover, we recommend

checking the quality of the DNA preparations as described above

Restriction enzyme digestion: no shift of PCR product band, as assessed Check the activity of enzymes with quality-validated PCR product
by agarose gel electrophoresis with the recognition sites; replace all reagents and enzymes. Make
sure that the enzymes and reagents have been added correctly

Oasis purification: no or low signal even with sufficient amount of Check solutions and vacuum. Use oligonucleotides diluted in
PCR or restriction enzyme digestion products, as assessed by matrix-assisted reaction solution to ensure functionality of the plate
laser desorption/ionization–time of flight mass spectrometry (MS)

MS: no signal with a good PCR product, high background or low signal Check the instrument for possible error messages and try increasing
of size standard laser power. Try desalting the samples again before application. New
matrix must be prepared or the target plates must be cleaned more
thoroughly and tested with ‘proven’ oligonucleotide standards

False positive signal in negative controls Replace all reagents and the controls used. Clean up the working
areas and ventilation

ANTICIPATED RESULTS
From the LANL HPV database sequences, we obtained a total of 74 combined mass patterns for 42 anogenital HPV and 32
nonanogenital HPV genotypes with distinctive mass values (see Table 2 and Supplementary Table 1 online). The 42 anogenital
HPV genotypes were assigned to 14 high-risk (H), 15 low-risk (L), 3 probable high-risk (PH) and not established-risk (NE)

2,162.4 3,990.6

3,755.4 4,013.6
2,177.4
3,700.4 3,796.4 4,050.6
2,206.4 4,059.6
2,200.4 3,621.4
r.i.
r.i.

2,191.4
3,653.44 3,781.4

3,749.4
2,162.4 4,059.6
2,186.4 3,761.4 2,177.4 4,006.6
2,191.4 3,707.4
2,206.4 3,668.4 3,990.6 4,010.6
4,022.6
4,074.6 2,000 2,500 3,000 3,500 4,000
m/z
2,000 2,500 3,000 3,500 4,000 4,500
m/z Figure 5 | Rescue experiment for a case with a failure in PCR amplification
step. Top panel shows agarose gel (left lane, positive control; right
Figure 4 | Matrix-assisted laser desorption/ionization mass spectra of the lane, no PCR product) and corresponding matrix-assisted laser desorption/
restriction fragment mass polymorphism assays of mixed genotype infections ionization–time of flight (MALDI-TOF) spectra of a patient with
in negative-ion mode. Top, analysis of multiple infections with HPV45 and cervical lesion. Bottom panel shows agarose gel (left lane, positive
HPV 66 (highlighted with shaded masses); bottom, multiple infections with control; right lane, 84-bp band) and corresponding MALDI-TOF spectra
HPV51 and HPV 61 (highlighted with shaded masses) (see Table 2 for from the repeated DNA extractions from the same patient. x and y axes
interpretation of results). x and y axes represent relative peak intensity (r.i.) represent relative peak intensity (r.i.) and mass-to-charge ratio (m/z),
and mass-to-charge ratio (m/z), respectively. respectively.

1482 | VOL.3 NO.9 | 2008 | NATURE PROTOCOLS

 PROTOCOL

TABLE 2 | Expected masses of RFMP assays of anogenital HPV genotypes and their corresponding risks.
Calculated molecular mass (Da)
Genotype Genotype specific sequences Risk
7mer 7mer 12mer 12mer 13mer 13mer
HPV16 AATGGCATTTGTTGGGGTAACCAACTATTT 2177.4 2191.4 3692.4 3796.4 4006.6 4003.6 H
HPVI8 –––––TG––––C–––CA–––T–––T––––– 2177.4 2222.4 3715.4 3740.4 3991.6 4018.6 H
HPV31 –––––T–––––––––––C––T––GT––––– 2177.4 2206.4 3661.4 3796.4 3990.6 4034.6 H
HPV33 –––––T–––––––––––C––T––GG––––– 2177.4 2206.4 3637.4 3796.4 3990.6 4059.6 H
HPV35 –––––T–––––––––A––––––––T–G––– 2162.4 2206.4 3691.4 3780.4 3990.6 4034.6 H
HPV39 –––––T––A––––––CA–––T–––T––––– 2177.4 2215.4 3715.4 3755.4 3981.6 4018.6 H
HPV45 –––––T–––––––––CA–––T––GT-G––– 2162.4 2206.4 3700.4 3755.4 3990.6 4050.6 H
HPV51 –––––––––––C–––AAC––T––G––T––– 2186.4 2191.4 3707.4 3749.4 4022.6 4010.6 H
© 2008 Nature Publishing Group http://www.nature.com/natureprotocols

