Mol Biotechnol (2013) 54:1004–1009
DOI 10.1007/s12033-013-9652-x
RESEARCH
Development and Padronization of Three Multiplex PCRs
for the Diagnosis of Chlamydia trachomatis, Toxoplasma gondii,
Herpes Simplex Viruses 1 and 2, and Cytomegalovirus
Danielle A. G. Zauli • Carla Lisandre Paula de Menezes
Cristiane Lommez de Oliveira
Published online: 24 February 2013
Ó Springer Science+Business Media New York 2013
Abstract To develop multiplex PCRs (mPCRs) that
allows simultaneous diagnosis of the infectious agents
Chlamydia trachomatis, Toxoplasma gondii, HSV 1/2, and
Cytomegalovirus (CMV). The study included patients with
clinical suspicion of these agents, and clinical samples
were blood, cerebrospinal fluid, urine, vaginal swabs, and
amniotic fluid. After the extraction of DNA, this was used
as a template in amplification by PCR of selected genes.
The following conditions were tested: primer concentra-
tion, MgCl2 concentration, and annealing temperature.
Three mPCRs were developed: multiplex I (CMV, HSV
1/2), multiplex II (CMV, HSV 1/2, T. gondii), and multi-
plex III (C. trachomatis, T. gondii, HSV 1/2, and CMV).
The primer pairs used were shown to be specific for each
infectious agent, and the specificity of mPCR assays was
100 %. Both the reactions of the monoplex PCR and
mPCR produced a detection limit of 2 9 10-5 to 6 9 10-7
ng/ll of different DNAs. Upon conclusion, amplified
products of expected size were obtained in 3 different
reactions, and all the infectious agents were detected
simultaneously in each mPCR. The concordant results of
the study suggest that mPCR can be a powerful tool to
improve the diagnostics of infectious diseases.
Keywords Multiplex PCR  Diagnosis 
Infectious diseases
D. A. G. Zauli (&)  C. L. P. de Menezes  C. L. de Oliveira
Departamento de Pesquisa e Desenvolvimento, Biocod
Biotecnologia Ltda, Belo Horizonte, MG, Brazil
e-mail: danielle@biocod.com.br
123
•
Introduction
The herpes virus is a ubiquitous virus in the human pop-
ulation and often remains inactive inside the body after a
primary infection and is usually reactivated in immuno-
suppressed individuals. Both primary and recurrent infec-
tions can lead to infections and diseases of the central
nervous system [1, 2]. The diagnosis of viral infections has
been hampered for many years due to the cost and labo-
ratory time. Early diagnosis of encephalitis/encephalopathy
virus is important to insure appropriate treatment and to
exclude other diseases with a similar presentation. Human
cytomegalovirus (HCMV) infection is a major cause of
morbidity in immunosuppressed patients and transplant
recipients together with HIV-infected patients [3, 4].
Besides virology, the diagnosis of infections due to fas-
tidious bacteria has been greatly improved from molecular
detection. Many of these fastidious bacteria have public
health implications such as Chlamydia trachomatis. The
prevalence of C. trachomatis has been identified in various
areas of the world, and studies done in different countries
show that C. trachomatis is the main bacterial agent of
sexually transmitted diseases [5]. Parasitological diagnosis
has also been improved by molecular methods since most
parasites are not cultured in routine laboratory settings, and
therefore, diagnosis relies mostly on relatively less sensi-
tive microscopy or serology [6]. Toxoplasma gondii is
widely distributed in the human population and is esti-
mated to affect more than one billion individuals around
the world. The toxoplasmosis is a dangerous disease when
contracted in the uterus, and also for patients with immu-
nodeficiency, especially if innate immunity is involved
(AIDS patients, patients with leukemia, and transplant
patients) [7, 8]. Nucleic acid-based diagnostics of infec-
tious diseases involve detection and characterization of
Mol Biotechnol (2013) 54:1004–1009
both bacterial and viral infections by DNA/RNA methods,
mainly with the applications of polymerase chain reaction
(PCR) [9, 10]. PCR technology has therefore improved the
detection of a number of these infectious agents, and PCR
assays rapidly and precisely detect the presence of micro-
organisms directly from clinical specimens [11]. Many
methods have been described for the quantitative analysis
