Science of the Total Environment 675 (2019) 615–622

Contents lists available at ScienceDirect

Science of the Total Environment

journal homepage: www.elsevier.com/locate/scitotenv

Chloropicrin alternated with biofumigation increases crop yield and

modifies soil bacterial and fungal communities in strawberry production
Daqi Zhang a, Dongdong Yan a,b, Wensheng Fang a, Bin Huang a, Xianli Wang a, Xiaoning Wang a, Jiahong Zhu a,
Jie Liu a, Canbin Ouyang a,b, Yuan Li a,b, Qiuxia Wang a,b, Aocheng Cao a,b,⁎
a
Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing 100193, China
b
State Key Laboratory for Biology of Plant Disease and Insect Pests, Beijing 100193, China

H I G H L I G H T S G R A P H I C A L A B S T R A C T

• Our study introduced a new method of

soil fumigation to reduce the use of
chemical fumigants.
• Chloropicrin alternated with
biofumigation (CAB) can improve nutri-
ent elements in chloropicrin fumigation
plots.
• Chloropicrin alternated with
biofumigation (CAB) also increased
strawberry yields
• Chloropicrin alternated with
biofumigation (CAB) significantly im-
pacts soil bacterial and fungal commu-
nity diversity.

a r t i c l e i n f o a b s t r a c t

Article history: Chloropicrin (Pic) and biofumigation are both considered effective chemical and non-chemical alternatives to
Received 30 November 2018 methyl bromide, respectively, for controlling crop-limiting soil-borne pests and diseases. In this study, we eval-
Received in revised form 12 April 2019 uated the effects of Pic alone and ‘chloropicrin alternated with biofumigation’ (CAB) on the soil's physico-
Accepted 14 April 2019
chemical properties and strawberry yield, as well as their effects on soil bacterial and fungal communities. The
Available online 19 April 2019
contents of NO−3 -N, available phosphorus and potassium, and electrical conductivity were all significantly in-

Editor: Jose Julio Ortega-Calvo creased when CAB was used. In addition, CAB also significantly increased the strawberry marketable yield.
High-throughput gene sequencing showed the species abundance of some soil bacteria and fungi was signifi-
Keywords: cantly increased such as the phyla Proteobacteria, Bacteroidetes, Actinobacteria and Ascomycota when CAB was
Biofumigation used. However, CAB decreased the relative abundance of the phyla Firmicutes, Chloroflexi, Gemmatimonadete
Chloropicrin alternated with biofumigation and Zygomycota. These results indicated that CAB could improve the physico-chemical properties of soil for
Soil bacterial communities strawberry production, increase the genetic diversity of microbes in the soil and enhance marketable fruit yield.
Soil fungal communities © 2019 Published by Elsevier B.V.
Strawberry yield
Soil physico-chemical properties

1. Introduction

⁎ Corresponding author at: No.2 west Yuanmingyuan Road, Institute of Plant Protection,
Strawberry (Fragaria × ananassa Duch.)is a high-value crop widely
Chinese Academy of Agricultural Sciences, Beijing 100193, China. appreciated for its characteristic aroma and flavour, bright red color,
E-mail address: aochengcao@ippcaas.cn (A. Cao). juicy texture and sweetness. In 2017, China production of strawberries