HPV52 ––––––––A––––––––C––T–GT-–G––– 2162.4 2200.4 3661.4 3796.4 3997.6 4050.6 H

HPV56 –––––––––––C––––––––T–––T––––– 2177.4 2191.4 3660.4 3796.4 4022.6 4018.6 H
HPV58 –––––––––––C–––––C––T––GT––––– 2177.4 2191.4 3661.4 3781.4 4022.6 4034.6 H
HPV59 –––––T––A––––––CAC––T–––T-G––– 2162.4 2215.4 3731.4 3740.4 3981.6 4034.6 H
HPV68i –––––T–––––––––CA–––T–––T––––– 2177.4 2206.4 3715.4 3755.4 3990.6 4018.6 H
HPV82 (MM4) –––––––––––C–––AA–––T––G––T––– 2186.4 2191.4 3691.4 3764.4 4022.6 4010.6 H
HPV6 –––––T––––––––––––––T–––––G––– 2162.4 2206.4 3676.4 3811.4 3990.6 4019.6 L
HPV11 –––––T–––––C–––––A–––––CT-G––– 2162.4 2206.4 3692.4 3790.4 4006.6 4010.6 L
HPV34 –––––––––––C–––CA–––T–––––G––– 2162.4 2191.4 3731.4 3740.4 4022.6 4019.6 L
HPV40 ––––––––A––––TT––C––T––GT––––– 2177.4 2200.4 3709.4 3746.4 3997.6 4034.6 L
HPV42 –––––T––A––––––––A––T––G–––––– 2177.4 2215.4 3652.4 3820.4 3981.6 4019.6 L
HPV43 –––––––––––––TT––G––T––GT–G––– 2162.4 2191.4 3669.4 3786.4 4006.6 4050.6 L
HPV44 –––––T–––––––––––A––T––GT––––– 2177.4 2206.4 3636.4 3820.4 3990.6 4034.6 L
HPV54 –––––T–––––––––––C-–T-–GG-G––– 2162.4 2206.4 3676.4 3796.4 3990.6 4034.6 L
HPV55 –––––T–––––––––––G––T-–GT––––– 2177.4 2206.4 3621.4 3836.4 3990.6 4034.6 L
HPV61 –––––T–––––––––TT–––TG––T-G––– 2162.4 2206.4 3668.4 3761.4 3990.6 4074.6 L
HPV70 –––––––––––––––CA––––––GT-G––– 2162.4 2191.4 3716.4 3740.4 4006.6 4050.6 L
HPV72 ––––––––C––––––TT–––TG-G––T––– 2186.4 2176.4 3669.4 3761.4 4022.6 4050.6 L
HPV8l –––––––––––––––TT–––TG––A-G––– 2162.4 2191.4 3659.4 3761.4 4006.6 4083.6 L
HPV83 (MM7) –––––––––––––––TT–––TG-GT––––– 2177.4 2191.4 3653.4 3761.4 4006.6 4074.6 L
HPV89 (CP6108) –––––T–––––––––TT–––TG-GT-G––– 2162.4 2206.4 3653.4 3761.4 3990.6 4090.6 L
HPV26N –––––T––C––––––––C––T–––T-G––– 2162.4 2191.4 3676.4 3796.4 4006.6 4034.6 PH
HPV53 ––––––––C––––––AAC––T––GT––––– 2177.4 2176.4 3691.4 3764.4 4022.6 4034.6 PH
HPV66 ––––––––A––C––––––––T––GG––––– 2177.4 2200.4 3621.4 3796.4 4013.6 4059.6 PH
HPV13 –––––T––A––––––––C––T––CT–G––– 2162.4 2215.4 3701.4 3796.4 3981.6 4010.6 NE
HPV30 –––––––––––––––––C––––-GG––––– 2177.4 2191.4 3653.4 3781.4 4006.6 4059.6 NE
HPV57 ––––––––G––C–––––C––T-GGA–C––C 2202.4 2216.4 3637.4 3781.4 3998.6 4035.6 NE
HPV62 –––––T–––––––––TT–––TG–-––G––– 2162.4 2206.4 3684.4 3761.4 3990.6 4059.6 NE
HPV64 –––––A–––––––––CA–––T–––––G––– 2162.4 2215.4 3731.4 3755.4 3981.6 4019.6 NE
HPV67 –––––T––A––C––––––––T–––A––––– 2177.4 2215.4 3651.4 3796.4 3997.6 4027.6 NE
HPV69 –––––––––––––––––C––––––T-G––– 2162.4 2191.4 3692.4 3781.4 4006.6 4034.6 NE
HPV74 –––––T––––––––––––––T–––T––––– 2177.4 2206.4 3660.4 3811.4 3990.6 4018.6 NE
HPV84 (MM8) –––––T––A––C–––TT–––T–––T-G––– 2162.4 2215.4 3708.4 3746.4 3997.6 4034.6 NE
HPV90 –––––T––C––C––––––––T––G––T––– 2186.4 2191.4 3661.4 3796.4 4022.6 4010.6 NE
H, high risk; L, low risk; NE, risk is not established yet; PH, probable high risk.