of nucleic acid and the real-time PCR is a powerful tool for
quantitative analysis. However, in diagnostic laboratories
and for qualitative analysis, the use of conventional PCR is
limited by cost and sometimes the availability of adequate
test sample volumes. To overcome these shortcomings and
also to increase the diagnostic capacity of PCR, a variant
termed multiplex PCR (mPCR) has been described. Mul-
tiplex PCR has been successfully applied in many areas of
nucleic acid diagnostics and, in the field of infectious
diseases; this technique has been shown to be a valuable
method for the identification of viruses, bacteria, fungi,
and/or parasites [12]. As far as possible, identical prepa-
ration and conditions were employed to facilitate use in a
routine diagnostic laboratory and to allow rapid design and
implementation of additional mPCR tests. The aim of this
study was to develop a test for simultaneous detection of
five organisms including C. trachomatis, cytomegalovirus,
T. gondii, herpes simplex viruses 1 and 2, all five of great
significance with regards to pregnant women, newborn
babies, and immunosuppressed patients and responsible for
infectious diseases in humans, using the technique of
mPCR.
Materials and Methods
Clinical Samples
A total of 315 clinical samples from patients with clinical
suspicion of these etiologic agents were tested for the
presence of C. trachomatis, T. gondii, HSV 1/2 and CMV
by the mPCRs and their corresponding monoplex PCRs.
The clinical samples were included blood, urine, cerebro-
spinal fluid, vaginal swabs, and amniotic fluid. The study
was approved by the Ethical Committee of Research of the
Federal University of Juiz de Fora (CEP/UFJF, protocol no.
1969.028.2010). The positive controls used were CMV
strain AD169, T. gondii strain RH, and clinical isolates
from patients with HSVI, HSV2, and Chlamydia.
Selection and Design of Primers for mPCR Assays
The sequences of the primer sets used in the mPCR assays
are listed in Table 1. The primers were selected from
published papers, and some primers were modified to
match the desired characteristics. The Primer3 program
1005
was used for designing these primers based on the
sequence of the gene obtained from GenBank.
DNA Extraction
DNA was extracted from all control and clinical samples as
previously described [13]. The concentration and quality of
the extracted DNA were obtained by spectrophotometry
(Nanovue GE Healthcare) and by amplification of a frag-
ment of the gene coding for the aminolevulinate delta-
synthase 1 (internal control) (No. GenBank NM 000688)
[14].
Multiplex PCRs Assays
Three mPCRs were designed for this study: multiplex I
(CMV, HSV 1/2 and internal control), multiplex II
(T. gondii, CMV, HSV 1/2, and internal control), and
multiplex III (C. trachomatis, T. gondii, CMV, HSV 1/2,
and internal control). The isolated DNA from each of the
infectious agents was used as a template for mPCR, and all
reactions were performed using a 10 ll reaction mixture.
The reactions were in accordance with the following
schedule protocol: an initial denaturation and polymerase
activation at 95 °C for 10 min, followed by 35 cycles of
denaturation at 95 °C for 1 min, primer annealing at 60 °C
for 1 min, and extension at 72 °C for 2 min. A final
extension step of 10 min at 72 °C was used for the last
cycle and 4 °C indefinitely. PCR products were visualized
on 6 % polyacrilamide gels with silver nitrate as previously
described [15].
Optimization of Multiplex PCR
To optimize the conditions of mPCRs, the following con-
ditions were tested: primer concentrations (0.05, 0.1
and 0.2 lmol), MgCl2 concentration (1.5, 2, 2.5 mmol),
annealing temperature (55, 60, 62, and 63 °C), and com-
parison of different types of enzymes (Taq Platinum and
Accuprimer from Invitrogen, PHT’s Phoneutria, Applied
Biosystems AmpliTaq Gold, and Taq polymerase from
Promega).
Specificity and Sensitivity
In order to confirmed the specificity of the primers selected
first, a BLAST was carried out using NCBI Nucleotide
BLAST software. Then, control DNA each infectious agent
was used as a template in monoplex PCRs with each spe-
cific primer.
123
1006 Mol Biotechnol (2013) 54:1004–1009