https://doi.org/10.1016/j.scitotenv.2019.04.222
0048-9697/© 2019 Published by Elsevier B.V.
616 D. Zhang et al. / Science of the Total Environment 675 (2019) 615–622
was 3.7 million tonnes, and which accounted for 40% of global produc-
tion (FAOSTAT, 2017). The significant financial returns from straw-
berries have encouraged increases in production. However,
continuous cultivation of strawberries under protected agriculture on
the same land has increased strawberry diseases such as strawberry
root rot caused by Rhizoctonia sp., Fusarium sp., Pestalotiopsis sp.
(Zhang et al., 2006), strawberry anthracnose caused by Colletotrichum
sp. (Ji et al., 2012), and strawberry gray mold caused by Botrytis cinerea
Pers. (Wang, 1997). These pathogens affect strawberry quality and can
reduce yield by 30% to 60% or more (Cao et al., 2017). As the majority
of farmers use the same land each year, it is imperative for them to be
able to control soil-borne diseases of strawberries so that strawberries
can be produced under protected agriculture continuously.
At present, preplant soil fumigation is the most direct, effective and
rapid technique to control soil-borne diseases. Chemicals such as
dazomet, chloropicrin (Pic) or metam‑sodium are now widely used to
control soil-borne diseases to improve strawberry crop yield (Locascio
et al., 2014; Fan et al., 2017), They have replaced methyl bromide
which was phased out globally because it depleted stratospheric
ozone (Prather and Watson, 1990; Ristaino and Thomas, 1997; Wang
et al., 2017; Bell, 2000). However, these broad-spectrum chemical fumi-
gants have the disadvantage of killing non-target beneficial microor-
ganisms that can benefit the soil ecosystem, rather than only
controlling the harmful soil-borne diseases (Imfeld and Vuilleumier,
2012).
Soil microorganisms are an important part of soil system, that are in-
volved in the decomposition of soil organic matter, transformation of
nutrients and the circulation of biologically-important chemicals (Niu
et al., 2015; Baldock, 2000). They are also routinely used to measure
the health of the soil ecosystem (Lin, 2010; Zheng and Liu, 2003). Latz
et al. (2012) reported that rhizosphere bacteria can prevent pathogens
from infecting the host and reduce the incidence of disease. Some bacte-
rial and fungal genera such as Bacillus, Pseudomonas and Chaetomium
can also be used as biological control agents to directly target soil-
borne diseases (Wang et al., 2018a; Chi and Yang, 2002).
Chemical fumigants are reported to have a significant impact on soil
microorganisms. They can destroy the structure and diversity of soil mi-
crobial communities (Ibekwe et al., 2001) resulting in a significant in-
crease in soil-borne diseases (Xue et al., 2011). Pic fumigation alters
bacterial community structure (Wei et al., 2016), inhibits nitrification
and promotes denitrification (Yan et al., 2015). Li et al. (2017) reported
that Pic decreased bacterial community diversity and inhibited the
abundance of ammonia-oxidizing archaea bacteria. Documentation of
the damaging effect of chemical fumigants has encouraged the search
for eco-friendly methods to control pests and diseases that have mini-
mal impact on the environment and off-target organisms.
Biofumigation is considered a non-chemical, ‘natural alternative’ to
chemical fumigants. Brassicaceae is an economically important family
of flowering plants commonly known as the mustards, the crucifers,
or the cabbage family. They are widely used as biofumigants
(Srivastava and Ghatak, 2017; Wei et al., 2016) because they are rich
in sulfide-glucosinolates (GSLs). When these plants are crushed, GSLs
are hydrolyzed by myrosinase enzymes to release isothiocyanates
(ITCs). ITCs are bioactive substances that kill nematodes and soil patho-
gens (Riga et al., 2004; Ren et al., 2018), such as strawberry
Phytophthora spp. (Porras et al., 2009) and Verticillium dahliae
(Neubauer et al., 2014). Cao et al. (2017) showed that fresh manure
from cows or chickens is a biofumigant due to the ammonia produced
from nitrogen during the process of fermentation. Ammonia provides
effective control of pests and diseases and increases crop yield.
Ghoname et al. (2017) reported that fresh chicken manure increased
lettuce yield, head length and diameter as well as lettuce fresh and
dry weights. Ghoname et al. (2015) found there was no statistical differ-
ence in cantaloupe yield between the broad-spectrum soil fumigant
dazomet and a combination of fresh cow manure, chicken manure and
Brassicaceae residuals. Moreover, it is reported that biofumigation
improves soil structure (Arnault et al., 2013) and increases bacterial
and reduces fungal populations (Wang et al., 2018b).
We investigated whether the detrimental effects of Pic on the soil
environment could be reduced if it were alternated with a biofumigant
such as fresh chicken manure and wheat straw. Our research aimed to
determine the potential of ‘chloropicrin alternated with biofumigant’
(CAB) as a way to reduce the use of Pic and thereby improve the pros-
pects of continuously producing a high-value crop grown under
protected agriculture. We monitored the 16S rRNA V3-V4 region of bac-
teria and the internal transcribed spacer (ITS) region of fungi using a
high-throughput gene sequencing technique to determine the effect of
CAB on bacterial and fungal communities in the soil. We also examined
the impact of CAB on the soil's physico-chemical properties and changes
in the strawberry marketable yield over a period of two years.
2. Materials and methods
2.1. Experimental location and fumigants
The research was undertaken in a greenhouse in Mancheng County,
Hebei Province, China. The greenhouse had used Pic to produce straw-
berries for N5 years. The soil is silty loam (44.39% sand, 51.05% silt and
4.56% clay) with pH of 7.67, electrical conductivity of 121.85
(μs cm−1) and organic matter 16.75%. N, P, and K were 2.36, 53.35,
30.58 mg/100 g soil, respectively. The main crops produced in the
greenhouse were strawberries (Zuohe) alternated with tomatoes.
Pic was obtained 99.5% pure from Dalian Lvfeng Chemical Co Ltd.,
China. Locally-obtained fresh chicken manure and wheat straw were
used as biofumigation materials.
2.2. Greenhouse experiments
Strawberry seedlings were transplanted to the greenhouse in early
September 2016 and 2017. During the strawberry growth period
(from September to April of the next year), the mean temperature in
the greenhouse was 20 °C and soil moisture content was 70%. The
strawberries were grown on beds 20 cm high and 50 cm wide, each con-
taining 2 rows of plants spaced 20 cm apart. The beds were spaced 0.7 m
from center to center. Each bed was 2.8 m long × 7.5 m wide.
Three treatments were established in the plots following a random
