Developmental Biology 348 (2010) 97–106

Contents lists available at ScienceDirect

Developmental Biology
j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / d e v e l o p m e n t a l b i o l o g y

Wnt/β-catenin signaling in the dental mesenchyme regulates incisor development

by regulating Bmp4
Sayumi Fujimori a, Hermann Novak a, Martina Weissenböck a, Maria Jussila b, Alexandre Gonçalves c,
Rolf Zeller c, Jenna Galloway d, Irma Thesleff b, Christine Hartmann a,⁎
a
Research Institute of Molecular Pathology, Dr. Bohrgasse 7, A-1030 Vienna, Austria
b
Developmental Biology Program, Institute of Biotechnology, Vikki Biocenter, P.O. Box 56, University of Helsinki, FIN-00014, Helsinki, Finland
c
Developmental Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel, Switzerland
d
Department of Genetics, Harvard Medical School, Boston, MA, USA

a r t i c l e i n f o a b s t r a c t

Article history: Loss- and gain-of function approaches modulating canonical Wnt/β-catenin activity have established a role
Received for publication 15 April 2010 for the Wnt/β-catenin pathway during tooth development. Here we show that Wnt/β-catenin signaling is
Revised 17 September 2010 required in the dental mesenchyme for normal incisor development, as locally restricted genetic inactivation
Accepted 20 September 2010
of β-catenin results in a splitting of the incisor placode, giving rise to two incisors. Molecularly this is first
Available online 27 September 2010
associated with down-regulation of Bmp4 and subsequent splitting of the Shh domain at a subsequent stage.
Keywords:
The latter phenotype can be mimicked by ectopic application of the BMP antagonist Noggin. Conditional
Canonical Wnt-signaling genetic inactivation of Bmp4 in the mesenchyme reveals that mesenchymal BMP4 activity is required for
Tooth development maintenance of Shh expression in the dental ectoderm. Taken together our results indicate that β-catenin
Mesenchyme together with Lef1 and Tcf1 are required to activate Bmp4 expression in order to maintain Shh expression in
BMP the dental ectoderm. This provides a mechanism whereby the number of incisors arising from one placode can
Msx1 be varied through local alterations of a mesenchymal signaling circuit involving β-catenin, Lef1, Tcf1 and
Shh Bmp4.
Incisor
© 2010 Elsevier Inc. All rights reserved.
Supernumerary

Introduction (BMP4), the enamel knot, a non-proliferating transient epithelial

The dentition of mice is highly reduced, with only one incisor
separated by a diastema region from three molars in each quadrant. The
first sign of mammalian tooth development for both type of teeth, molars
and incisors, is a thickening of the oral epithelium in the tooth area
around embryonic day (E) 11. Molar and incisor developments are in
principle similar, but differ slightly in developmental timing and with
respect to gene expression. Tooth development requires sequential and
reciprocal interactions between the dental epithelium and dental
mesenchyme mediated by different signaling pathways (Caton and
Tucker, 2009). The thickened dental epithelium expresses growth factors
such as the Fibroblast growth factor 8 (Fgf8) and Sonic hedgehog (Shh).
Concurrent with its thickening the proliferating epithelium invaginates
into the underlying mesenchyme. The mesenchyme condenses around
the invaginated epithelium, resulting in the formation of a dental bud
stage around E12.5 (bud stage) in the incisor region. Subsequently, the
invaginating epithelium extends farther into the mesenchyme and in
response to mesenchymal signals, such as bone morphogenetic protein-4
⁎ Corresponding author. Fax: + 43 1 7987153.
E-mail address: hartmann@imp.ac (C. Hartmann).
structure, appears at the cap stage (around E13.5 for the incisor).
Mesenchymal Bmp4 expression is regulated by transcription factors such
as Msx1 and Pax9 (Chen et al., 1996; Ogawa et al., 2006). Amongst other
molecules the enamel knot expresses Shh and Fgf4 and serves as a
signaling center that regulates dental papilla formation in the adjacent
mesenchyme and proliferation of the remaining dental epithelium
(Thesleff and Jernvall, 1997). The epithelium extends further by
differential proliferation and forms a bell shaped structure enclosing
the mesenchyme (bell stage; ≥E16 for the incisor). During the bell stage,
epithelial cells adjacent to the mesenchyme differentiate further into
enamel-producing ameloblasts and the mesenchymal cells into dentin-
producing odontoblasts.
Previous studies provided evidence for a key role for the Wnt/β-
catenin pathway in the dental epithelium during tooth morphogenesis.
The pathway is activated by binding of a Wnt-ligand to a receptor
complex composed out of a frizzled family member and LDL receptor
related protein (Lrp5/6), which leads to the inhibition of a cytoplasmic
destruction complex containing the Adenomatosis polyposis coli (APC),
Axin and GSK3 kinase proteins. Thus cytosolic β-catenin accumulates
and translocates to the nucleus where it assembles into a transcriptional
activating complex with members of the Tcf/Lef transcription factor
family (Logan and Nusse, 2004). Loss of Lef1, which is expressed in the