Table 1 Oligonucleotide used in this study

Infectious agents Code Oligonucleotide sequence (50 –30 ) Targets products Amplicons References
(bp)

Chlamydia HL 1 50 TAGAGATAGGAAACCAACTC 30 Cryptic plasmid 512 [5]

trachomatis HL2 0
5 CTCGGGTTAATGTTGCATGA 3 0

Toxoplasma gondii Toxo F 50 GATCAGAAAGGAACTGCATCC 30 Bl gene 200 [6]

Toxo R 50 TT AA AGCGTTC GTGGTC A AC 30
Herpes simplex virus 1 H1P32 50 TGGGACACATGCCTTCTTGG 30 RL2 gene 147 [1]
H1M32 50 ACCCTTAGTCAGACTCTGTTACTTACCC
30
Herpes simplex virus 2 HSV II F 50 GTACAGACCTTCGGAGG 30 UL28 gene 232 This study
HSV II R 50 CGCCCGCTTCATCATGGGC 30
Cytomegalovirus LA 1 50 CGCAACCTGGTGCCCATGG 30 gp64 late antigen 136 [19] [4]
LA 2 0
5 CGTTTGGGTTGCGCAGCGGG 3 0 Gene

After the singleplex PCR for each infectious agent, the
control DNA bands were excised, purified from poly-
acrylamide gels by using the ‘‘crush and soak’’ method
[13]. Following, the control DNA bands were quantified by
spectrophotometry (Nanovue GE Healthcare) and were
serially diluted 10-fold to determine the smallest concen-
tration of each organism, which was expressed as nano-
grams per microliter of DNA, in a sample that can
accurately be measured by an assay The lowest DNA
concentration that produced a visible band was considered
the detection limit of this assay. The results were compared
with the multiplex PCR reaction to insure that there is no
cross amplification between them.
Results
Selection and Design of Primers for mPCR Assays
The primers used in this study are shown in Table 1. Due to
difficulties in obtaining a more reproducible amplification
of DNA isolated from HSV type 2 with the primers in the
literature, a pair of specific primers for this virus was
designed exclusively for use in this study. All the primers
used in this study had a satisfactory performance in
mPCRs, generating products of different sizes that can be
distinguished in electrophoresis gels.

Sequencing Analysis of mPCR Products Optimization of mPCR

To confirm the identity of the infectious agent, DNA
sequence analyses of the amplicons were performed [16].
In brief, DNA polymerase I is used to extend the primer
oligonucleotide and copy the template in the presence of
the four deoxyribotriphosphates, one of which is labeled
with P32. This sequencing is relatively rapid and simple
alternative procedure for deducing sequences by primed
synthesis with DNA polymerase. Each sequence was then
compared with already known sequences by sequence
alignment using the BLAST program.
Evaluating the Effectiveness of the Proposed
Diagnostic Method
To demonstrate the efficiency of mPCRs, clinical samples
from patients with clinical symptoms of the diseases
examined in this study were tested in monoplex PCRs and
mPCRs, and the results were compared with results
obtained in the corresponding monoplex reactions.
DNA isolated from each infectious agent was used as a
template for mPCRs. The following conditions were tested:
primer concentration, MgCl2 concentration, and compari-
son between different types of Taq polymerase enzymes.
We also tested different annealing temperatures 55, 60, 62,
and 63 °C and verified that 60 °C was the optimum tem-
perature for a better amplification of the DNA target.
Furthermore, AmpliTaq Gold Star polymerase (Applied
Biosystems) provided better results than all the others
enzymes. After optimization of amplification conditions for
each test, the ideal cycling for the three reactions was the
following: a 10 ll reaction mixture containing 50–100 ng/
ll template DNA, 0.1 lmol/l primer mixture, 1 lmol/l
deoxynucleoside triphosphates, 1 ll of 109 buffer, 2 mmol/l
MgCl2 and Gold Star Taq polymerase, using the following
cycling protocol: an initial denaturation and polymerase
activation step for 10 min at 95 °C, followed by 35 cycles
of denaturation 95 °C for 1 min, primer annealing 60 °C
for 1 min, and extension at 72 °C for 2 min. A final