block design: (A) Pic alternated with biofumigation (CAB). Pic
(30 g/m2) was manually injected into the soil and covered with polyeth-
ylene film (PE film, 0.04 μm thick, Shandong Longxing Science and Tech-
nology Co. Ltd., China) for 10d. Biofumigation immediately followed the
Pic application and consisted of 5 kg/m2 fresh chicken manure
+1.5 kg/m2 wheat straw added into the soil and mixed thoroughly
using mechanical tractor. The treated soil was sprayed gently with
water to activate the biofumigant fermentation process and then cov-
ered with the same PE film for 30 days when it was removed. (B) Pic
(30 g/m2) was manually injected into the soil 15–20 cm deep and
then covered with PE film for 10 days. (C) Control. The soil on which
strawberries were grown was left untreated. The CAB, Pic and Control
treatments were replicated three times. Fig. S1 provides further infor-
mation on the soil treatments applied to these plots.
2.3. Soil samples and chemicals
Soil samples were collected 10–20 cm below the surface from three
points randomly selected in each plot 120 d after the start of the exper-
iment. The plant residues and gravel were removed from each sample.
The samples were put through a 2 mm sieve and divided into three
parts: 1) Packed into sealed bags and refrigerated at −80 °C for later mi-
crobial DNA extraction; 2) Refrigerated at 4 °C for later nitrogen deter-
mination using a Futura™ Continuous Flow Analytical System
(Alliance Instruments, Eragny-Sur-Oise, France); 3) Air-dried for later
soil analyses. Phosphorus concentration was determined using a UV
 D. Zhang et al. / Science of the Total Environment 675 (2019) 615–622
2102 - PC spectrophotometer (UNICO, New Jersey, USA) and followed
the methods used by Cao et al. (2014). Potassium concentration was de-
termined using an FP640 flame photometer (Shanghai Instruments
Group Co., Ltd., Shanghai, China). Organic matter was determined by
the dichromate digestion (Schinner et al., 1995). A 1:2.5 soil to H2O
ratio was used to measure pH.
2.4. Marketable yield of strawberry
Twenty strawberry plants were selected randomly from each plot in
2016 and 2017. The dates of each strawberry harvest and marketable
fruit weight at each harvest were recorded. The total marketable yield
from each treatment at each harvest was calculated at the end of straw-
berry season.
2.5. DNA extraction
Total genomic DNA was extracted from a 0.25 g soil sample using a
Powersoil® DNA Extraction Kit (Mo Bio, Carlsbad, USA) following the
manufacturer's protocol. The extracted DNA was verified using 0.1%
(w/v) agarose gel electrophoresis and then refrigerated at −20 °C.
2.6. PCR amplification and high-throughput sequencing
The 16 s rRNA V3-V4 region of bacteria and the internal transcribed
spacer (ITS) region of fungi were used as the target sequences of DNA.
The PCR amplification was carried out with the universal primers 338F
(5′- ACTCCTACGGGAGCAGCAG -3′) -806R (5′-GGAC
TACHGGGTWTCTAAT-3′) (Xu et al., 2016) and ITS1F (5′- CTTGGTCAT
TTAGGAAGTAA-3′) - ITS2R (5′- GCTGCGTTCTTCATCATGATGC -3′)
(Adams et al., 2013), respectively. The 20 μl PCR amplification reaction
material comprised 4 μl of 5 × FastPfu Buffer (16 s v3-v4)/2 μl of 10
× Buffer (ITS)，2 μl dNTPs (2.5 mM)，0.8 μl each of forward and reverse
primers, 0.4 μl of FastPfu Polymerase (16S v3-v4)/0.2 μl of rTaq Poly-
merase (ITS), 0.2 μl of BSA, and 10 ng template DNA. Each of these
was supplemented with up to 20 μl of ddH2O.
Polymerase chain reaction (PCR) amplification followed a specific
thermal program: an initial denaturation at 95 °C for 3 min, followed
by 28 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for
30 s, elongation at 72 °C for 45 s, and a final extension at 72 °C for
10 min. Three repeated PCR products from the same sample were
mixed and detected by 2% agarose gel electrophoresis. The samples
with bright main bands between 400 bp and 450 bp were selected for
further analysis. The PCR products were recovered and purified by
AxyPrep™ DNA Gel Extraction Kit (Axygen Biosciences, Union City,
CA, USA) and quantified using a QuantiFluor®-ST Fluorometer
(Promega, USA). Finally, the Illumina pair-end library preparation, clus-
ter generation and 250 bp pair-end sequencing were determined by
Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China).
2.7. Statistical analysis
QIIME v1.7.0 was used to depolymerize, quality filter and analyze
the raw Illumina fastq sequence data file and to obtain high quality
tags data (Bokulich et al., 2013). After comparison with GOLD (Genomes
Online Database), the detected chimera sequence was removed (Edgar
Table 1
Soil physical and chemical properties 120 days after treatment.
Treatment NH+
4 -N NO−
3 -N Available P (mg/kg)
(mg/kg) (mg/kg)
CAB 10.26 ± 0.61a 54.00 ± 1.73a 321.55 ± 6.34a
Pic 10.63 ± 0.71a 31.33 ± 0.07b 303.26 ± 5.58b
Control 10.91 ± 0.99a 28.22 ± 0.37c 243.21 ± 2.25c
CAB = chloropicrin alternated with biofumigation; Pic = chloropicrin fumigation; Control = the soil was not fumigated with fresh chicken manure + wheat straw or chloropicrin alone.
Means (N = 3) within the same column accompanied by the same letter following by Duncan's new multiple range test are not statistically different (p = 0.05).
617
et al., 2011) to obtain valid tags data. The sequence obtained was clus-
tered into operational taxonomic units (OTUs) according to the similar-
ity level using UPARSE Pipeline v 7.0 at the 97% classification threshold.
The representative sequences in OTUs were then selected and com-
pared with the known sequence in the database to obtain the species
annotation information. All samples were subsampled according to
the minimum number of sample sequences. Other correlation analyses
were carried out by using SPSS v19.0 statistical software, and the dia-
grams showing genetic similarity were drawn using Microsoft Excel
2013. Duncan's new multiple range test was used to determine statisti-
cal differences.
3. Results
3.1. Soil physico-chemical properties
The concentrations of NH+ 4 -N in the soil in the CAB or Pic treatments
were not significantly different to the control after 120 d. However, the
concentration of NO−3 -N was significantly increased in both treatments,
compared with control (Table 1). After CAB treatment, the available P
and K were significantly increased compared to the control, and the
available P was also significantly increased in the Pic treatment. After
CAB and Pic treatments, electrical conductivity was significantly in-
creased compared with control. Although CAB increased the content
of organic matter, there was no significant difference from control.
The soil pH decreased significantly after the CAB and Pic treatments.
3.2. Total marketable yield of strawberries