0012-1606/$ – see front matter © 2010 Elsevier Inc. All rights reserved.
doi:10.1016/j.ydbio.2010.09.009
98 S. Fujimori et al. / Developmental Biology 348 (2010) 97–106
dental mesenchyme and epithelium causes arrest of tooth development
at the bud stage (van Genderen et al., 1994) and tissue recombination
experiments showed that Lef1 activity is required in the dental
epithelium to regulate Fgf4 expression and cell survival (Kratochwil
et al., 2002; Sasaki et al., 2005). Constitutive activation of the Wnt/β-
catenin pathway in the oral epithelium results in the formation of
ectopic invaginations, giving rise to ectopic teeth (Jarvinen et al., 2006;
Kuraguchi et al., 2006; Liu et al., 2008; Wang et al., 2009). A similar but
less severe phenotype is observed when Lef1 is overexpressed in the oral
epithelium (Zhou et al., 1995). Inhibition of the Wnt/β-catenin pathway
by overexpression of the secreted inhibitor Dickkopf 1 (Dkk1) in the oral
epithelium results in an early arrest of tooth development (Andl et al.,
2002; Liu et al., 2008). Genetic deletion of β-catenin in the oral
epithelium results in a similar albeit less severe phenotype (Liu et al.,
2008). Until recently, most of the published experimental approaches,
with the exception of inhibiting the pathway by Dkk1 overexpression,
which may also affect the dental mesenchyme, demonstrated a role for
Wnt/β-catenin in the dental epithelium and not in the mesenchyme
during tooth development. Direct evidence for a role of the canonical
Wnt-pathway in the mesenchyme, was for the first time provided
through conditional inactivation of β-catenin in the dental mesenchyme,
which lead to an arrest of molar development at the cap stage (Chen
et al., 2009).
Here we investigated the requirement for Wnt/β-catenin signaling
in the incisor mesenchyme using a conditional approach and showed
that locally restricted loss of β-catenin from the mandibular incisor
region results in the formation of double incisors. Molecular analysis
revealed that β-catenin is required in the mesenchyme to positively
regulate Bmp4 expression. This occurs independent of Msx1 and is
directly mediated by the activity of Tcf/Lef transcription factors.
Furthermore, we provide in vitro and genetic in vivo evidence that
mesenchymal BMP4 activity is required to maintain Shh expression in
the overlying dental epithelium. Thus our results show that
mesenchymal activity of β-catenin is required for incisor develop-
ment and indicate that incisor numbers can be altered through local
modulation of β-catenin activity.
Materials and methods
Animals and preparation of embryonic tissues
The transgenic mouse lines for β-catenin, β-catfl (conditional
allele) and β-catlacZ (null allele), Bmp4, Bmp4ΔLacZ (null allele), Bmp4hf
(hypomorphic conditional allele) and Bmp4fl (conditional allele), Lef1−
(null allele), Tcf1− (null allele) and Prx1-Cre used in this study have been
described earlier and genotyping was performed accordingly (Benazet
et al., 2009; Chang et al., 2008; Galceran et al., 1999; Huelsken et al.,
2000, 2001; Logan et al., 2002). Intercrosses to generate the mutants
were done as described previously (Benazet et al., 2009; Galceran et al.,
1999; Hill et al., 2005). Bmp4ΔPrx1/ΔGL mutants were generated taking
advantage of the germ line activity of Prx1-Cre females through
intercrosses of Prx1-Cre females with Bmp4fl/fl males. From the offspring
Bmp4ΔGL/+;Prx1Cre males were crossed with Bmp4fl/fl females to
generate the desired mutants. Embryos were staged according to
morphological criteria; plug date was considered to be E0.5. Whole
heads or lower jaws were dissected in PBS, fixed in 4% paraformalde-
hyde, dehydrated with methanol and ethanol for whole mount and
paraffin section in situ hybridizations, respectively. All mouse experi-
ments were performed in accordance with local and institutional
regulations and licenses.
Cre recombinase and Wnt activity detection
For the detection of Cre recombinase Prx1-Cre mice were crossed
with Z/AP mice (Lobe et al., 1999) and stained for alkaline
phosphatase (Hill et al., 2005). For the detection of Wnt activity in
E11.5–E13.5 mandibles, heads from BAT-gal (Maretto et al., 2003),
TOP-gal (DasGupta and Fuchs, 1999) and Axin2-lacZ (Lustig et al.,
2002) mice were dissected and fixed in 2% paraformaldehyde/0.2%
glutaraldehyde in PBS and stained in X-gal solution for 20 h to detect
β-galactosidase activity as previously described (Jarvinen et al., 2006).
Skeletal preparations, in situ hybridizations and immunohistochemistry
Heads of newborns (P0) embryos were skinned, fixed in 95%
ethanol and stained with alizarin red and Alcian blue (McLeod, 1980).
Whole mount (on dissected mandibles) and section (5 μm paraffin-
sections) in situ hybridizations were performed as described
(Murtaugh et al., 1999; Riddle et al., 1993). Double-color and double
fluorescence in situ hybridization on serial paraffin sections were
performed using Digoxigenin (DIG) and Fluorescein (Flu) and Biotin
and DIG labeled probes, respectively, as described previously (Brent
et al., 2003; Tylzanowski et al., 2003). All probes used are available
upon request. Immunohistochemistry was performed on paraffin
sections using anti-β-catenin mAb (BD Transduction Laboratories,
1:200) as described (Spater et al., 2006). Ki67 (Novocastra, 1:1000)
and Caspase-3 (Cell signaling, 1:100) immunohistochemistry was
performed using the automated Discovery XT system (Ventana
Medical Systems).
Tissue recombination experiments and kidney capsule transplantation
Incisor anlagen from E12.5 mandible of WT and β-catfl/fl mice were
dissected in Dulbecco's PBS (pH 7.4) under a stereomicroscope. Dental
epithelium and mesenchyme were separated after incubation in a
2.25% Trypsin (Sigma)/0.25% Pancreatin (Sigma)/Tyrode's solution
(pH 7.4) for 2 min at room temperature, followed by incubation in
DMEM/10% FCS (Autogen Bioclear) to stop Protease digestion. Given
that it has been shown that excessive removal of dental mesenchyme
can affect incisor number (Munne et al., 2009), we took care not to
remove any dental mesenchyme. Separated β-catfl/fl mesenchyme was
inoculated with 1 × 1010 pfu/ml Adeno-GFP or Adeno-Cre each (Gene
transfer vector core, University of Iowa) in DMEM/10% FCS for 1 h at
37 °C in 5% CO2. β-catfl/fl adenovirus-infected mesenchyme recom-
bined with uninfected wild-type epithelium in the right orientation
on Nuclepore filters, and cultured on metal grids at 37 °C in 5% CO2.
After 1 day in culture, the recombined samples were transplanted
under the kidney capsule of anesthetized immuno-compromised
mice. The cut was sutured and after 3 weeks the mouse was killed,
and the kidneys were carefully removed.
Bead implantations
Implantation of NOGGIN and BSA coated beads were performed by
following published protocol (Vainio et al., 1993). Affi-Gel blue agarose
beads (Bio Rad) were incubated in 100 ng/μl recombinant mouse
Noggin (R&D) for 45 min at 37 °C. Heparin acrylic beads (Sigma)
incubated for 45 min at 37 °C in PBS containing 0.1% BSA were used as
controls. Control beads were implanted near the presumptive incisor
regions in the left quadrant and NOGGIN beads in the right quadrant of
dissected mandibular explants from WT E11.5 embryos. Explants were
then placed on Nuclepore filters and cultured supported by metal grids
in DMEM / 10% FCS. After 48 h the explants were fixed in 100% methanol
for 5 min followed by an overnight fixation in 4% paraformaldehyde, and
processed for whole-mount in situ hybridization.
Real-time PCR
For real-time PCR analysis, DNase I-treated total RNA (1 μg) was
reverse transcribed using oligo (dT) to produce first-strand cDNA. Real-
time PCR was performed using SYBR greenI nucleic acid gel stain
(Roche) and TAKARA rTaq. Values were calculated using the relative
 S. Fujimori et al. / Developmental Biology 348 (2010) 97–106 99

standard method and normalized to mouse Hprt1 expression. Primers

sets were tested by dilution series and products were analyzed by gel
electrophoresis and melting curves. cDNA were amplified using the
following primer pairs:

Bmp4: sense, CGTTACCTCAAGGGAGTGGA and anti-sense

ATGCTTGGGACTACGTTTGG;
Bmp7: sense, TACGTCAGCTTCCGAGACCT and anti-sense,
GGTGGCGTTCATGTAGGAGT;
Hprt1: sense, AGCTACTGTAATGATCAGTCAACG, and anti-sense,
AGAGGTCCTTTTCACCAGCA.

Luciferase promoter studies

The mouse Bmp4 reporter plasmids were constructed by cloning

the −3000/+120 fragment (3 kb) and the −4820/+120 fragment
(4.8 kb) of the mouse Bmp4 genomic region into the pGL3-Basic
luciferase vector (Promega). HEK293T cells (8 × 105 cells/well) were
co-transfected with each reporter plasmid (0.5 μg) and a total of 2 μg
DNA containing the respective concentrations of expression plasmids
(kindly provided by H. Clevers) and pcDNA3.1 (Invitrogen) together
with 0.05 μg of Renilla luciferase reporter plasmid pRL-CMV (Pro-
mega) using calcium phosphatase co-precipitation procedure. 24 h
after transfection, firefly and Renilla luciferase activities were
measured using the Dual-Glo luciferase assay system (Promega)
following the manufacturer's protocol on a Synergy 2 Multi-Detection
Microplate Reader (BioTek Instruments). Firefly activity was stan-
dardized against the Renilla luciferase control activity.