types according to their reported carcinogenicities (Table 2). Anticipated results for RFMP assays of representative high-risk
types and nonhigh-risk (probable high, low and not established) types are presented in Figures 2 and 3, respectively.
Mixed genotype infection can be detected by recognition of peak combinations matched to predicted mass patterns of more
than two genotypes, as shown in Figure 4. The presence of peak patterns that cause a deviation from the molecular mass
pattern predicted from up-to-date databases may reflect potential genotype variants; thus we recommend that samples with
aberrant peaks be sequenced to verify the presence of a variation and to determine the exact nucleotide change. Rarely,
samples with negative results in PCR amplification can be rescued with repetitive HPV DNA extraction (Fig. 5). In case of
discrepancy between genotyping result and cytology, we recommend repeating the analysis from DNA extraction step with
fresh swab samples.

NATURE PROTOCOLS | VOL.3 NO.9 | 2008 | 1483

 PROTOCOL
Accurate determination of ion masses is facilitated by high mass resolution and low parts per million precision in the peak
centroid positions for the raw flight time data. These are necessary features for resolving adjacent peaks, particularly with
increasing oligonucleotide fragment size. Because the absolute error, on average, was o+0.5 Da and the width of the mass
peak at the half maximum was as low as 1–4 Da for 2–6-kDa mass ranges in our experimental setup, discrimination between
multiple fragments of extremely similar masses, such as 13mer of HPV 16 (4003.6 and 4006.6; see Fig. 2) and 7mer of HPV 53
(2177.4 and 2176.4; see Fig. 3), is easily made possible by inspection of multiple split view windows with different zooming
mass ranges.
Note: Supplementary information is available via the HTML version of this article.
Published online at http://www.natureprotocols.com/
© 2008 Nature Publishing Group http://www.nature.com/natureprotocols
Reprints and permissions information is available online at http://npg.nature.com/
reprintsandpermissions/
1. Muñoz, N. et al. Epidemiologic classification of human papillomavirus types
associated with cervical cancer. N. Engl. J. Med. 348, 518–527 (2003).
2. Chow, V.T., Loh, E., Yeo, W.M., Tan, S.Y. & Chan, R. Identification of multiple
genital HPV types and sequence variants by consensus and nested type-specific
PCR coupled with cycle sequencing. Pathology 32, 204–208 (2000).
3. Laconi, S. et al. One-step detection and genotyping of human papillomavirus in
cervical samples by reverse hybridization. Diagn. Mol. Pathol. 10, 200–206
(2001).
4. Human papillomavirus testing for triage of women with cytologic evidence of low-
grade squamous intraepithelial lesions: baseline data from a randomized trial. The
Atypical Squamous Cells of Undetermined Significance/Low-Grade Squamous
Intraepithelial Lesions Triage Study (ALTS) Group. J. Natl. Cancer Inst. 92,
397–402 (2000).
5. Terry, G. et al. Detection of high-risk HPV types by the hybrid capture 2 test.
J. Med. Virol. 65, 155–162 (2001).
6. Schiffman, M.H. et al. Epidemiologic evidence showing that human
papillomavirus infection causes most cervical intraepithelial neoplasia. J. Natl.