The total marketable yield of strawberries was statistically similar in
2016 and 2017 for the CAB and Pic treatments (Fig. 1). In 2016 and
2017, the CAB and Pic treatments produced statistically more market-
able strawberries than the control. The CAB and Pic treatments were
statistically similar in 2016 and 2017.
3.3. Genetic sequencing of bacterial and fungal communities
3.3.1. Base pair length and rarefaction curves
A total of 468,450/430,964 effective reads and 2727/225 OTUs were
obtained from the genetic sequencing of the bacteria and fungi micro-
bial community, respectively, in the soil samples obtained from the
CAB, Pic and control treatments. The average length of the effective bac-
terial and fungal reads was 440 and 266 bp. The rarefaction curves of all
samples reached a plateau indicating that the database obtained by
gene sequencing was based on the vast majority of the available genetic
information. Our results were therefore a reasonable representation of
the composition and diversity of bacterial and fungal communities pres-
ent in the soil samples.
3.3.2. Genetic analysis of the similarity of bacterial and fungal species
3.3.2.1. Venn diagram analysis. The bacterial and fungal shared and
unique OTUs in the CAB, Pic and control treatments are shown in the
Venn diagrams (Fig. 2). There were more bacterial OTUs than fungal
OTUs. Compared with the control treatment, the number of unique bac-
terial and fungal OTUs was reduced after CAB and Pic treatments.
Available K (mg/kg) Organic matter (mg/kg) pH Electrical conductivity (μs/cm)
(1:2.5)
523.33 ± 1.42a 21.50 ± 3.31a 7.38 ± 0.07c 442.67 ± 8.74a
474.17 ± 0.42b 19.50 ± 1.96a 7.66 ± 0.01b 189.00 ± 1.39b
471.67 ± 0.61b 20.20 ± 1.02a 7.96 ± 0.13a 166.73 ± 3.62c
618 D. Zhang et al. / Science of the Total Environment 675 (2019) 615–622
Fig. 1. Total marketable yield of strawberries (Kg/m2) in 2016 and 2017 following different
soil treatments: CAB = chloropicrin alternated with biofumigation; Pic = chloropicrin
fumigation; Control = the soil was not fumigated with fresh chicken manure + wheat
straw or chloropicrin alone. Means (N = 3) within the same column accompanied by
the same letter are not statistically different (p = 0.05).
Moreover, the CAB treatment had 52% and 69% more unique OTUs than
the Pic treatment in the bacterial and fungal soil samples, respectively.
3.3.2.2. Hierarchical cluster analysis. Hierarchical clustering analysis was
carried out based on the beta diversity distance matrix. The UPGMA
(Unweighted Pair-Group Method with Arithmetic Mean) was used to
construct tree structure. The distance between different branches on
the tree showed the size of the genetic distance between sample micro-
organisms. Microbial communities in the CAB and the control samples
were genetically close compared with Pic and CAB/control, which indi-
cated that the soil microbial community structure was changed more in
the Pic than in the CAB treatments (Fig. 3). The structure of the micro-
bial community was similar in the CAB and the control.
3.3.2.3. Principal coordinate analysis. The more similar the species com-
position, the closer they are in the Principal Coordinate Analysis
(PCoA) diagram. PC1 and PC2 are the two main characteristic values
that influence differences in community composition in CAB, Pic and
control. The contribution of the bacterial community composition in
the two principal coordinates was 40.25% and 29.21%, respectively
(Fig. 4, left). The control, CAB and Pic bacterial community compositions
Fig. 2. Bacterial (left) and fungal (right) Venn diagrams showing the extent of shared and unique OTUs in the different treatments: CAB = chloropicrin alternated with biofumigation; Pic
= chloropicrin fumigation; Control = the soil was not fumigated with fresh chicken manure + wheat straw or chloropicrin alone. OTUs = operational taxonomic units.
were located separately in the second, third and fourth quadrants. The
three replicates of each treatment were close to each other indicating
the treatments had good repeatability. However, the Pic treatment
was furthest away from the control and CAB treatment in the PCoA.
The contribution of fungal community composition in the two prin-
cipal coordinates was 64.2% and 15.22% (Fig. 4, right). The fungi species
in the control and CAB treatments were relatively close to each other,
but the Pic treatment was further away from both of them in the
PCoA. This indicated that the Pic treatment also had the greatest influ-
ence on the composition of the soil fungal community.
3.3.3. Effect of different treatments on the soil microbial community and
dominant phyla
Proteobacteria, Bacteroidetes, Chloroflexi and Actinobacteria became
the dominant bacterial phyla in soil (Fig. 5, left). Among them, phylum
Proteobacteria was the most abundant, accounting for 25% to 40% of
the total. CAB increased the relative abundance of Proteobacteria in the
soil to 38.22%, while Proteobacteria in the control treatment was
31.86%. Pic decreased the relative abundance of Proteobacteria by
17.92%, compared to the control. In addition, CAB also increased the rel-
ative abundance of Bacteroidetes and Actinobacteria by 76.38% and
50.76%, respectively, compared to the control, while CAB decreased
the relative abundance of Firmicutes by 44.73%. Pic decreased the rela-
tive abundance of Actinobacteria and increased the relative abundance
of Chloroflexi and Gemmatimonadetes.
Ascomycota was the most abundant and dominant fungal phyla in
the CAB, Pic and control treatments (Fig. 5, right). Ascomycota accounted
for 87.13% to 99.90% of the total gene pool. Compared to control and Pic
treatments, CAB increased the relative abundance of Ascomycota by
4.40% and 6.75%, respectively. CAB decreased the relative abundance
of Zygomycota and Basidiomycota. However Pic increased the relative
abundance of Basidiomycota.
3.3.4. Effect of different treatments on the soil microbial community and
dominant genera
The relative abundance of bacteria and fungi at the genera level com-
pared to the control changed after the CAB and Pic treatments (Fig. 6).
Bacillaceae was the dominant bacterial group in the control (Fig. 6,
left). After the CAB and Pic treatments, the relative abundance of
Bacillaceae significantly decreased (P ≤ 0.001) by 51.43% and 16.74%, re-
spectively. Pseudomonas increased in the CAB and Pic treatments. In ad-
dition, Chitinophaga, Flavobacterium and Microbispora also increased
after the CAB treatment. Fungal genera (Fig. 6, right) Humicola,
Chaetomium and Mortierella decreased after the CAB and Pic treatments.
However, Zopfiella and Mycothermus in the CAB treatment increased by
93.72% and 98.36% compared to the control, respectively.
 D. Zhang et al. / Science of the Total Environment 675 (2019) 615–622 619

