Plant Mol Biol Rep (2007) 25:1–9

DOI 10.1007/s11105-007-0003-6

Single-reaction for SNP Genotyping on Agarose Gel

by Allele-specific PCR in Black Poplar (Populus nigra L.)

Muriel Gaudet & Anna-Giulia Fara &

Maurizio Sabatti & Elena Kuzminsky &
Giuseppe Scarascia Mugnozza

Published online: 25 July 2007

# Springer-Verlag 2007

Abstract The wide development of single nucleotide polymorphism (SNP) markers

also in non-model species increases the need for inexpensive methods that do not
require sophisticated equipment and time for optimization. This work presents a new
method for polymerase chain reaction (PCR) amplification of multiple specific alleles
(PAMSA), which allows efficient discrimination of SNP polymorphisms in one
reaction tube with standard PCR conditions. This improved PAMSA requires only
three unlabeled primers: a common reverse primer and two allele-specific primers
having a tail of different length to differentiate the two SNP alleles by the size of
amplification products on agarose gel. A destabilizing mismatch within the five bases
of the 3′ end is also added to improve the allele specificity. To validate the accuracy of
this method, 94 full-sib individuals were genotyped with three SNPs and compared to
the genotypes obtained by cleaved amplified polymorphic sequence (CAPS) or
derived CAPS. This method is flexible, inexpensive, and well suited for high
throughput and automated genotyping.

Keywords Allele-specific PCR . Destabilizing mismatch . PAMSA .

SNP genotyping . Tailed primers

Abbreviations
ARMS amplification refractory mutation system
AS-PCR allele-specific polymerase chain reaction
Bi-PASA bidirectional-PASA
CAPS cleaved amplification polymorphic site
dCAPS derived cleaved amplification polymorphic site
PAMSA PCR amplification of multiple specific alleles
PASA PCR allele-specific amplification
SNP single nucleotide polymorphisms

M. Gaudet (*) : A.-G. Fara : M. Sabatti : E. Kuzminsky : G. S. Mugnozza

Department of Forest Environment and Resources DISAFRI, University of Tuscia,
Via S. Camillo de Lellis, Viterbo 01100, Italy
e-mail: gaudet@unitus.it
2 Plant Mol Biol Rep (2007) 25:1–9

Introduction

Single nucleotide polymorphisms (SNPs) are the most abundant genetic markers in
the genome (Soleimani et al. 2003) and offer a large range of applications, such as
association studies, high density genetic maps, genome evolution studies, disease
diagnostics, marker-assisted selection, and traceability (Sachidanandam et al. 2001;
Waterfall and Cobb 2001; Yanagisawa et al. 2003; Yamanaka et al. 2004). SNPs are
widely used in animal genomics and are increasingly adopted in model plants, crop
species, and also in less studied plants such as trees. A wide variety of methods has
been developed to detect SNPs, and many of them use automated high throughput
systems (Gupta et al. 2001; Gut 2001). These methods require expensive equipment
and development costs. Therefore, they are not well suited to work with few SNPs
and/or few samples. A simple and cost-effective method for SNP genotyping would
improve the accessibility to SNPs for all minimally equipped laboratories (Bundock
et al. 2005).
Among the simple SNP genotyping methods, the cleaved amplification
polymorphic site or polymerase chain reaction-restriction fragment length polymor-
phism (CAPS or PCR-RFLP) and the derived CAPS (dCAPS; Neff et al. 1998;
Michaels and Amisino 1998) are widely applied (Iwaki et al. 2002; Yanagisawa et al.
2003; Yamanaka et al. 2004). However, these methods are time consuming and not
applicable to all SNPs because of the high cost of some restriction enzymes
(Bundock et al. 2005). An alternative method is the allele-specific PCR also called
PCR allele-specific amplification (PASA) or amplification refractory mutation
system. The advantage of this method is the detection of the amplification products
on agarose gel. On the other hand, the single base-pair change at the 3′ primer end is
often not sufficient to ensure reliable discrimination between the two SNP alleles
(Ahmadian et al. 2001), and two reactions are needed, one for each allele (Kim et al.
2005). To overcome these disadvantages, some improvement was achieved with
PCR amplification of multiple specific alleles (PAMSA), which involves the use of
at least two allele-specific primers in the same reaction and allows the detection of
all the SNP alleles present in a sample. Even with the simplicity of a single-tube
reaction, PAMSA often requires more expensive equipment and reagents than the
basic method, such as fluorescence detection, real-time fluorescence detection, and
sequencer (Germer and Higuchi 1999; Ishiguro et al. 2005; Hansson and Kawabe
2005; Wu et al. 2005; Hinten et al. 2007).
Some PAMSA methods allow the discrimination of alleles by gel electrophoresis.
Dutton and Sommer (1991) described a PAMSA in which SNP alleles were detected
by agarose gel electrophoresis with one allele-specific primer that was 31
nucleotides longer than the other one. Yet, this technique required rigorous PCR
optimization because of the wide difference in length between the primers. Okimoto
and Dodgson (1996) developed an assay in which one allele-specific primer was five
or two nucleotides longer than the other one, whereas the different alleles were
resolved on acrylamide gel, and the molar ratio of the allele-specific primers needed
to be optimized. A variant of the PAMSA method is the bidirectional-PASA (Bi-
PASA), which also allows the allele separation on agarose gel. In this method, one of
the alleles is amplified by a PASA reaction in one direction, whereas the second
allele is amplified in the opposite direction. Therefore, four primers are needed: two
Plant Mol Biol Rep (2007) 25:1–9 3