123
Mol Biotechnol (2013) 54:1004–1009
extension step of 10 min at 72 °C was used for the last
cycle.
mPCRs Assays
According to the clinical characteristics of each pathogen
and the type of clinical sample where the same agent can
be detected, 3 mPCR were developed: (i) Multiplex I,
infectious agents of which to be detected are CMV, HSV
type 1 and type 2, (ii) Multiplex II, infectious agents of
which to be detected are CMV, HSV type 1 and type 2, T.
gondii, and (iii) Multiplex III, infectious agents of which to
be detected are C. trachomatis, T. gondii, HSV type 1 and
type 2, and CMV.
Fig. 1 Electrophoresis on a 6 % polyacrylamide gel of the products of
multiplex PCR reactions; a Multiplex I (Lane HSV I; Lane HSV II;
Lane CMV); b Multiplex II (Lane Tox; Lane CMV; Lane HSV I; Lane
HSV II); c Multiplex III (Lane CMV; Lane HSV II; Lane HSV I; Lane
1007
Specificity and Sensitivity
The primers were selected from the published literature or
designed for this study in way to include the infectious
agents, and all the primers were annealed with equal effi-
ciency in the amplification conditions. Consequently, all
the infectious agents were detected by three developed
mPCRs (Fig. 1). Regarding the analysis of the specificity,
it was proved that the primers do not attach to any other
sequences. Moreover, the comparison of results of mono-
plex PCR with each multiplex assay showed that primer
pairs used were specific for each infectious agent, and the
specificity of mPCR assays was 100 % (data not shown).
The limits of detection of the both reactions of the
Tox; Lane Chla). M Size marker (50 bp ladder); IC internal control
(99 bp); N negative control. The amplicon sizes are as follows: HSV 1,
147 bp; HSV 2, 232 bp; CMV, 136 bp; T. gondii, 200 bp; C.
trachomatis, 512 bp
123
1008 Mol Biotechnol (2013) 54:1004–1009

monoplex PCR and mPCR were detected at the concen-
tration of 2 9 10-5 to 6 9 10-7 ng/ll of different target
DNAs (data not shown).
Evaluating the Effectiveness of the Proposed
Diagnostic Method
After optimizing the amplification conditions for each
assay and direct sequence analysis confirmed that the
infectious agents, we detected (data not shown). Clinical
samples from patients with clinical symptoms of the dis-
eases studied were tested, and the results were compared
with results obtained in the corresponding monoplex
reactions (Table 2). It was found that the results obtained
using the mPCR corresponded to that obtained by mono-
plex PCR. According to the result of Fig. 1, amplified
products of expected size were obtained in three different
reactions and all the infectious agents were detected
simultaneously in each mPCR.
Discussion
PCR is a powerful toll for detecting minute amount of
pathogen nucleic acids of as an indication of infection. This
technology is particularly useful in the field of diagnosis of
infectious diseases; however, most of the present diag-
nostic methods target a single pathogenic agent. Tests for
multiple agents using multiple primers in PCR reactions
are an innovation that offers significant benefits in cost,
time, and accuracy of diagnoses [16]. In this study, 3
mPCRs were developed to simultaneously detect and
identify DNA from 5 infectious agents (C. trachomatis,
T. gondii, HSV 1/2 and CMV). The technique used allowed
the detection of pathogenic DNA extracted from a wide
variety of clinical specimens such as amniotic fluid, urine,
blood, vaginal swab, and cerebrospinal fluid. To demon-
strate the effectiveness of each mPCR proposed in this
study, clinical samples from patients with clinical symp-
toms of the diseases were tested in the multiplex reactions
and the results were compared with results obtained in the
corresponding monoplex PCR reactions. It was found that
the results obtained using the mPCR corresponded to those
obtained by monoplex PCR.
In this study, all clinical samples tested were only with
clinical suspicion of an infection caused by the infectious
agents included in the study. The majority of samples
tested for CMV and T. gondii were of either from newborns
with mothers with positive serology for CMV or from
amniotic fluid pregnant women during prenatal exams.
This could explain the fact that all clinical samples tested
were negative for detection of CMV DNA and T. gondii
DNA. Often, different pathogens induce similar or identi-
cal clinical symptoms, especially in the acute stages of
infection, and with similar epidemiological characteris-
tics [17, 18]. According to data from the literature, the