Fig. 3. Bacterial (left) and fungal (right) hierarchical cluster analysis at the OTU level (based on Bray-Curtis method) in the different treatments: CAB = chloropicrin alternated with
biofumigation; Pic = chloropicrin fumigation; Control = the soil was not fumigated with fresh chicken manure + wheat straw or chloropicrin alone.

4. Discussion
4.1. Effect on soil physico-chemical properties and marketable yield of
strawberry
The NH+ 4 -N concentrations in the CAB and Pic treatments after 120 d
were similar to the control, indicating that the nitrogen cycling mi-
crobes had recovered and that the process of nitrification was no longer
inhibited. This result was consistent with the results of Yan et al. (2010).
The available P and K concentrations after the CAB treatment were
higher than in the Pic and control samples, indicating that CAB can aug-
ment P and K in the soil. The recovery of nitrification activity resulted in
an increase of NO− 3 -N, and also led to a decrease of soil pH (de Boer and
Knowalchuk, 2001). In our study, a negative relationship between
higher NO− 3 -N and lower pH in the CAB and Pic was observed. During
fumigation, the NaCl present in fresh chicken manure may have been
gradually released, resulting in an increase in electrical conductivity re-
corded in the CAB treatment. A similar result was also reported by Ma
et al. (2010). Chloropicrin has a killing effect on soil microorganism,
which can affect the absorption and transport of ions in the soil,
resulting in an increase in electrical conductivity.
Both CAB and Pic increased the marketable yield of strawberries
compared to the control over the two years of our study. Pic is widely-
reported to increases the marketable yield (Yan et al., 2012; Du et al.,
2007). Biofumigation has also been reported to promote crop growth
(Wang et al., 2016; Njoroge et al., 2008). The fermentation and rich nu-
trients of fresh chicken manure and the fermentation of loose straw
were reported to contribute to an increase in strawberry yield (Rees
et al., 2014; Riad et al., 2017). However, there was no significant differ-
ence in strawberry yield between CAB and Pic, which was consistent
with McGuire (2003) who reported that biofumigation and chemical fu-
migation both increased potato yield significantly. In our study, CAB
showed potential to reduce the use of Pic which in practice would be
an environmentally favorable result. Further research is required to de-
termine the extent to which Pic can be reduced before disease control
and strawberry yield are affected.
4.2. Effect on soil bacterial and fungal communities using genetic
sequencing
The development and use of genome sequencing technology allows
a greater understanding of soil microbial composition. In our study, the
results of Venn diagrams, hierarchical cluster analysis and PCoA all sug-
gested that CAB did not alter the structure of soil microbial community
significantly. Importantly, CAB could control soil-borne pathogens
while promoting and restoring the microbial populations in the soil,
compared with continual Pic fumigation.
4.2.1. Effect on the soil bacteria and fungi at phyla level
Bacteria phylum Proteobacteria is the most abundant phylum re-
corded in soil libraries (Janssen, 2006) and is often found in nutrient-
rich environments (Taketani et al., 2013). Actinobacteria is known as a
decomposer of organic materials and plays an important role in organic
matter turnover in soil (Sykes and Skinner, 1973). In our study, the pos-
itive correlation between Proteobacteria, Actinobacteria and organic
matter in the CAB treatment was also observed. Since the soil samples