outer primers and two allele-specific inner primers (Liu et al. 1997). The two outer
primers amplify a constant fragment, which is also a PCR positive control. Once
again, this method required optimization because of the effects of competition among
multiple primer sets in the PCR reaction (Liu et al. 1997; Sasvari-Szekely et al. 2000;
Waterfall and Cobb 2001; Waterfall and Cobb 2002). Moreover, the efficient
amplification of all expected fragments was not always guaranteed (Waterfall and
Cobb 2001). The Bi-PASA was simplified using only three primers (Soleimani et al.
2003), but one of the SNP alleles was deduced by the absence of a PCR fragment,
which could also be due to a lack of PCR amplification, and the heterozygote
genotype could not be differentiated. In addition to the 3′ end base complementary to
the SNP site, the introduction of a destabilizing mismatched base pair within four
bases of the 3′ primer end increased the primer’s specificity (Kwok et al. 1990). This
improvement was successfully used in PASA, PAMSA (Bundock et al. 2005; Kim
et al. 2005), and bi-PASA (Okimoto and Dodgson 1996).
In this work, we describe a new inexpensive PAMSA method that allowed us to
add SNPs to Populus nigra genetic maps. Only three unlabeled primers were
necessary, and the alleles were detected on agarose gel. The PCR reaction used allele-
specific primers with a destabilizing mismatch within the five bases of the 3′ end and a
5′ tail for the amplification of different-length PCR products. The additional
mismatches and the tails confer high allele specificity, avoid megapriming, and allow
performing PCR without optimization. Four SNPs were analyzed, and three of them
were genotyped on 92 full-sib progenies. The results were validated by CAPS or
dCAPS.

Materials and Methods

Genomic DNA Template and SNPs Analyzed

Total genomic DNA of 94 P. nigra individuals were extracted from frozen young
leaves using the GenElute™ Plant Genomic DNA Miniprep Kit (Sigma Aldrich,
Milano, Italy).
Four SNPs, S01, S02, S03, and S04, were analyzed, and three of them
corresponded to gene loci: S01 to PhyA, S02 to PhyB2, and S04 to IAA2. S03
corresponded to an unknown genomic sequence named I13R (Table 1). The 94
individuals analyzed included 92 full-sib progenies and the two parents. For each
SNP, the genotype of the two parents was determined from sequence data (Gaudet
et al. 2007), and they were used as control.