Results

Inactivation of β-catenin in the dental mesenchyme affects incisor

number

Previous data have established important roles for Wnt/β-catenin

signaling for tooth development in the dental epithelium and recently
in the mesenchyme. In various Wnt-reporter mice such as Top-GAL,
BAT-GAL and Axin2-lacZ mice reporter activity in the dental
mesenchyme can first be detected in the incisor regions from E11.5
onwards (Supplementary Fig. 1A–C and data not shown), suggesting a
potential role for Wnt/β-catenin signaling in the dental mesenchyme
for incisor development. In order to delete β-catenin activity in the
dental mesenchyme we used the Prx1-Cre line (Logan et al., 2002).
Using the Z/AP reporter mouse we could show that Prx1-Cre has
mosaic activity in the mesenchyme of the mandibular incisor region
from E11.5 onwards, while we could not detect any activity in the
molar region (Supplementary Fig. 1D–H). Skeletal preparations of P0
β-catenin conditional mutant heads derived from intercrosses of Prx1-
Cre;β-cat+/lacZ males with homozygous β-cat fl/fl females revealed in 5/
12 β-cat ΔPrx/lacZ mutants the presence of two incisors on one side of
the mandible only, while 2/12 mutants had two incisors on both sides.
In contrast, wild-type embryos have only one incisor per mandibular
half (Fig. 1A, and data not shown). H&E staining of sagittal and frontal
sections of E18.5 β-cat ΔPrx/lacZ heads showed that the two incisors
developed on top of each other (Fig. 1B, C). In addition, we noticed
that the incisors in the mutants were shorter and showed altered
ameloblast distribution (Fig. 1B and Supplementary Fig. 2). The
observed shortening of the incisors is probably a secondary event and
due to the presence of ectopic cartilage (asterisks in Fig. 1B, C).
Formation of ectopic cartilage primarily occurred within the bone
region and is probably due to a differentiation of chondrocytes instead
of osteoblasts as previously reported in the limbs and skulls of
conditional β-catenin mutants (Day et al., 2005; Hill et al., 2005). The
first clear morphological differences with regard to incisor develop-
ment were observed as early as E13.5 (n = 3/6, Fig. 1D), while at E12.5
Fig. 1. Deletion of β-catenin in the dental mesenchyme increases the number of incisors.
(A) Skeletal preparation of WT and β-cat ΔPrx/lacZ newborn (P0) showing one half of a
mandibular jaw. Note the double incisors at the distal tip (indicated by arrows) in the
β-catΔPrx/lacZ mutant compared to the one incisor in the wild-type jaw. (B–D) H&E stained
sagittal (B) and frontal (C) sections of E18.5 heads, and frontal sections of E13.5 heads
(D), showing the presence of double incisors and the early invagination of a second incisor
anlage in β-cat ΔPrx/lacZ mandibles. (E) Frontal sections of E12.5 heads, showing a similar
appearance for the incisor anlage in β-cat ΔPrx/lacZ and wild-type mandibles. Asterisk in B
and C indicates formation of ectopic cartilage in β-cat ΔPrx/lacZ mutants. White lines in (D, E)
mark the boundaries between epithelium and mesenchyme.
and E11.5 the incisors in mutants resembled those of wild-types
(n = 3, Fig. 1E, and data not shown).
To further support the in vivo observations by an independent
experimental approach we performed the following in vitro experi-
ments. Single incisor anlagen were dissected from E12.5 β-catfl/fl
mandibles and the dental mesenchyme was infected with adenovi-
rally expressed Cre-recombinase to inactivate the β-catenin gene.
Subsequently, the partially infected, partly mutant mesenchyme was
recombined with wild type E12.5 dental epithelium, cultured for 24 h,
and then implanted into the kidney capsule and grown there for
3 weeks. The frequency in recovering incisors and not only bone in
those in vitro experiments was very low, with incisors present in only
8/35 adeno-Cre treated and 5/34 adeno-GFP treated control recom-
binant explants. In 1/8 adeno-Cre treated cases two incisors instead of
one developed from a single incisor anlage (Supplementary Fig. 2M).
This was not observed in the control tissue recombination
100 S. Fujimori et al. / Developmental Biology 348 (2010) 97–106

experiments (infected with adeno-GFP; n = 5). Thus, the preliminary
result from the in vitro recombination experiment supports the in vivo
genetic analysis (Fig. 1A–D), suggesting that local inactivation of
β-catenin in the mesenchyme of the incisor anlage can lead to incisor
duplication.
The loss of β-catenin alters Shh and Bmp4 expression
Alteration of BMP4 activity and expression affect Shh expression in the incisor
As down-regulation of Bmp4 expression in the dental mesenchyme
of β-catΔPrx/lacZ embryos seems to precede the alterations in Shh
expression, we asked whether there is a causal connection. Therefore,
BMP activity was inhibited in in vitro explant-cultures using the BMP

In order to identify the underlying molecular alterations we

examined the expression of genes critical for tooth development such
as Shh, Msx1, Msx2, Pax9, Axin2, Fgf3, Fgf8, Fgf9, Fgf10, and Bmp2, Bmp4,
and Bmp7 in the incisor region. At E11.5, the distribution and levels of
Fgf8 (n = 6), Shh (n = 5), Fgf9 (n = 5) and Fgf10 (n = 6) were not
altered in the dental epithelium (Fig. 2A, B, and data not shown). The
expression of mesenchymal genes such as Msx1 (n = 5), Msx2 (n = 6)
and Pax9 (n = 6) expression domain were not noticeably altered
(Fig. 2C, D, and data not shown). This was confirmed for Msx1 by
section in situ analysis (data not shown). In contrast, Bmp4 expression
appeared patchy in the mutant mesenchyme in comparison to the
homogenous expression in wild-types (n = 5/5, Fig. 2E). A similar
patchy down-regulation was observed for the bona fide Wnt target
gene Axin2 (n = 3/4; Fig. 2F) and confirmed on sections by in situ
hybridization (Supplementary Fig. 3B). The expression of other BMP
family members, such as Bmp2 and Bmp7, which were expressed in
the mandible at E11.5 in the epithelium or in the epithelium and
mesenchyme, respectively, were not altered in β-catenin mutants
(Supplementary Fig. 3C–E). Quantification of total transcript levels in
the mandibular region by real-time PCR showed a significant
reduction of Bmp4, but not Bmp7 expression (Supplementary
Fig. 3F). From E12.5 onwards, the Shh expression domain appeared
to be split into two small dots either bi- (n = 4/11) or unilaterally
(n = 7/11) (Fig. 2G). The split in the Shh expression domain was
confirmed by section in situ hybridization using frontal sections
(n = 3/4, Fig. 3A, C). Hybridization of alternating sections to Bmp4 or
using two-color in situ detection showed that Bmp4 is highly
expressed in the mesenchyme directly underneath the Shh expression
domain in wild-type controls (Fig. 3B, C, E). In mutants with a split Shh
expression domain, two high level Bmp4 expression domains are
apparent in conjunction with a slight reduction of the overall Bmp4
levels in the mandibular mesenchyme (Fig. 3B, C). Consistent with the
whole mount in situ observations Msx1 was still expressed through-
out the dental mandibular mesenchyme, including the region where
Bmp4 was down-regulated (n = 2, Fig. 3D). We used double
fluorescent section in situ hybridization to establish that Bmp4
expression was specifically lost from regions deficient in β-catenin
(Fig. 3E–G). In contrast to what we had observed in the Z/AP reporter
staining, recombination for the β-catenin locus was more restricted at
E12.5, resulting in a patchy, mosaic loss of β-catenin expression
(Fig. 3F). The epithelial and mesenchymal cells surrounding the split
Shh expression domains were proliferating normally and no increase
in cellular apoptosis was observed (Supplementary Fig. 4). Expression
of Fgf10 was not altered at E13.5, while Fgf3 expression was reduced
(data not shown). Thus the first change that we are able to detect in
mutants lacking β-catenin in a mosaic manner in their mesenchyme
was a mosaic down-regulation in expressions of Bmp4 and the bona
fide Wnt/β-catenin target gene Axin2 in the dental mesenchyme.