Fig. 4. PCoA diagram of bacteria (left) and fungi (right) after different treatments: CAB = chloropicrin alternated with biofumigation; Pic = chloropicrin fumigation; Control = the soil was
not fumigated with fresh chicken manure + wheat straw or chloropicrin alone.
620 D. Zhang et al. / Science of the Total Environment 675 (2019) 615–622

Fig. 5. Relative bacterial (left) and fungal (right) abundance (N0.01) histogram of soil microbial phyla exposed to different treatments: CAB = chloropicrin alternated with biofumigation;
Pic = chloropicrin fumigation; Control = the soil was not fumigated with fresh chicken manure + wheat straw or chloropicrin alone. The number of asterisks indicates significant
differences between treatments according to a one-way ANOVA and FDR (Fasle Discovery Rate) adjustment (P b 0.05): * 0.01 b P ≤ 0.05; ** 0.001 b P ≤ 0.01; *** P ≤ 0.001.

were collected in winter, the increasing of bacterial phylum
Bacteroidetes in CAB was not surprising. Previous studies have showed
that Bacteroidetes is enriched with unsaturated cellular fatty acids that
allows them to survive low temperatures (Weber et al., 2001) and ex-
ploit rapidly bioavailable organic matter (Abell and Bowman, 2005).
The phylum Chloroflexi are photosynthetic bacterium (Bauld and
Brock, 1973) that it can degrade organochlorine and release chloride.
Chloroflexi populations increased as chloride increased (Krzmarzick
et al., 2012). Since Chloropicrin is degraded by Pseudomonas sp.
(Castro et al., 1983), the chloride in the final products may stimulate
the increase of Chloroflexi after the Pic treatment.
We observed an increase in fungi phylum Ascomycota in the CAB
treatment. Similarly, Paungfoolonhienne et al. (2015) observed an in-
crease in Ascomycota possibly because of abundance of nitrogen in
fresh chicken manure. Ascomycota form mycorrhizae in the roots of
plants, thereby increasing the capacity of plants to absorb nutrients
and promoting the growth of plants.
4.2.2. Effect on the soil bacteria and fungi at the genera level
Bacteria genera Bacillus and Pseudomonas are effective biological
control agents (Wang et al., 2018a). Bacillus subtilis is reported to de-
crease the incidence of Fusarium wilt (Huang et al., 2018). Pseudomonas
was also reported to lower disease incidence (Haas and Défago, 2005;
Hollister et al., 2013). Wolińska et al. (2017) claimed that
Flavobacterium can be used as an indicator to evaluate soil biological
degradation. For fungal genera, Humicola, a common saprobic fungus
usually associated with compost or animal manure, produces cellulase,
xylanase, and other biomass degrading enzymes necessary for
decomposing wheat straw (de Almeida et al., 1995; Yang et al., 2006).
The genus Chaetomium belongs to the phylum Ascomycota. It is a type
of fungal biological control agent (Chi and Yang, 2002) reported to
have an important role in controlling plant diseases (Heye and
Andrews, 1983). The genus Mortierella has also been reported to inhibit
disease (Gao et al., 2017). These disease controlling organisms (Bacillus,
Humicola, Chaetomium and Mortierella) all decreased after CAB and Pic
treatments, and there was a negative correlation with crop yield. We
hypothesize that the number of these genera were negatively correlated
with the incidence of disease, or that the diverse and complex composi-
tion of soil microorganisms belies their role in disease control. Further
experiments are needed to determine which of these hypotheses is
correct.
5. Conclusions
The results of our study showed that chloropicrin alternated with
biofumigation (CAB) increased NO− 3 -N, available P, available K and or-
ganic matter in soil. It may also improve any deficiency in soil fertility
and nutrient imbalance caused by continuous Pic fumigation. CAB also
significantly increases the marketable yield of strawberries although
there was no significant difference with Pic. We used high-throughput
gene sequencing to detect changes in the bacterial and fungal commu-
nities. The results of Venn diagrams and PCoA as well as hierarchical
cluster analysis showed that CAB could minimize the disruption of mi-
crobial communities when it compared to Pic fumigation. The results