Primers Design

Primers were designed using Vector NTI 9.1.0 software (Invitrogen life technology,
Italy). For each SNP, the primer set included a reverse common primer (R) and two
forward allele-specific primers (ASF1 and ASF2), with the 3′ terminal base of each
specific primer matching one of the SNP alleles. The primers were designed to have
a length of 20 nucleotides and to amplify a fragment ranging from 100 to 200 bp. A
mismatch was added to the allele-specific primers within the five bases of the 3′ end
4 Plant Mol Biol Rep (2007) 25:1–9

Table 1 List of SNP polymorphisms and sequence of primers used for analysis

Analysis SNP Primer Primer sequence 5′-3′

methods name name

PAMSA S01 ASF1a GGGACAGCTCAACATGATTTAGTGG

ASF1b GGGACAGCTCAACATGATTTACTGG
ASF1c GGGACAGCTCAACATGATTTATTAG
ASF2 TGCGGGATAGGCGACAGCTCAACATGATTTAGTGA
R CCTTTTCATTGCTCTTCATC
PAMSA S02 ASF1 CGAGCATGAAAGCCAATAGATGATTATTA
ASF2 ATTACTACTAGACGGATGAAAGCCAATAGATGATGACTT
R AACAGAGCACCACAGTCAAA
PAMSA S03 ASF1 GGGCGGTTTTTGGCTTATCTAACAT
ASF2 GGGTTGGTTTGGCGGGTTTTTGGCTTATCTATCAG
R GAAGATCAGATAGAAGGAAT
PAMSA S04 ASF1 GCGGGCATAGGTGAGCAAAATCAAA
ASF2 GAAGAAAGGTGGGAGGCATAGGTGAGCAAAATGAAT
R AACTCGATCCATAAACAAAC
CAPS S02 F AGGTGAGTATTTCTGCTTTG
R ATTAACTTAAAAAAGATTATACAG
CAPS S03 F AGTAGTCCTAAAATCACAAGC
R AGAAGATCAGATAGAAGGAA
dCAPS S04 F TGTTTTACCATAGGTGAGCAAAATTAA
R CCTGACATCATAACAAAGTA

Underlined bases correspond to the base of the SNP alleles; bold bases denote internal mismatches; italic
bases correspond to the tails
ASF1 and ASF2 Allele-specific forward primers 1 and 2; F forward primers; R reverse primers

to increase allele specificity. Tails of different length, five bases for one primer and 15
for the second one, were finally added to each of the two allele-specific primers to
obtain a difference of 10 bp between the amplification products (Table 1). Different
mismatched bases and tails were incorporated in the two allele-specific primers. To
achieve a good PCR efficiency, the mismatches and the tails were chosen to have the
less hairpin loops, primer dimers, and duplexes among the three primers.
For the SNP S01, different mismatches in the primer ASF1 were tested: the
primer ASF1a had the same mismatch as ASF2 (a G four bases in from the 3′ end);
the primer ASF1b had the same mismatch position as ASF2 but with a different
nucleotide, C for ASF1b and G for ASF2; the primer ASF1c had a mismatch (A)
two bases in from the 3′ end (Table 1).

PCR Amplification and Electrophoresis

The PCR reactions were performed in a volume of 12.5 μl, containing 15 ng of

genomic DNA, 0.25 μM of each of the three primers, 0.2 mM of each dNTP, 0.25 U
of Taq DNA polymerase (Amersham Biosciences, Milano, Italy), 1×reaction buffer
(50 mM KCl, 10 mM Tris-HCl pH 9.0), and 2.25 mM MgCl2. PCR was conducted
with 3 min of denaturation at 94°C, 35 cycles of 94°C for 20 s, annealing at 50°C for
45 s, 72°C for 30 s, and a final extension at 72°C for 4 min. The amplification
products were separated on 3% high resolution agarose gel Metaphor® Agarose
(Cambrex BioScience, Milano, Italy) at 6 V/cm constant voltage and visualized with
ethidium bromide staining.
Plant Mol Biol Rep (2007) 25:1–9 5