Fig. 2. Alterations in gene expression in β-catΔPrx/lacZ mutant mandibles at early stages of

tooth development. (A–F) In situ hybridization showing the expression of Fgf8, Shh, Msx1,
Pax9 and Bmp4 at E11.5 and (G) Shh at E12.5 in wild-type and β-catΔPrx/lacZ mutant mandibles.
No significant changes in the expression of Fgf8 (A), Shh (B), Msx1 (C), and Pax9 (D) were
observed in β-catΔPrx/lacZ mutant mandibles at E11.5. (E) Patchy expression of Bmp4 in
β-catΔPrx/lacZ mutant mandibles at E11.5. See also magnified region of the white-boxed area in
the right corner. (F) Patchy expression of Axin2 in β-catΔPrx/lacZ mutant mandibles at E11.5. See
also magnified region of the white-boxed area in the right corner. (G) Split Shh expression
domain in the incisor region of β-catΔPrx/lacZ mandibles; in this case on both sides (indicated by
arrowheads).
 S. Fujimori et al. / Developmental Biology 348 (2010) 97–106
Fig. 3. Correlation between alterations in mesenchymal Bmp4 and epithelial Shh expression upon inactivation of mesenchymal β-catenin. (A–G) Frontal section showing incisor tooth buds at E12.5. (A, B) Alternating sections showing a split
Shh expression domain on one side of the incisor region in the β-catΔPrx/lacZ mutant mandibles (A) and a similar split in epithelial Bmp4 expression and overall reduction of its mesenchymal expression (B). (C) Two-color in situ hybridization for
Shh (red) and Bmp4 (blue) in mandibular incisor buds at E12.5; note the high level mesenchymal Bmp4 expression domain directly abutting the epithelial Shh expression domain (red) in wild-types, which is split in two domains associated
with a split Shh expression in the epithelium in the β-catΔPrx/lacZ mutant incisor bud region. (D) Adjacent section showing that Msx1 expression in not down-regulated in the region lacking Bmp4. (E-G) Double fluorescent in situ hybridization
for Bmp4 (red) and β-catenin (green) in the incisor bud of wild-type and β-catΔPrx/lacZ at E12.5. Note that the loss-of Bmp4 expression in the area underneath the invaginating epithelium (red arrows in E) corresponds to the regions in which
β-catenin expression has been inactivated in the dental mesenchyme (green arrows in F). (G) Merged images of (E, F). Right panel: higher magnification images, showing the areas where Bmp4 transcripts (red) are down-regulated
(surrounded by the thin line; labeled 1, 2, 3 in the merged image) corresponding to areas showing deletion of β-catenin (green). Red lines in A and B, and white lines in E–G mark the boundary between epithelium and mesenchyme. Asterisks
in the higher magnifications shown in the right panel mark holes in the tissue.

101
102 S. Fujimori et al. / Developmental Biology 348 (2010) 97–106

antagonist NOGGIN. NOGGIN-soaked beads were implanted near the

incisor region of wild-type E11.5 mandibles, which were then
cultured for 48 h. In about 50% of all NOGGIN treated cultures, the
Shh expression domain was split (8/15), associated with a down-
regulation of Shh in 4/8 cases showing the split expression (Fig. 4A,
and data not shown). Next we asked whether genetic inactivation of
Bmp4 in dental mesenchyme would alter Shh expression. This was
achieved by crossing females homozygous for the hypomorphic
Bmp4hf allele with males double-heterozygous for the Bmp4ΔlacZ null
allele and the Prx1Cre transgene (Benazet et al., 2009). At E12.5
(n = 2) Shh was completely absent from the incisor and molar regions
of mandibles of Bmp4 deficient (Bmp4hfΔPrx/ΔlacZ) embryos, while its
expression was unaffected in littermate controls (Fig. 4B). In contrast,
Shh expression was only reduced and the two domains fused at the
midline in the Bmp4 (Bmp4hfΔPrx/ΔlacZ) deficient embryonic mandibles
at E11.5 (n = 2; Fig. 4C). When we examined the efficiency of the
Bmp4 deletion in Bmp4hfΔPrx/ΔlacZ mandibles at E11.5 using a Bmp4
probe detecting the deleted exon 4, it became apparent that Bmp4
expression was in general severely reduced but not completely lost
(n = 2; Fig. 4D). Interestingly, when we looked at the expression of
Msx1 in the Bmp4 mutants at E11.5, we did not observe a decrease in
the expression levels (n = 2/2; Fig. 4E). As expected, Bmp4 expression
was also reduced in the mandibles of Bmp4ΔlacZ/hf embryos (n=2/3), but
Shh expression was not lost at E12.5 (n=1; data not shown). At E14.5,
either no (n=1/3) or only weak Shh expression in one or two tiny spots
was detected at the tip of Bmp4hfΔPrx/ΔlacZ mandibles (n=2/3) (Fig. 4E). In
contrast to the local reduction of Bmp4 expression in β-catΔPrx/lacZ
mandibles (Fig. 3C) the almost complete loss in Bmp4hfΔPrx/ΔlacZ embryos
provides a feasible explanation for why Shh expression is lost in
Bmp4hfΔPrx/ΔlacZ rather than being split. In addition, we examined Shh
expression in Bmp4ΔPrx/ΔGL mutants, in which a none-hypomorphic
conditional allele of Bmp4 (Chang et al., 2008) had been deleted using
the Prx1-Cre in the presence of a germ-line deleted Bmp4ΔGL/+ allele.
However, using this Bmp4 loss-of-function allele, only minimal changes in
Bmp4 expression (n=3/4) and no significant changes in Shh expression
(n=3) were observed in the mandibles (Supplementary Fig. 5). In
contrast to the mandibles, mesenchymal Bmp4 expression is completely
lost in the limb, but again we did not observe a loss of Msx1 expression
(n=2; Supplementary Fig. 5C, D). Taken together, this genetic analysis
indicates that BMP4 activity is likely to be required for maintenance but
not initiation of epithelial Shh expression. Furthermore, our genetic data
suggest that Msx1 is not a Bmp4-dependent gene.