Fig. 6. Relative bacterial (left) and fungal (right) abundance (N0.02) histogram of microbial genera after different treatment: CAB = chloropicrin alternated with biofumigation; Pic =
chloropicrin fumigation; Control = the soil was not fumigated with fresh chicken manure + wheat straw or chloropicrin alone. The number of asterisks indicates significant
differences between treatments according to a one-way ANOVA and FDR (Fasle Discovery Rate) adjustment (P b 0.05): * 0.01 b P ≤ 0.05; ** 0.001 b P ≤ 0.01; *** P ≤ 0.001.
 D. Zhang et al. / Science of the Total Environment 675 (2019) 615–622
of microbial dominant phyla and genera analyses showed that the phyla
Proteobacteria, Actinobacteria and Ascomycota and the genus Pseudomo-
nas (associated with disease control and crop growth) increased after
the CAB treatment. Further experiments are needed to explain the neg-
ative correlation with crop yield after the CAB treatment of the genera
Bacillus, Humicola, Chaetomium and Mortierella that are associated
with disease control.
In summary, our study showed that CAB can ameliorate the changes
in the physico-chemical properties of soil, increase strawberry yield and
increase the diversity of the soil bacterial and fungal communities. CAB
can provide a suitable soil for profitable strawberry production, which
increases the possibility of reducing the frequency of Pic. CAB can also
make use of agricultural waste and manure, and potentially reduce
planting cost. As many countries are aiming to reduce pesticide, the
use of CAB for producing high-value crops under protected agriculture
is worthy of consideration. We hope that our research paves the way
for further research to confirm the validity of this approach.
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.scitotenv.2019.04.222.
Acknowledgments
The authors are grateful for the financial support from The National
Key Research and Development Program of China (2017YFD0201600),
National Natural Science Foundation project of China (31672066), and
the Agricultural Science and Technology Innovation Program over the
years. We thank Dr. Tom Batchelor for providing editorial comments
on the manuscript.
Author contributions
Daqi Zhang and Aocheng Cao designed the study and wrote the pro-
tocol; Daqi Zhang, Xianli Wang, Jiahong Zhu, Jie Liu collected the soil
samples. Daqi Zhang, Wensheng Fang, Bin Huang, Xianli Wang and
Xiaoning Wang carried out determination of soil physico-chemical
properties; Daqi Zhang performed most of the experiments; Daqi
Zhang, Dongdong Yan, Yuan Li, Canbin Ouyang and QiuxiaWang man-
aged the literature search and analyses; Daqi Zhang, Dongdong Yan an-
alyzed the data; Daqi Zhang, Dongdong Yan and Aocheng Cao were
responsible for the overall design and wrote the manuscript.
Conflicts of interest
The authors declare no conflict of interest.
References
Abell, G.C.J., Bowman, J.P., 2005. Colonization and community dynamics of class
Flavobacteria on diatom detritus in experimental mesocosms based on Southern
Ocean seawater. FEMS Microbiol. Ecol. 53, 379–391.
Adams, R.I., Miletto, M., Taylor, J.W., Bruns, T.D., 2013. Dispersal in microbes: fungi in in-
door air are dominated by outdoor air and show dispersal limitation at short dis-
tances. The ISME journal 7 (7), 1262–1273.
de Almeida, E.M., Polizeli, M.D.T.M., Terenzi, H.F., Jorge, J.A., 1995. Purification and bio-
chemical characterization of bxylosidase from Humicola grisea var thermoidea.
FEMS Microbiol. Lett. 130, 171–175.
Arnault, I., Fleurance, C., Vey, F., Auger, J., 2013. Use of Alliaceae residues to control soil-
borne pathogens. Ind. Crop. Prod. 49, 265–272.
Baldock, J.A., 2000. Role of the soil matrix and minerals in protecting natural organic ma-
terials against biological attack. Org. Geochem. 31 (7), 697–710.
Bauld, J., Brock, T.D., 1973. Ecological studies of Chloroflexis, a gliding photosynthetic bac-
terium. Arch. Mikrobiol. 92 (4), 267–284.
Bell, C.H., 2000. Fumigation in the 21st century. Crop Prot. 19 (8–10), 563–569.
de Boer, W., Knowalchuk, G.A., 2001. Nitrification in acid soils: microorganisms and
mechanisms. Soil Biol. Biochem. 33, 853–866.
Bokulich, N.A., Sathish, S., Faith, J.J., Gevers, D., Gordon, J.I., Knight, R., et al., 2013. Quality-
filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nat.
Methods 10 (1), 57–59.
Cao, A.C., Guo, M.X., Yan, D.D., Mao, L.G., Wang, Q.X., Li, Y., et al., 2014. Evaluation of sul-
furyl fluoride as a soil fumigant in China. Pest Manag. Sci. 70 (2), 219–227.
Cao, A.C., Liu, X.M., Guo, M.X., 2017. Incidences of soil-borne diseases and control mea-
sures. Plant Prot. 43 (2), 6–16.
621
Castro, C.E., Wade, R.S., Belser, N.O., 1983. Biodehalogenation. The metabolism of chloro-
picrin by pseudomonas sp. J. Agric. Food Chem. 31 (6), 1184–1187.
Chi, Y.J., Yang, Q., 2002. Biological control of plant diseases with Chaetomium spp.and the
problems in its application. System Sciences and Comprehensive Studies In Agricul-
ture 18 (3), 215–218.
Du, Y.J., Yang, S.G., Li, X.Y., Guo, X.L., Guo, L.P., Zhou, M.J., 2007. Effect of chloropicrin treat-
ment on controlling strawberry soil-borne diseases and increasing yield. Shandong
Agricultural Science (4), 98–99.
Edgar, R.C., Haas, B.J., Clemente, J.C., Quince, C., Knight, R., 2011. UCHIME improves sensi-
tivity and speed of chimera detection. Bioinformatics 27 (16), 2194–2200.
Fan, L.J., Liu, Q.Z., Song, Z.X., Li, W.H., 2017. Evaluation of Dazomet and chloropicrin effec-
tiveness on replanted soil in greenhouse strawberry. Agrochemicals 56 (4), 293–296.
FAOSTAT, 2017. http://www.fao.org/faostat/en/#data/QC.
Gao, J.H., Wang, W., Xe, X.F., Cao, X.Y., Peng, C., 2017. Study on disease resistance of radix
aconiti lateralis praeparata varieties and their rhizoplane fungal diversities. World
Chinese Medicine 12 (11), 2563–2567.
Ghoname, A.A., Riad, G.S., El-Basiouny, A.M.M., Hegazi, A.M., El-Mohamady, R.S., 2015.
Finding natural alternatives to methyl bromide in greenhouse cantaloupe for yield,
quality and disease control. Int. J. ChemTech Res. 8 (9), 84–92.
Ghoname, A.A., Riad, G.S., El-Bassiony, A.M.M., Tantawy, A.S., 2017. Biofumigation with
fresh manure or brassicaceae residuals could be a promising methyl bromide alterna-
tive in head lettuce production. Gesunde Pflanzen 69 (1), 29–37.
Haas, D., Défago, G., 2005. Biological control of soil-borne pathogens by fluorescent pseu-
domonads. Nat. Rev. Microbiol. 3 (4), 307–319.
Heye, C.C., Andrews, J.H., 1983. Antagonism of Athelia bombacina and Chaetomium
globosum to the apple scab pathogen, Venturia inaequalis. Phytopathology 73 (5),
650–654.
Hollister, E.B., Hu, P., Wang, A.S., Hons, F.M., Gentry, T.J., 2013. Differential impacts of
brassicaceous and nonbrassicaceous oilseed meals on soil bacterial and fungal com-
munities. FEMS Microbiol. Ecol. 83 (3), 632–641.
Huang, Y., Xiao, X., Huang, H.Y., Jing, J.Q., Zhao, H.J., Wang, L., Long, X.E., 2018. Contrasting
beneficial and pathogenic microbial communities across consecutive cropping fields
of greenhouse strawberry. Appl. Microbiol. Biotechnol. 02 (13), 5717–5729.
Ibekwe, A.M., Papiernik, S.K., Gan, J., Yates, S.R., Yang, C.H., Crowley, D.E., 2001. Impact of
fumigants on soil microbial communities. Appl. Environ. Microbiol. 67 (7),
3245–3257.
Imfeld, G., Vuilleumier, S., 2012. Measuring the effects of pesticides on
bacterialcommunities in soil: a critical review. Eur. J. Soil Biol. 49, 22–30.
Janssen, P.H., 2006. Identifying the dominant soil bacterialtaxa in libraries of 16S rRNA
and 16S rRNA genes. Appl. Environ. Microbiol. 72 (3), 1719–1728.
Ji, M.X., Yang, J.H., Wu, X., Zhu, C.G., Xiao, T., Yao, K.B., Zhuang, Y.Q., 2012. Biocontrol of
strawberry anthracnose caused by Colletotrichum fragariae. Jiangsu Journal of Agri-