CAPS and dCAPS Analysis

The primers were designed with Vector NTI 9.1.0 software (Invitrogen life technology,
Italy; Table 1). A CAPS reaction was performed for S02 and S03, and their
amplification products were digested with the restriction endonuclease BsaBI and
VspI, respectively. A dCAPS reaction was carried out for S04. The forward dCAPS
primer was designed with the web-based program dCAPS finder 2.0 (Neff et al. 2002),
and the PCR products were digested with the restriction endonuclease VspI (Table 1).
The PCR reaction was performed as previously described, changing the annealing
temperature to 52°C. Aliquots (5 μl) of the PCR product were digested with 2 U of the
appropriate restriction endonuclease (Fermentas Life Sciences, Milano, Italy) in a
volume of 10 μl for 1 h 30 min at the temperature indicated by the manufacturer. The
digestion products were separated and visualized as described above.

Results and Discussion

PAMSA Method Development

The principle of the new modified PAMSA method is schematically represented in

Fig. 1a. The tail, incorporated in the primers, allowed differentiating the alleles by
the length of the PCR products, and thus, they could be detected on agarose gel.
Moreover, the different sequence of the tails added differences between the two
allele-specific PCR products, although the 5′ end of the primer is not considered
essential for the specificity. The SNP S03 enabled us to check the efficiency of the
method for all the possible genotypes: homozygote for the allele 1, homozygote for
the allele 2, and heterozygote (Fig. 2, middle panel).
The three different mismatches tested for the primers ASF1 of SNP S01
demonstrated the discrimination power of the method. SNP S01 is a transition G-A,
which induces G-T and C-A mismatches. They belong to the difficult mismatches
known to yield extension products with Taq DNA polymerase and hinder proper
discrimination between genotypes (Day et al. 1999; Ahmadian et al. 2001). The
genotype of the parents, determined from sequence data, is heterozygote (G/A) for
parent 1 (P1) and homozygote (G/G) for parent 2 (P2). The primer ASF1 generated a
179 bp product for the allele “G,” and the primer ASF2 amplified a fragment of
189 bp for the allele “A.” Three PAMSA reactions were performed in the same
conditions using alternatively the primers ASF1a, ASF1b, or ASF1c (Fig. 1b). With
the primer ASF1a, the amplification was not specific and produced two fragments
with the expected length for all the individuals tested (Fig. 1b, top panel), whereas
the primers ASF1b and ASF1c gave the expected pattern for P1 and P2 and the
expected segregation of the F1 genotypes (Fig. 1b, middle and bottom panel).
The results obtained allowed us to draw two conclusions. Firstly, the introduction
of a mismatch within the five bases of the 3′ primer end allows the specific
amplification of the two alleles in the first PCR cycles. Secondly, the different
mismatch between primers ASF1 and ASF2 allows the conservation of the
amplification specificity in the following PCR cycles. In fact, the unique difference
between ASF1a and ASF1b is the nucleotide introduced as mismatch: G in ASF1a,
6 Plant Mol Biol Rep (2007) 25:1–9

Fig. 1 a Principle of the new PAMSA method. Genomic DNA is amplified by two forward allele-specific
(AS) primers and a common reverse primer. A destabilizing mismatch within the five bases of the 3′ end is
added to the allele-specific primer to improve the allele specificity. The allele 1 is amplified by the AS primer
with a short tail and the allele 2 by the AS primer with a long tail. Therefore, the two alleles are discriminated
by the length of the amplification products. In this case, the PCR product of the allele 1 is shorter than the
one of the allele 2. b PAMSA amplification products of three allele-specific primers with different
destabilizing mismatches for the S01 SNP. Template DNA of eight F1 genotypes and their two parents (P1
and P2) were analyzed. P1 and P2 have a known genotype from sequence data: P1 is heterozygote G/A
corresponding to an amplification product of 179 and 189 bp, respectively, and P2 is homozygote G/G
corresponding to a fragment of 179 bp. The amplification products were separated on 3% high resolution
agarose gel and stained with ethidium bromide. M is the marker lane. Fragment size in bp is given on the
right for the marker lane and on the left for the individuals. Three sets of primers were tested. They included
the reverse primer and the allele-specific primer 2 (ASF2) as common primers (Table 1) and the allele-
specific primer 1a (ASF1a), ASF1b, and ASF1c (top, middle, and bottom panel, respectively). ASF1a primer
had the same mismatch as ASF2, ASF1b had the same mismatch position as ASF2 but with a different
nucleotide, and ASF1c had a mismatch two bases in from the 3′ end (Table 1). The set of primers with
ASF1a presented a non-specific amplification (top panel), whereas the ASF1b and ASF1c gave specific
amplification and the expected pattern for P1 and P2 (middle and bottom panel)