Bmp4 is a direct target of a β-catenin–Tcf1–Lef1 complex

Since Msx1, which has been shown previously to be required for

Bmp4 expression in the dental mesenchyme (Chen et al., 1996), was
not affected by the loss of β-catenin activity, we determined whether
Bmp4 is a transcriptional target of Wnt/β-catenin signaling in the
dental mesenchyme. In silico analysis using the transfac database
revealed that a 4.8 kb upstream region of the Bmp4 locus encodes
approximately 33 putative TCF/LEF binding sites (Fig. 5A). Some of
those binding sites are conserved between rat and mouse or rat,
mouse and human based on a CLUSTALW analysis (indicated by one
or two asterisks respectively, see Fig. 5A). Bmp4-reporter constructs
encoding either the 4.8 kb up stream region or a shorter 3 kb region
(containing approximately 21 potential TCF/LEF binding sites) were
transactivated in luciferase assays upon co-transfection of expression
plasmids for both Lef1 and β-catenin, Tcf1 and β-catenin or an
expression plasmid encoding a TCF1-β-catenin fusion protein (Fig. 5B,
and data not shown). Next, we determined whether Bmp4 expression
is altered in the dental mesenchyme of Tcf1 and/or Lef1 mutant
mandibles at E11.5. However, no significant difference in Bmp4
expression was observed in the incisor regions of Lef1−/− or Tcf1−/−
embryos in comparison to controls at E11.5 (n = 3; Fig. 5C). In
compound Tcf1;Lef1 mutant embryos (Tcf1−/−;Lef1+/− n = 5/6 and
Fig. 4. Alterations in BMP4 activity affect Shh expression in the dental epithelium. (A) In
situ detection of Shh expression in E11.5 mouse mandibular explants cultured for 48 h
with BSA- (white) or NOGGIN- (blue) soaked beads. Note the split in the Shh expression
domain on the side where the NOGGIN-soaked bead was implanted. The right panel
shows a higher magnification of the incisor area (white box in the left panel). (B–E) Shh
and Bmp4 expression in mandibles of Bmp4hfΔPrx1/ΔlacZ mice. (B) Loss of Shh in molar and
incisor regions in Bmp4hfΔPrx1/ΔlacZ deficient mandibles at E12.5. (C) Down-regulation of
Shh in the presumptive incisor and molar regions in Bmp4hfΔPrx1/ΔlacZ mandible at E11.5.
Note that the expression domains are fused at the mid-line. (D) Bmp4 expression, using
an exon4 specific in situ hybridization probe, is almost completely lost in Bmp4
mutant mandibles at E11.5. (E) Msx1 expression pattern in E11.5 wild-type and Bmp4
mutant mandibles. Note Msx1 expression is not down-regulated in the Bmp4 mutant
mandibles. (F) Presence of tiny Shh expression domains in the incisor and molar regions
of Bmp4 mutant mandibles at E14.5.
 S. Fujimori et al. / Developmental Biology 348 (2010) 97–106 103

Fig. 5. In vitro and in vivo regulation of Bmp4 expression by β-catenin in combination with Tcf/Lef family members. (A) Schematic overview over the −4.8 kb mouse Bmp4 promoter
region indicates the location of putative Tcf/Lef binding sites (light blue). Sites conserved between human, rat and mouse are indicated by two red asterisks, those conserved
between rat and mouse by one red asterisk. (B) Luciferase assay using the -3.0 kb Bmp4 promoter region in response to control, increasing levels of Lef1 and β-catenin, Tcf1 and
β-catenin or a TCF1-β-catenin fusion expression constructs. Error bars represent the standard deviation (s.d.). (C) Bmp4 expression in mandibles of wild-type, Tcf1 and Lef1 single
mutant embryos at E11.5. No obvious difference in Bmp4 expression was observed in Tcf1−/− and Lef1−/− single mutants. (D) Bmp4 expression in mandibles of Tcf1;Lef1 compound
and double mutant embryos at E11.5. Bmp4 expression was reduced in the compound mutants and completely lost in embryos lacking both Tcf1 and Lef1. Higher magnifications of
the boxed areas are shown in the upper right corners. (E) Bmp4 expression in the mandibles (Md) of Tcf1−/−;Lef1+/+ and Tcf1−/−;Lef1−/− mutant embryos (frontal view, upper row;
lateral view, lower row) at E9.5. Arrowheads point at the Bmp4 expression domain.