Table 2 Results of multiplex and monoplex PCR reactions in clinical samples from patients suspected of infectious agents: Herpes simplex
virus type 1 (HSV 1) and type 2 (HSV 2), Cytomegalovirus (CMV), T. gondii (Toxo), and C. trachomatis (Chla)
Test Sample typea Infectious Monoplex PCR Multiplex PCR
agent
No. of positive No. of negative No. of positive No. of negative
samples samples samples samples

Multiplex I (n = 81) HSV I/HSV II 8 41 8 41

CMV 0 32 0 32
Multiplex II (n = 104) Liquor HSVI/HSV II 8 41 8 41
Blood CMV 0 32 0 32
Urine Toxo 0 23 0 23
Alveolar lavage
bronchiolitis
Amniotic fluid
Urethral discharge
Multiplex III (n = 130) HSV I/HSV II 1 49 1 49
CMV 0 32 0 32
Toxo 0 23 0 23
Chla 1 21 1 21
0 1 0 1
Total 315
a
Clinical specimens which were suspected of viral and/or protozoan and/or bacterial infection. Liquor n = l59, blood n = 32, urine n = 79,
alveolar lavage bronchiolitis n = 3, amniotic fluid n = 38, urethral discharge n = 4

123
Mol Biotechnol (2013) 54:1004–1009
pathogens included in this study presented similar clinical
features, thus justifying the development of 3 mPCRs
(mPCRs I, II, and III) that allowed the simultaneous
detection of three, four, and five infectious agents,
respectively. The nucleic acid tests have allowed a more
sensitive and specific detection of infectious agents and
have been widely used by diagnostic laboratories. This
technology is particularly useful in virology to replace
conventional methods of culture that are expensive and
laborious, detect multiple agents in low copy numbers,
such as herpes simplex virus in cerebrospinal fluid.
Moreover, the mPCR could be used for the diagnosis of
sexually transmitted diseases (STDs), inflammation in the
urogenital tracts of men and women, toxoplasmosis in
pregnant woman and her fetus, encephalitis caused by
genital herpes infection, and congenital infections. In
conclusion, the mPCRs developed and optimized simulta-
neous diagnosis of some infectious agents in a single
reaction tube and in a short period of time, and this
methodology has the potential to replace routine diagnostic
techniques such as monoplex PCR that are time consuming
and costly. It was shown that the monitoring of pathogen
load and the kinetics of pathogen proliferation has prog-
nostic relevance for the course of disease and clinical
outcome. The availability of quantitative tests is therefore
of paramount importance for the clinical management of
infections. This test may become a quantitative method in
future studies, using technique real-time PCR, moreover,
this method will contribute to the diagnosis of possible
development of other multiplex reactions for the detec-
tion of infectious agents from clinical and diagnostic
importance.
Acknowledgments This study was supported by Grants from the
Fundação de Amparo à Pesquisa do Estado de Minas Gerais
(FAPEMIG).
References
1. Markoulatos, P., Georgopoulou, A., Siafakas, N., Plakokefalos,
E., Tzanakaki, G., & Kourea-Kremastinou, J. (2001). Laboratory
diagnosis of common herpesvirus infections of the central ner-
vous system by a multiplex PCR assay. Journal of Clinical
Microbiology, 39, 4426–4432.
2. Kubota, N., Wada, K., Ito, Y., Shimoyama, Y., Nakamura, S.,
Nishiyama, Y., et al. (2008). One-step multiplex real-time PCR
assay to analyse the latency patterns of Epstein-Barr virus
infection. Journal of Virological Methods, 147, 26–36.
3. Caballero, O. L., Menezes, C. L. P., Costa, M. C. S. L.,
Fernandes, S. C., Anacleto, T. M., de Manoel Oliveira, R., et al.
(1997). Highly sensitive single step PCR protocol for diagnosis