as ASF2, and C in ASF1b (Table 1). The non-specific products generated by ASF1a
could be explained by the mismatched base (G) identical to the mismatched base of
the primer ASF2. We hypothesize that the PAMSA with ASF1a generated the allele-
specific PCR fragment in the first PCR cycles, but the mismatched PCR products
cancelled the differences, and there was, most likely, cross amplification, which
indifferently generated the two alternative PCR fragments. The 3′ end mismatch of
the primer ASF1 was not sufficient to discriminate the two alleles. The key to obtain
a good discrimination of the two alleles is the addition of a destabilizing mismatch
within the five bases of the 3′ primer end, which is different between the two allele-
Plant Mol Biol Rep (2007) 25:1–9 7

Fig. 2 PAMSA genotyping and validation by CAPS or dCAPS. Template DNA of 13 F1 genotypes and
their two parents (P1 and P2) were analyzed with PAMSA and CAPS or dCAPS. The amplification
products were separated on 3% high resolution agarose gel and stained with ethidium bromide. The
genotype of each individual is indicated on the top of each panel. It comes from the sequence data for P1
and P2 (control) and from CAPS or dCAPS analysis for the F1. M is the marker lane. Fragment size in bp
is given on the right for the marker lane and on the left for the individuals. The SNPs analyzed (S02, S03,
and S04) are indicated on the right of the panel, and the method used is on the left. The genotypes
obtained by PAMSA corresponded completely to sequencing data and CAPS or dCAPS results

specific primers. In this way, cross-amplification as a result of complementarity

between one allele-specific primer and the product of the others is avoided. The
position of the mismatch had no influence on the specificity of the PAMSA (same
results for ASF1b and ASF1c) and on the efficiency of amplification. In fact, the
presence of a mismatch at the penultimate nucleotide of the ASF1b primer did not
prevent the amplification of its allele in the first PCR cycles.
Many of the existing methods (Dutton and Sommer 1991; Okimoto and Dodgson
1996; Imyanitov et al. 2002; Hansson and Kawabe 2005; Hinten et al. 2007)
achieved good results after empirical adjustment of PCR conditions, mainly, the
concentration of each primer, of magnesium chloride, and the annealing temperature.
On the contrary, the method presented in this work did not need any PCR
optimization. The SNP alleles were efficiently detected with equimolar concentration
of the primers. The annealing temperature of the PCR program was chosen to work
for all the primer triplets to simplify the procedure. A PCR reaction with a gradient
of annealing temperature from 49 to 64°C was performed for the four primer triplets.
8 Plant Mol Biol Rep (2007) 25:1–9

All the reactions gave a clearly interpretable expected pattern up to 55°C. Above this
temperature, the results depended on the primer triplets (data not shown). In our
experiment, the specificity of the primers did not depend on the annealing
temperature. Therefore, an annealing temperature of 50°C allowed using a standard
PCR program.
To validate the method, the SNPs S02, S03, and S04 were analyzed on 94
individuals by PAMSA, and the genotypes were compared with those obtained by
CAPS reactions for S02 and S03 and dCAPS reaction for S04 (Table 1 and Fig. 2).
The genotyping data obtained with the two methods were identical at 100% for S02
and S03 and at 99% for S04. The 99% obtained for S04 resulted from the non
amplification of one individual with the PAMSA method, probably because of a
manipulation error.