Tcf1+/−;Lef1−/− n = 4/4) the overall expression of Bmp4 was slightly
reduced (Fig. 5D), while Bmp4 expression was completely lost in Tcf1−/−:
Lef1−/− mutant embryos at E11.5 (n=2/2; Fig. 5D). Given the severity of
the embryonic defects and the developmental retardation of the Tcf1/Lef1
double mutant embryos at E11.5 it is possible that the loss of Bmp4 is due
to secondary effects. However, when we analyzed E9.5 double mutant
embryos, which are fairly similar to wild-type and single mutant embryos,
we could already at this stage observe a reduction in the Bmp4 expression
in the mandibles of Tcf1−/−:Lef1−/− compared to littermate Tcf1−/−;
Lef1+/+ mutant embryos (Fig. 5E). At this stage a rudimentary forelimb
was still present, which also showed reduced Bmp4 expression (data not
shown).
Although all four Tcf/Lef family members are expressed in the
dental mesenchyme at E11.5 (Supplementary Fig. 6), the almost
complete absence of Bmp4 expression in Tcf1/Lef1 double mutants
would suggest that Tcf1 and Lef1 are the primary transcriptional co-
104 S. Fujimori et al. / Developmental Biology 348 (2010) 97–106
factors, which in a complex with β-catenin, regulate Bmp4 expression
in the dental and possibly also in the limb mesenchyme.
Discussion
Mesenchymal β-catenin activity regulating Bmp4 is required for incisor
development
Various ectodermal appendages including teeth depend on canon-
ical Wnt/β-catenin signaling (Mikkola and Millar, 2006). Until recently
it was thought that this pathway is primarily required in the dental
epithelium during tooth development. This notion was supported by the
finding that TCF/LEF reporters seem not to be active in the molar
mesenchyme (Liu et al., 2008). However, here we show that there is
activity of various Wnt-reporter mice in the early incisor mesenchyme
of the lower jaw. Recently, the analysis of a conditional β-catenin mutant
by Chen and colleagues established that β-catenin is required in the
dental mesenchyme during tooth development (Chen et al., 2009). Their
study showed that following β-catenin inactivation, molar and incisor
formation arrests at bud stage but the underlying molecular alterations
resulting in this arrest remained unknown. In contrast we show that
sporadic deletion of β-catenin in the incisor mesenchyme of the lower
jaw using the Prx1-Cre recombinase transgene resulted in a double-
incisor phenotype in about 50% of all mutant embryos. Our molecular
analysis revealed that in parallel to the onset of Prx1-Cre activity, gene
expressions were altered starting around E11.5. In particular, mesen-
chymal Bmp4 and Axin2 expressions were down-regulated in a patchy
manner as a likely first molecular alteration in the mosaic β-catenin
deficient mesenchyme. The changes in Bmp4 expression appear to occur
in an Msx1-independent manner and cell-autonomously, coinciding
with the local loss of β-catenin. These cell-autonomous changes together
with the Bmp4 promoter analysis suggest that Bmp4 might be a direct
target of β-catenin/TCF/LEF mediated transcription in the dental
mesenchyme. β-catenin has been shown to regulate Bmp4 in other
tissues such as cancer cells, lung, limb and eye (Hill et al., 2006; Kim
et al., 2002; Shu et al., 2005; Zhou et al., 2008). Consistent with our in
vitro data, it has been shown previously that β-catenin can activate and
bind to a 2.4-kb Bmp4 promoter region in vitro (Shu et al., 2005; Song
et al., 2009). Based on the results from transgenic promoter studies this
region is, however, not sufficient to drive expression in the primordial
tooth anlage (Feng et al., 2002). Thus the more upstream located Tcf/Lef
binding sites might be the ones, which regulate Bmp4 expression in the
early tooth anlage. This needs to be demonstrated in the future by in vivo
ChIP experiments and transgenic promoter studies. Nevertheless given
that Bmp4 expression was reduced in mandibles of compound Tcf1/Lef1
mutants and lost in mandibles of double mutants supports our model
that β-catenin, together with Tcf1 and Lef1, which are both expressed in
the dental mesenchyme at E11.5, directly regulates Bmp4 expression in
the dental mesenchyme (Fig. 6). So similar to what has been reported
in the limb, Tcf1 and Lef1 seem to act redundantly in the mandibular
mesenchyme (Galceran et al., 1999). Furthermore, our data establish
that Tcf1 plays a functional, albeit redundant role in tooth development.
Interestingly, Bmp4 has been shown to regulate Lef1 expression in the
dental mesenchyme (Chen et al., 1996), thus establishing a positive
feed-back loop (see model Fig. 6). In addition to the Bmp4 down-
regulation, Shh expression in the overlying dental epithelium was
altered in the conditional β-catenin mutant mandibles. Bmp4 has been
previously implicated in regulating Shh and Bmp2 expression in the
dental epithelium of the molars based on the analysis of Msx1 deficient
mouse embryos and in vitro explant studies (Zhang et al., 2000).
Alteration of BMP activity in mandibular explants by NOGGIN-bead
implantation affects Shh expression in a manner similar to loss of
mesenchymal β-catenin activity, which supports the notion that BMP
activity is required to maintain Shh expression in the incisor region. In
addition, it has been recently shown that treatment of incisor explants
with NOGGIN resulted in splitting of the Shh expression domain and the
Fig. 6. Model of the β-catenin/BMP4 circuit maintaining Shh expression in wild-type and
β-catenin mutant incisor regions. (A) β-catenin in a transcriptional complex with Tcf1 and
Lef1 activates the expression of Bmp4 (indicated by the light and dark orange domains)
independently of Msx1 in the dental mesenchyme at stage E11.5. Mesenchymal BMP4
activity maintains continuous expression of Shh (indicated by the red domain) in the
overlying dental epithelium and regulates Lef1 expression in the dental mesenchyme.
(B) Local loss of β-catenin in the region of high Bmp4 expression (indicated in dark orange)
results in a BMP4 deficient region, which fails to maintain Shh expression in the overlying
dental epithelium, generating a gap within the Shh expressing placode. The split Shh
expression domains will invaginate independently giving rise to two incisors in the adult.
development of to up to three incisors, dependent on the NOGGIN
concentration (Munne et al., 2010). This further supports the idea that
alteration of BMP-signaling influences Shh expression and incisor
number. Importantly, genetic inactivation of Bmp4 in the dental
mesenchyme establishes that it is the mesenchymal activity of BMP4,
which is indeed required for the maintenance of Shh in the dental
epithelium of molars and incisors, but not for its induction. Therefore,
we hypothesize that the Shh expression domain splits only in those
cases where the regions lacking Bmp4 expression in the mesenchyme
were substantial and directly abutting the overlying epithelium (Fig. 6).
The study by Zhang et al. (2000) reported that Bmp4 might also inhibit
Shh expression at least at high concentrations in vitro. Thus, BMP4 in
combination with other factors might regulate Shh expression differ-
entially over time in a concentration-dependent manner, which might
explain why residual Shh expression was detected in 2 out of 3 Bmp4
deficient embryos at E14.5. Alterations in the Shh expression domain
might ultimately affect the invagination of dental epithelium, as loss of
Shh at the early bud stage and inhibition of Shh activity at the epithelial
thickening stage is known to alter growth and morphogenesis of teeth
(Cobourne et al., 2001; Dassule et al., 2000). Furthermore, ectopic
application of SHH protein to oral epithelium induces invagination of
non-dental epithelium (Hardcastle et al., 1998). Thus the generation of a
second Shh expressing center within the dental epithelium might be one
of the key steps triggering the second invagination that causes the
formation of a second incisor in β-catΔPrx/lacZ mutant embryos.
These phenotypic and molecular alterations were not observed in the