and monitoring of human cytomegalovirus infection in renal
1009
transplant recipients. Journal of Clinical Microbiology, 35,
3192–3197.
4. Ogawa, H., Suzutani, T., Baba, Y., Koyano, S., Nozawa, N.,
Ishibashi, K., et al. (2007). Etiology of severe sensorineural
hearing loss in children: Independent impact of congenital cyto-
megalovirus infection and GJB2 mutations. Journal of Infectious
Diseases, 195, 782–788.
5. Lima, H. E., Oliveira, M. B., Valente, B. G., Afonso, D. A. F.,
Darocha, W. D., Souza, M. C. M., et al. (2007). Genotyping of
Chlamydia trachomatis from endocervical specimens in Brazil.
Sexually Transmitted Diseases, 34, 709–717.
6. Joseph, P., Calderon, M. M., Gilman, R. H., Quispe, M. L., Cok,
J., Ticona, E., et al. (2002). Optimization and evaluation of a PCR
assay for detecting toxoplasmic encephalitis in patients with
AIDS. Journal of Clinical Microbiology, 40, 4499–4503.
7. Speers, D. J. (2006). Clinical applications of molecular biology
for infectious diseases. Clinical Biochemical Review, 27, 39–51.
8. Switaj, K., Master, A., Skrzypczak, M., & Zaborowski, P. (2005).
Recent trends in molecular diagnostics for Toxoplasma gondii
infections. Clinical Microbiology & Infection, 11, 170–176.
9. Barken, K. B., Haagensen, J. A. J., & Tolker-Nielsen, T. (2007).
Advances in nucleic acid-based diagnostics of bacterial infec-
tions. Clinica Chimica Acta, 384, 1–11.
10. Ratcliff, R. M., Chang, G., Kok, T., & Sloots, T. P. (2007).
Molecular diagnosis of medical viruses. Current Issues in
Molecular Biology, 9, 87–102.
11. Elnifro, E. M., Cooper, R. J., Klapper, P. E., Yeo, A. C., & Tullo,
A. B. (2000). Multiplex polymerase chain reaction for diagnosis
of viral and chlamydial keratoconjunctivitis. Investigative Oph-
thalmology and Visual Science, 41, 1818–1822.
12. Elnifro, E. M., Ashshi, A. M., Cooper, R. J., & Kapper, P. E.
(2000). Multiplex PCR: optimization and application in diag-
nostic virology. Clinical Microbiology Reviews, 13, 559–570.
13. Sambrook, J., Fritisch, E. F., & Maniatis, T. (1989). Molecular
cloning: A laboratory manual (p. 626). New York: Cold Spring
Harbor Laboratory, Cold Spring Harbor.
14. Nishiwaki, M., Yamamoto, T., Tone, S., Murai, T., Ohkawara, T.,
Matsunami, T., et al. (2008). Genotyping of human papillom-
aviruses by a novel one-step typing method with multiplex PCR
and clinical applications. Journal of Clinical Microbiology, 46,
1161–1168.
15. Sanguinetti, C. J., Dias Neto, E., & Simpson, A. J. (1994). Rapid
silver staining and recovery of PCR products separated on
polyacrylamide gels. Biotechniques, 17(5), 914–921.
16. Sanger, F., & Coulson, A. R. (1975). A rapid method for de
termining sequences in DNA by primed synthesis with DNA
polymerase. Journal of Molecular Biology, 94, 441–448.
17. McIver, C. J., Jacques, C. F. H., Chow, S. S. W., Munro, S. C.,
Scott, G. M., Roberts, J. A., et al. (2005). Development of mul-
tiplex PCRs for detection of common viral pathogens and agents
of congenital infections. Journal of Clinical Microbiology, 43,
5102–5110.
18. Tanaka, T., Kogawa, K., Sasa, H., Nonoyama, S., Furuya, K., &
Sato, K. (2009). Rapid and simultaneous detection of 6 types of
human herpes virus (herpes simplex virus, varicella-zoster virus,
Epstein-Barr virus, cytomegalovirus human herpes virus 6A/B,
and human herpes virus 7) by multiplex PCR assay. Biomedical
Research, 30, 279–285.
19. Schaade, L., Kockelkorn, P., Ritter, K., & Kleines, M. (2000).
Detection of cytomegalovirus DNA in human specimens by
LightCycler PCR. Journal of Clinical Microbiology, 38, 4006–
4009.
123