cultural Sciences 28 (6), 1498–1500.
Krzmarzick, M.J., Crary, B.B., Harding, J.J., Oyerinde, O.O., Leri, A.C., Myneni, S.C.B., Novak,
P.J., 2012. Natural niche for organohalide-respiring Chloroflexi. Applied & Environ-
mental Microbiology 78 (2), 393.
Latz, E., Eisenhauer, N., Rall, B.C., Allan, E., Roscher, C., Scheu, S., Jousset, A., 2012. Plant di-
versity improves protection against soil-borne pathogens by fostering antagonistic
bacterial communities. J. Ecol. 100, 597–604.
Li, J., Huang, B., Wang, Q.X., Li, Y., Fang, W.S., Yan, D.D., Guo, M.X., Cao, A., 2017. Effect of
fumigation with chloropicrin on soil bacterial communities and genes encoding key
enzymes involved in nitrogen cycling. Environ. Pollut. 227, 534–542.
Lin, X.G., 2010. Research Principle and Method of Soil Microorganism. Higher Education
Press, Beijing.
Locascio, S.J., Dickson, D.W., Mitchell, D.J., Olson, S.M., Gilreath, J.P., Noling, J.W., 2014. Al-
ternative treatments to methyl bromide for strawberry. Proceedings of the Florida
State Horticultural Society. vol. 112, pp. 297–302.
Ma, Y., Li, Y.X., Chang, Z.Z., Xu, Y.D., Zhang, J.Y., 2010. Biological characteristics of organic
liquid fertilizer and its control effect on soil-borne diseases of cucumber and straw-
berry. Soil and Fertilizer Sciences in China (5), 71–76.
McGuire, A.M., 2003. Mustard green manures replace fumigant and improve infiltration
in potato cropping system. Crop Management. 2 (203).
Neubauer, C., Heitmann, B., Müller, C., 2014. Biofumigation potential of brassicaceae cul-
tivars to verticillium dahliae. Eur. J. Plant Pathol. 140 (2), 341–352.
Niu, X.Y., Sun, X.M., Chen, D.S., Zhang, S.G., 2015. Soil microorganisms nutrients and
enzyme activity of Larix Kaempferi plantation under different ages in mountain-
ous region of eastern Liaoning Province, China. Chin. J. Appl. Ecol. 26 (9),
2663–2672.
Njoroge, S.M., Riley, M.B., Keinath, A.P., 2008. Effect of incorporation of Brassica spp. res-
idues on population densities of SoiPBRorne microorganisms and on damping-off and
Fusarium wilt of watermelon. Plant Dis. 92 (2), 287–294.
Paungfoolonhienne, C., Yeoh, Y.K., Kasinadhuni, N.R., Lonhienne, T.G., Robinson, N.,
Hugenholtz, P., et al., 2015. Nitrogen fertilizer dose alters fungal communities in sug-
arcane soil and rhizosphere. Sci. Rep. 5, 8678.
Porras, M., Barrau, C., Romero, E., Zurera, C., Romero, F., 2009. Effect of biofumigation with
Brassica carinata and soil solarization on Phytophthora spp. and strawberry yield. Acta
Hortic. (842), 969–972.
Prather, M.J., Watson, R.T., 1990. Stratospheric ozone depletion and future levels of atmo-
spheric chlorine and bromine. Nature 344 (6268), 729.
Rees, H.W., Chow, T.L., Zebarth, B., Xing, Z., Toner, P., Lavoie, J., et al., 2014. Impact of sup-
plemental poultry manure application on potato yield and soil properties on a loam
soil in North-Western New Brunswick. Can. J. Soil Sci. 94 (1), 49–65.
Ren, Z.J., Li, Y., Fang, W.S., Yan, D.D., Huang, B., Zhu, J.H., et al., 2018. Evaluation of allyl iso-
thiocyanate as a soil fumigant against soil-borne diseases in commercial tomato
(lycopersicon esculentum mill.) production in China. Pest Manag. Sci. 74 (9),
2146–2155.
622 D. Zhang et al. / Science of the Total Environment 675 (2019) 615–622
Riad, G.S., Ghoname, A.A., Hegazi, A.M., Fawzy, Z.F., El-Nemr, M.A., 2017. Cultivation in rice
straw and other natural treatments as an eco-friendly methyl bromide alternative in
head lettuce production. Gesunde Pflanzen 69 (1).
Riga, E., Mojtabedi, H., Ingham, R.E., McGuire, A., 2004. Green manure amendments and
management of root knot nematodes on potato in the Pacific Northwest of USA.
Nematology Monographs and Perspecttives (2), 151–158.
Ristaino, J.B., Thomas, W., 1997. Agriculture, methyl bromide, and the ozone hole: can we
fill the gaps. Plant Dis. 81 (9), 964–977.
Schinner, F., Öhlinger, R., Kandeler, D.E., Margesin, R., 1995. Methods in Soil Biology.
Springer Verlag, Berlin, Germany, pp. 386–389.
Srivastava, J.N., Ghatak, A., 2017. Biofumigation: a control method for the soil-borne dis-
eases. International Journal of Plant Protection 10 (2), 453–460.
Sykes, G., Skinner, F.A., 1973. Actinomycetales: Characteristics and Practical Importance.
vol 111. Academic Press, Cambridge, pp. 1220–1221.
Taketani, R.G., Lima, A.B., Jesus, E.D.C., Teixeira, W.G., Tiedje, J.M., Tsai, S.M., 2013. Bacterial
community composition of anthropogenic biochar and Amazonian anthrosols
assessed by 16S rRNA gene 454 pyrosequencing. Antonie Van Leeuwenhoek 104
(2), 233–242.
Wang, C.Y., 1997. Occurrence law and comprehensive control of strawberry root rot. Plant
Prot. 23 (3), 32–33.
Wang, D.J., Yang, Z.C., Qiao, S.J., Kang, C.S., Yuan, R., Yao, X.T., et al., 2016. Effect of
biofumigation on inhibition of cucumber fusarium wilt, quality and yield of cucum-
ber. Chinese Agricultural Science Bulletin 125–130.
Wang, Q.X., Yan, D.D., Wang, X.L., Lü, P.X., Li, X.Y., Cao, A.C., 2017. Research advances in
soil fumigants. Journal of Plant Protection 44 (4), 529–543.
Wang, J., Cao, J.M., Chen, D.X., Qiu, J., Wang, X.Q., Feng, C., Wang, W.J., 2018a. Antimicro-
bial effect and components analysis of volatile organic compounds from bacillus
pumilus ar03. Sci. Agric. Sin. 51 (10), 1908–1919.
Wang, X.F., Xu, S.Z., Wang, M., Duan, Y.N., Wang, H.Y., Sheng, Y.F., Mao, Z.Q., 2018b. Effects
of soil biofumigation using tateges erecta powder on growth of malus hupehensis
rehd. Seedlings and soil microorganisms in old apple orchard soil. Acta Pedol. Sin.
55 (1), 213–224.
Weber, M.H.W., Klein, W., Mueller, L., Niess, U.M., Marahiel, M.A., 2001. Role of the Bacil-
lus subtilis fatty acid desaturase in membrane adaptation during cold shock. Mol.
Microbiol. 39, 1321–1329.
Wei, F., Passey, T., Xu, X.M., 2016. Amplicon-based metabarcoding reveals temporal re-
sponse of soil microbial community to fumigation-derived products. Appl. Soil Ecol.
103, 83–92.
Wolińska, A., Kuźniar, A., Zielenkiewicz, U., Izak, D., Szafranek-Nakonieczna, A., Banach, A.,
Błaszczyk, M., 2017. Bacteroidetes, as a sensitive biological indicator of agricultural
soil usage revealed by a culture-independent approach. Appl. Soil Ecol. 119, 128–137.
Xu, N., Tan, G., Wang, H., Gai, X.P., 2016. Effect of biochar additions to soil on nitrogen
leaching, microbial biomass and bacterial community structure. Eur. J. Soil Biol. 74,
1–8.
Xue, C., Huang, Q.W., Ling, N., Gao, X.L., Cao, Y., Zhao, Q.Y., et al., 2011. Analysis, regulation
and high-throughput sequencing of soil microflora in mono-cropping system. Acta
Pedol. Sin. 48 (3), 612–618.
Yan, D.D., Wang, Q.X., Guo, M.X., Guo, Z.B., Cao, A.C., 2010. Effects of four fumigants on soil
nitrogen transformation. Chin. J. Eco-Agric. 18 (5), 934–938.
Yan, D.D., Wang, Q.X., Mao, L.G., Xie, H.W., Guo, M.X., Cao, A.C., 2012. Evaluation of chlo-
ropicrin gelatin capsule formulation as a soil fumigant for greenhouse strawberry in
China. J. Agric. Food Chem. 60 (20), 5023–5027.
Yan, D.D., Wang, Q.X., Mao, L.G., Ma, T.T., Li, Y., Ouyang, C.B., Guo, M.X., Cao, A.C., 2015. In-
teraction between nitrification, denitrification and nitrous oxide production in fumi-
gated soils. Atmos. Environ. 103, 82–86.
Yang, S.Q., Yan, Q.J., Jiang, Z.Q., Li, L.T., Tian, H.M., Wang, Y.Z., 2006. High-level of xylanase
production by the thermophilic Paecilomyces themophila J18 on wheat straw in
solid-state fermentation. Bioresour Technology 97, 1794–1800.
Zhang, X.J., Wang, S.T., Zhang, F.Q., Du, H.Z., Jiang, J.Z., 2006. The research advance on
strawberry root rot. Chinese Agricultural Science Bulletin 12 (8), 416–419.
Zheng, Z.P., Liu, Z.X., 2003. Soil quality and its evaluation. Chin. J. Appl. Ecol. 14 (1),
131–134.