previous genetic analysis by Chen et al. (2009). This might be due to
differences in the onset of Cre-recombinase activity in the mandibular
region as at least for the Osr2-IresCre no recombinase activity was reported
prior to E14.5 in incisor regions (Lan et al., 2007). On the other hand the
deletion efficiency might vary between the different Cre-lines. In
particular, we have observed that deletion of β-catenin in different
 S. Fujimori et al. / Developmental Biology 348 (2010) 97–106
β-catΔPrx/lacZ mutant embryos was patchy and variable. This observation
probably also explains why the penetrance of the double-incisor
phenotype was not 100%. Similarly, only incomplete and patchy
inactivation of β-catenin activity was achieved in the adenovirally
infected mesenchymal explants, explaining probably why a double-
incisor was only observed in one case.
Local alterations in the β-catenin/BMP4 circuits affect incisor number
Although adult mice have only one upper and lower incisor, mouse
embryos still show a more ancestral pattern with about six vestigial
incisor placodes in the upper and three in the lower half of the developing
jaw (Peterkova et al., 2006). The entire epithelial area, comprising all
placodes, folds normally into the mesenchyme, but is thought to form only
one incisor through an incorporation process potentially due to the failure
to form inhibitory zones (Peterkova et al., 2006). These inhibitory zones
might be regulated by reaction–diffusion interactions of growth inhibitors
and activators similar to Turing-type mechanisms, but may have been lost
or became suppressed during rodent evolution (Peterkova et al., 2002;
Turing, 1952). Recently it has been shown that the mesenchyme
surrounding the incisor tooth germ has the capability to restrict tooth
induction (Munne et al., 2009). This repressive potential of the
mesenchyme is in part mediated by ectodin, which is encoded by the
Sostdc1 gene (Munne et al., 2009). Ectodin, is related to Sclerostin and is
known to modulate the Wnt-pathway and to potentially inhibit BMP-
signaling (Itasaki et al., 2003; Laurikkala et al., 2003; Lintern et al., 2009).
However, the timing and mode of supernumerary incisor formation in
Sostdc1 mutants is distinct from the duplications observed following
β-catenin inactivation (Munne et al., 2009; Murashima-Suginami et al.,
2007). Thus, we propose that in addition to the inhibitory potential of the
dental mesenchyme there is also an activatory potential, which β-catenin
and BMP4 are part of. This mesenchymal activatory pathway maintains
the expression of critical factors in the dental epithelium, such as Shh and
the Bmp4 dependent cell cycle inhibitor p21 (Jernvall et al., 1998). A recent
finding showed that treatment of mandibular explants with defined
concentrations of the BMP antagonist Noggin leads to a destabilization of
the large placode and the formation of two to three incisors (Munne et al.,
2010). In agreement with these findings, our data suggest that local or
non-uniform reduction of mesenchymal BMP activity due to the loss of
β-catenin contributes to the formation of supernumerary incisors by
splitting the signaling center, which results in the formation of two
invaginations. Thus, a potential mechanism to alter incisor number would
be to locally modulate β-catenin activity in the dental mesenchymal,
thereby altering Bmp4 expression and subsequently epithelial Shh
expression. An alternative explanation, for the observed phenotype
might be that reduced Wnt/BMP4 signaling somehow affects survival/
revitalization of the posterior incisor placode, which normally regresses
around E13.5. This explanation is in agreement with earlier findings by
Zhang and colleagues, which showed that high levels of BMP4 inhibit Shh
expression in the molar and incisor region (Zhang et al., 2000). However,
based on this alternative model one would have expected increased Shh
expression upon reduction of BMP4 activity in the mesenchyme, which
we did not observe.
Acknowledgments
We thank Rudolf Grosschedl and Hans Clevers for providing the Lef1
and Tcf1 mutant mice and expression plasmids, Elina Järvinen and
Riikka Santalahti for technical advice, Vukoslav Komnenovic and
Mihaela Ziba for help with the immunohistochemistry. This research
was supported by Boehringer Ingelheim. HN was supported by the
Austrian Science Found (FWF Grant No. P19281-B16). Research by RZ is
supported by the Swiss National Science foundation (SNF Grant. No.
31003A-113866) and AG is supported by "The Fundação para a Ciência e
a Tecnologia” (FCT; SFRH/BD/24301/2005).
105
Appendix A. Supplementary data
Supplementary materials related to this article can be found online
at doi:10.1016/j.ydbio.2010.09.009.
References
Andl, T., Reddy, S.T., Gaddapara, T., Millar, S.E., 2002. WNT signals are required for the
initiation of hair follicle development. Dev. Cell 2, 643–653.
Benazet, J.D., Bischofberger, M., Tiecke, E., Goncalves, A., Martin, J.F., Zuniga, A., Naef, F.,
Zeller, R., 2009. A self-regulatory system of interlinked signaling feedback loops
controls mouse limb patterning. Science 323, 1050–1053.
Brent, A.E., Schweitzer, R., Tabin, C.J., 2003. A somitic compartment of tendon
progenitors. Cell 113, 235–248.
Caton, J., Tucker, A.S., 2009. Current knowledge of tooth development: patterning and
mineralization of the murine dentition. J. Anat. 214, 502–515.
Chang, W., Lin, Z., Kulessa, H., Hebert, J., Hogan, B.L., Wu, D.K., 2008. Bmp4 is essential
for the formation of the vestibular apparatus that detects angular head movements.
PLoS Genet. 4, e1000050.
Chen, Y., Bei, M., Woo, I., Satokata, I., Maas, R., 1996. Msx1 controls inductive signaling
in mammalian tooth morphogenesis. Development 122, 3035–3044.
Chen, J., Lan, Y., Baek, J.A., Gao, Y., Jiang, R., 2009. Wnt/beta-catenin signaling plays an
essential role in activation of odontogenic mesenchyme during early tooth
development. Dev. Biol. 334, 174–185.
Cobourne, M.T., Hardcastle, Z., Sharpe, P.T., 2001. Sonic hedgehog regulates epithelial
proliferation and cell survival in the developing tooth germ. J. Dent. Res. 80,
1974–1979.
DasGupta, R., Fuchs, E., 1999. Multiple roles for activated LEF/TCF transcription complexes
during hair follicle development and differentiation. Development 126, 4557–4568.
Dassule, H.R., Lewis, P., Bei, M., Maas, R., McMahon, A.P., 2000. Sonic hedgehog regulates
growth and morphogenesis of the tooth. Development 127, 4775–4785.
Day, T.F., Guo, X., Garrett-Beal, L., Yang, Y., 2005. Wnt/beta-catenin signaling in
mesenchymal progenitors controls osteoblast and chondrocyte differentiation
during vertebrate skeletogenesis. Dev. Cell 8, 739–750.
Feng, J.Q., Zhang, J., Tan, X., Lu, Y., Guo, D., Harris, S.E., 2002. Identification of cis-DNA
regions controlling Bmp4 expression during tooth morphogenesis in vivo. J. Dent.
Res. 81, 6–10.
Galceran, J., Farinas, I., Depew, M.J., Clevers, H., Grosschedl, R., 1999. Wnt3a−/−like
phenotype and limb deficiency in Lef1(−/−)Tcf1(−/−) mice. Genes Dev. 13, 709–717.
Hardcastle, Z., Mo, R., Hui, C.C., Sharpe, P.T., 1998. The Shh signalling pathway in tooth
development: defects in Gli2 and Gli3 mutants. Development 125, 2803–2811.
Hill, T.P., Spater, D., Taketo, M.M., Birchmeier, W., Hartmann, C., 2005. Canonical Wnt/
beta-catenin signaling prevents osteoblasts from differentiating into chondrocytes.
Dev. Cell 8, 727–738.
Hill, T.P., Taketo, M.M., Birchmeier, W., Hartmann, C., 2006. Multiple roles of mesenchymal
beta-catenin during murine limb patterning. Development 133, 1219–1229.
Huelsken, J., Vogel, R., Brinkmann, V., Erdmann, B., Birchmeier, C., Birchmeier, W., 2000.
Requirement for beta-catenin in anterior–posterior axis formation in mice. J. Cell
Biol. 148, 567–578.
Huelsken, J., Vogel, R., Erdmann, B., Cotsarelis, G., Birchmeier, W., 2001. beta-Catenin
controls hair follicle morphogenesis and stem cell differentiation in the skin. Cell
105, 533–545.