Cancer Inst. 85, 958–964 (1993).
7. Walboomers, J.M. et al. Human papillomavirus is a necessary cause of invasive
cervical cancer worldwide. J. Pathol. 189, 12–19 (1999).
8. Bulkmans, N.W., Rozendaal, L., Voorhorst, F.J., Snijders, P.J. & Meijer, C.J. Long-
term protective effect of high-risk human papillomavirus testing in population-
based cervical screening. Br. J. Cancer 92, 1800–1802 (2005).
9. Clavel, C. et al. Negative human papillomavirus testing in normal smears selects a
population at low risk for developing high-grade cervical lesions. Br. J. Cancer 90,
1803–1808 (2004).
10. Haff, L.A. & Smirnov, I.P. Single-nucleotide polymorphism identification assays
using a thermostable DNA polymerase and delayed extraction MALDI-TOF mass
spectrometry. Genome Res. 7, 378–388 (1997).
11. Laken, S.J. et al. Genotyping by mass spectrometric analysis of short DNA
fragments. Nat. Biotechnol. 16, 1352–1356 (1998).
12. Ross, P., Hall, L., Smirnov, I.P. & Haff, L. High level multiplex genotyping by
MALDI-TOF mass spectrometry. Nat. Biotechnol. 16, 1347–1351 (1998).
13. Abdi, F., Bradbury, E.M., Doggett, N. & Chen, X. Rapid characterization of DNA
oligomers and genotyping of single nucleotide polymorphism using nucleotide-
specific mass tags. Nucleic Acids Res. 29, 61 (2001).
14. Wolfe, J.L. et al. A genotyping strategy based on incorporation and cleavage of
chemically modified nucleotides. Proc. Natl. Acad. Sci. USA 99, 11073–11078
(2002).
15. Mauger, F. et al. SNP genotyping using alkali cleavage of RNA/DNA chimeras and
MALDI time-of-flight mass spectrometry. Nucleic Acids Res. 34, e18 (2006).
16. Sauer, S., Reinhardt, R., Lehrach, H. & Gut, I.G. Single-nucleotide polymorphisms:
analysis by mass spectrometry. Nat. Protoc. 1, 1761–1771 (2006).
17. Stuyver, L. et al. Line probe assay for monitoring drug resistance in hepatitis B
virus-infected patients during antiviral therapy. J. Clin. Microbiol. 38, 702–707
(2000).
18. Stuyver, L., Wyseur, A., van Arnhem, W., Hernandez, F. & Maertens, G. Second-
generation line probe assay for hepatitis C virus genotyping. J. Clin. Microbiol. 34,
2259–2266 (1996).
19. Kim, H.S. et al. Evaluation of methods for monitoring drug resistance in chronic
hepatitis B patients during lamivudine therapy based on mass spectrometry and
reverse hybridization. Antivir. Ther. 10, 441–449 (2005).
1484 | VOL.3 NO.9 | 2008 | NATURE PROTOCOLS
20. Hong, S.P. et al. Detection of hepatitis B virus YMDD variants using mass
spectrometric analysis of oligonucleotide fragments. J. Hepatol. 40, 837–844
(2004).
21. Kim, Y.J. et al. Population genotyping of hepatitis C virus by matrix-assisted laser
desorption/ionization time-of-flight mass spectrometry analysis of short DNA
fragments. Clin. Chem. 51, 1123–1131 (2005).
22. Szybalski, W., Kim, S.C., Hasan, N. & Podhajska, A.J. Class-IIS restriction
enzymes-a review. Gene 100, 13–26 (1991).
23. Lee, C.H. et al. Predominance of hepatitis B virus YMDD mutants is prognostic of
viral DNA breakthrough. Gastroenterology 130, 1144–1152 (2006).
24. Yeon, J.E. et al. Resistance to adefovir dipivoxil in lamivudine-resistant chronic
hepatitis B patients treated with adefovir dipivoxil. Gut 55, 1488–1495 (2006).