Itasaki, N., Jones, C.M., Mercurio, S., Rowe, A., Domingos, P.M., Smith, J.C., Krumlauf, R.,
2003. Wise, a context-dependent activator and inhibitor of Wnt signalling.
Development 130, 4295–4305.
Jarvinen, E., Salazar-Ciudad, I., Birchmeier, W., Taketo, M.M., Jernvall, J., Thesleff, I.,
2006. Continuous tooth generation in mouse is induced by activated epithelial
Wnt/beta-catenin signaling. Proc. Natl. Acad. Sci. USA 103, 18627–18632.
Jernvall, J., Aberg, T., Kettunen, P., Keranen, S., Thesleff, I., 1998. The life history of an
embryonic signaling center: BMP-4 induces p21 and is associated with apoptosis in
the mouse tooth enamel knot. Development 125, 161–169.
Kim, J.S., Crooks, H., Dracheva, T., Nishanian, T.G., Singh, B., Jen, J., Waldman, T., 2002.
Oncogenic beta-catenin is required for bone morphogenetic protein 4 expression in
human cancer cells. Cancer Res. 62, 2744–2748.
Kratochwil, K., Galceran, J., Tontsch, S., Roth, W., Grosschedl, R., 2002. FGF4, a direct
target of LEF1 and Wnt signaling, can rescue the arrest of tooth organogenesis in
Lef1(−/−) mice. Genes Dev. 16, 3173–3185.
Kuraguchi, M., Wang, X.P., Bronson, R.T., Rothenberg, R., Ohene-Baah, N.Y., Lund, J.J.,
Kucherlapati, M., Maas, R.L., Kucherlapati, R., 2006. Adenomatous polyposis coli
(APC) is required for normal development of skin and thymus. PLoS Genet. 2, e146.
Lan, Y., Wang, Q., Ovitt, C.E., Jiang, R., 2007. A unique mouse strain expressing Cre
recombinase for tissue-specific analysis of gene function in palate and kidney
development. Genesis 45, 618–624.
Laurikkala, J., Kassai, Y., Pakkasjarvi, L., Thesleff, I., Itoh, N., 2003. Identification of a
secreted BMP antagonist, ectodin, integrating BMP, FGF, and SHH signals from the
tooth enamel knot. Dev. Biol. 264, 91–105.
Lintern, K.B., Guidato, S., Rowe, A., Saldanha, J.W., Itasaki, N., 2009. Characterization of
wise protein and its molecular mechanism to interact with both Wnt and BMP
signals. J. Biol. Chem. 284, 23159–23168.
Liu, F., Chu, E.Y., Watt, B., Zhang, Y., Gallant, N.M., Andl, T., Yang, S.H., Lu, M.M., Piccolo,
S., Schmidt-Ullrich, R., Taketo, M.M., Morrisey, E.E., Atit, R., Dlugosz, A.A., Millar, S.E.,
2008. Wnt/beta-catenin signaling directs multiple stages of tooth morphogenesis.
Dev. Biol. 313, 210–224.
106 S. Fujimori et al. / Developmental Biology 348 (2010) 97–106
Lobe, C.G., Koop, K.E., Kreppner, W., Lomeli, H., Gertsenstein, M., Nagy, A., 1999. Z/AP, a
double reporter for cre-mediated recombination. Dev. Biol. 208, 281–292.
Logan, C.Y., Nusse, R., 2004. The Wnt signaling pathway in development and disease.
Annu. Rev. Cell Dev. Biol. 20, 781–810.
Logan, M., Martin, J.F., Nagy, A., Lobe, C., Olson, E.N., Tabin, C.J., 2002. Expression of Cre
Recombinase in the developing mouse limb bud driven by a Prxl enhancer. Genesis
33, 77–80.
Lustig, B., Jerchow, B., Sachs, M., Weiler, S., Pietsch, T., Karsten, U., van de Wetering, M.,
Clevers, H., Schlag, P.M., Birchmeier, W., Behrens, J., 2002. Negative feedback loop of
Wnt signaling through upregulation of conductin/axin2 in colorectal and liver
tumors. Mol. Cell. Biol. 22, 1184–1193.
Maretto, S., Cordenonsi, M., Dupont, S., Braghetta, P., Broccoli, V., Hassan, A.B., Volpin, D.,
Bressan, G.M., Piccolo, S., 2003. Mapping Wnt/beta-catenin signaling during mouse
development and in colorectal tumors. Proc. Natl. Acad. Sci. USA 100, 3299–3304.
McLeod, M.J., 1980. Differential staining of cartilage and bone in whole mouse fetuses
by alcian blue and alizarin red S. Teratology 22, 299–301.
Mikkola, M.L., Millar, S.E., 2006. The mammary bud as a skin appendage: unique and
shared aspects of development. J. Mammary Gland Biol. Neoplasia 11, 187–203.
Munne, P.M., Tummers, M., Jarvinen, E., Thesleff, I., Jernvall, J., 2009. Tinkering with the
inductive mesenchyme: Sostdc1 uncovers the role of dental mesenchyme in
limiting tooth induction. Development 136, 393–402.
Munne, P.M., Felszeghy, S., Jussila, M., Suomalainen, M., Thesleff, I., Jernvall, J., 2010.
Spitting placodes: effects of BMP and Activin on the patterning and identity of
mouse incisors. Evol. Dev. 12, 383–392.
Murashima-Suginami, A., Takahashi, K., Kawabata, T., Sakata, T., Tsukamoto, H., Sugai,
M., Yanagita, M., Shimizu, A., Sakurai, T., Slavkin, H.C., Bessho, K., 2007. Rudiment
incisors survive and erupt as supernumerary teeth as a result of USAG-1 abrogation.
Biochem. Biophys. Res. Commun. 359, 549–555.
Murtaugh, L.C., Chyung, J.H., Lassar, A.B., 1999. Sonic hedgehog promotes somitic
chondrogenesis by altering the cellular response to BMP signaling. Genes Dev. 13,
225–237.
Ogawa, T., Kapadia, H., Feng, J.Q., Raghow, R., Peters, H., D'Souza, R.N., 2006. Functional
consequences of interactions between Pax9 and Msx1 genes in normal and
abnormal tooth development. J. Biol. Chem. 281, 18363–18369.
Peterkova, R., Peterka, M., Viriot, L., Lesot, H., 2002. Development of the vestigial tooth
primordia as part of mouse odontogenesis. Connect. Tissue Res. 43, 120–128.
Peterkova, R., Lesot, H., Peterka, M., 2006. Phylogenetic memory of developing
mammalian dentition. J. Exp. Zool. B Mol. Dev. Evol. 306, 234–250.
Riddle, R.D., Johnson, R.L., Laufer, E., Tabin, C., 1993. Sonic hedgehog mediates the
polarizing activity of the ZPA. Cell 75, 1401–1416.
Sasaki, T., Ito, Y., Xu, X., Han, J., Bringas Jr., P., Maeda, T., Slavkin, H.C., Grosschedl, R.,
Chai, Y., 2005. LEF1 is a critical epithelial survival factor during tooth morphogen-
esis. Dev. Biol. 278, 130–143.
Shu, W., Guttentag, S., Wang, Z., Andl, T., Ballard, P., Lu, M.M., Piccolo, S., Birchmeier, W.,
Whitsett, J.A., Millar, S.E., Morrisey, E.E., 2005. Wnt/beta-catenin signaling acts
upstream of N-myc, BMP4, and FGF signaling to regulate proximal-distal patterning
in the lung. Dev. Biol. 283, 226–239.
Song, L., Li, Y., Wang, K., Wang, Y.Z., Molotkov, A., Gao, L., Zhao, T., Yamagami, T., Wang,
Y., Gan, Q., Pleasure, D.E., Zhou, C.J., 2009. Lrp6-mediated canonical Wnt signaling is
required for lip formation and fusion. Development 136, 3161–3171.
Spater, D., Hill, T.P., Gruber, M., Hartmann, C., 2006. Role of canonical Wnt-signalling in
joint formation. Eur. Cell Mater. 12, 71–80.
Thesleff, I., Jernvall, J., 1997. The enamel knot: a putative signaling center regulating
tooth development. Cold Spring Harb. Symp. Quant. Biol. 62, 257–267.
Turing, A.M., 1952. The chemical basis of morphogenesis. Philos. Trans. R. Soc. (B) 236, 37–72.
Tylzanowski, P., De Valck, D., Maes, V., Peeters, J., Luyten, F.P., 2003. Zfhx1a and Zfhx1b
mRNAs have non-overlapping expression domains during chick and mouse
midgestation limb development. Gene Expr. Patterns 3, 39–42.
Vainio, S., Karavanova, I., Jowett, A., Thesleff, I., 1993. Identification of BMP-4 as a signal
mediating secondary induction between epithelial and mesenchymal tissues
during early tooth development. Cell 75, 45–58.
van Genderen, C., Okamura, R.M., Farinas, I., Quo, R.G., Parslow, T.G., Bruhn, L., Grosschedl,
R., 1994. Development of several organs that require inductive epithelial–mesenchy-
mal interactions is impaired in LEF-1-deficient mice. Genes Dev. 8, 2691–2703.
Wang, X.P., O'Connell, D.J., Lund, J.J., Saadi, I., Kuraguchi, M., Turbe-Doan, A., Cavallesco,
R., Kim, H., Park, P.J., Harada, H., Kucherlapati, R., Maas, R.L., 2009. Apc inhibition of
Wnt signaling regulates supernumerary tooth formation during embryogenesis
and throughout adulthood. Development 136, 1939–1949.
Zhang, Y., Zhang, Z., Zhao, X., Yu, X., Hu, Y., Geronimo, B., Fromm, S.H., Chen, Y.P., 2000. A
new function of BMP4: dual role for BMP4 in regulation of Sonic hedgehog
expression in the mouse tooth germ. Development 127, 1431–1443.
Zhou, P., Byrne, C., Jacobs, J., Fuchs, E., 1995. Lymphoid enhancer factor 1 directs hair
follicle patterning and epithelial cell fate. Genes Dev. 9, 700–713.
Zhou, C.J., Molotkov, A., Song, L., Li, Y., Pleasure, D.E., Pleasure, S.J., Wang, Y.Z., 2008.
Ocular coloboma and dorsoventral neuroretinal patterning defects in Lrp6 mutant
eyes. Dev. Dyn. 237, 3681–3689.