25. Paik, Y.H. et al. Clinical impact of early detection for YMDD mutant on the
outcomes of long-term lamivudine therapy in patients with chronic hepatitis B.
Antivir. Ther. 11, 447–455 (2006).
26. Lee, Y.S. et al. Increased risk of adefovir resistance in patients with lamivudine-
resistant chronic hepatitis B after 48 weeks of adefovir dipivoxil monotherapy.
Hepatology 43, 1385–1391 (2006).
27. Chung, H.J. et al. Comparison of efficacy of human papilloma virus genotyping
assays using restriction fragment mass polymorphism and DNA chip analysis in
patients with abnormal pap smear and uterine cervical cancer. Korean J. Pathol.
40, 439–347 (2006).
28. Lee, E.H. et al. Human papilloma virus genotyping assay using restriction
fragment mass polymorphism analysis, and its comparison with sequencing and
hybrid capture assays. Korean J. Lab. Med. 27, 62–68 (2007).
29. Ahn, S.H. et al. Association of genetic variations in CCR5 and its ligand, RANTES
with clearance of hepatitis B virus in Korea. J. Med. Virol. 78, 1564–1571 (2006).
30. Hwang, S.H., Oh, H.B., Choi, S.E., Hong, S.P. & Yoo, W. Effective screening of
informative single nucleotide polymorphisms using the novel method of
restriction fragment mass polymorphism. J. Int. Med. Res. 35, 827–835 (2007).
31. Sohn, S.K. et al. Efficacy of dose escalation of imatinib mesylate in patients with
cytogenetic or hematologic resistance. Leuk. Lymphoma 48, 1659–1661 (2007).
32. Smirnov, I.P., Hall, L.R., Ross, P.L. & Haff, L.A. Application of DNA-binding
polymers for preparation of DNA for analysis by matrix-assisted laser desorption/
ionization mass spectrometry. Rapid Commun. Mass Spectrom. 15, 1427–1432
(2001).
33. Little, D.P. et al. MALDI on a chip: analysis of arrays of low-femtomole to
subfemtomole quantities of synthetic oligonucleotides and DNA diagnostic
products by a piezoelectric pipet. Anal. Chem. 69, 4540–4546 (1997).
34. Shahgholi, M., Garcia, B.A., Chiu, N.H., Heaney, P.J. & Tang, K. Sugar additives for
MALDI matrices improve signal allowing the smallest nucleotide change (A:T) in a
DNA sequence to be resolved. Nucleic Acids Res. 29, e91 (2001).
35. Wu, K.J., Steding, A. & Becker, C.H. Matrix-assisted laser desorption time-of-
flight mass spectrometry of oligonucleotides using 3-hydroxypicolinic acid as an
ultraviolet-sensitive matrix. Rapid Commun. Mass Spectrom. 7, 142–146 (1993).
36. Kim, Y., Hurst, G.B., Doktycz, M.J. & Buchanan, M.V. Improving spot homogeneity
by using polymer substrates in matrix-assisted laser desorption/ionization mass
spectrometry of oligonucleotides. Anal. Chem. 73, 2617–2624 (2001).
37. Gravitt, P.E. et al. Improved amplification of genital human papillomaviruses.
J. Clin. Microbiol. 38, 357–361 (2000).
38. Kwok, S. & Higuchi, R. Avoiding false positives with PCR. Nature 339, 237–238
(1989).
39. Wright, T.C. et al. 2001 Consensus Guidelines for the management of women with
cervical cytological abnormalities. JAMA 287, 2120–2129 (2002).
40. Fontaine, V. et al. Evaluation of combined general primer-mediated PCR
sequencing and type-specific PCR strategies for determination of human
papillomavirus genotypes in cervical cell specimens. J. Clin. Microbiol. 45,
928–934 (2007).