Conclusions

The PAMSA method developed in this work was completely successful also with
difficult mismatches, such as G-T and C-A (Day et al. 1999; Ahmadian et al. 2001).
Moreover, this method allows a reliable discrimination of SNP polymorphisms
without time-consuming PCR optimization. We experimentally confirmed the
importance of incorporating different mismatched bases in the allele-specific primer
to avoid cross amplification. The efficient and inexpensive method presented here
enables genotyping laboratories to analyze SNPs with standard PCR protocols and is
suitable for projects with modest budget or where sophisticated equipment is not
available. This PAMSA technique could easily be adapted to automated analysis
processes using a fluorescent-labeled reverse primer. In this way, multiplex in length
and dye color could be possible and would allow a high throughput of data with
reduced cost.

Acknowledgments The authors thank Véronique Jorge and Claudia Mattioni for their critical reading of
the manuscript, Dermot Browne for correction of English writing, and Isacco Beritognolo for his technical
advice and assistance. This work was supported by grants from the European Project QLK5-CT-2002-
00953 (POPYOMICS) and the Italian project MIUR PRIN 2005072892_001.

References

Ahmadian A, Gharizadeh B, O’Meara D, Odeberg J, Lundeberg J. Genotyping by apyrase-mediated

allele-specific extension. Nucl Acids Res 2001;29:e121.
Bundock PC, Cross MJ, Shapter FM, Henry RJ. Robust allele-specific polymerase chain reaction markers
developed for single nucleotide polymorphisms in expressed barley sequences. Theor Appl Genet
2005;112:358–65.
Day JP, Bergstrom D, Hammer RP, Barany F. Nucleotide analogs facilitate base conversion with 3′
mismatch primers. Nucl Acids Res 1999;27:1810–18.
Dutton C, Sommer SS. Simultaneous detection of multiple single-base alleles at a polymorphic site.
BioTechniques 1991;11:700–7002.
Gaudet M, Jorge V, Paolucci I, Beritognolo I, Scarascia Mugnozza G, Sabatti M. Genetic linkage maps of
Populus nigra L. including AFLPs, SSRs, SNPs, and sex trait. Tree Genet Genome 2007. DOI
10.1007/s11295-007-0085-1.
Germer S, Higuchi R. Single-tube genotyping without oligonucleotide probes. Genome Res 1999;9:72–8.
Plant Mol Biol Rep (2007) 25:1–9 9

Gupta PK, Roy JK, Prasad M. Single nucleotide polymorphisms: a new paradigm for molecular marker
technology and DNA polymorphism detection with emphasis on their use in plants. Curr Sci India
2001;80:524–35.
Gut IG. Automation in genotyping of single nucleotide polymorphisms. Hum Mutat 2001;17:475–92.
Hansson B, Kawabe A. A simple method to score single nucleotide polymorphisms based on allele-
specific PCR and primer-induced fragment-length variation. Mol Ecol Notes 2005;5:692–6.
Hinten GN, Hale MC, Gratten J, Mossman JA, Lowder BV, Mann MK, Slate J. SNP-SCALE: SNP scoring
by colour and length exclusion. Mol Ecol Notes 2007;7:377–88.
Imyanitov EN, Buslov KG, Suspitsin EN, Kuligina ESh, Belogubova EV, Grigoriev MY et al. Improved
reliability of allele-specific PCR. BioTechniques 2002;33:484–90.
Ishiguro A, Kubota T, Soya Y, Sasaki H, Yagyu O, Takarada Y et al. High-throughput detection of
multiple genetic polymorphisms influencing drug metabolism with mismatch primers in allele-specific
polymerase chain reaction. Anal Biochem 2005;337:256–61.
Iwaki K, Nishida J, Yanagisawa T, Yoshida H, Kato K. Genetic analysis of Vrn-B1 for vernalization
requirement by using linked dCAPS markers in bread wheat (Triticum aestivum L.). Theor Appl
Genet 2002;104:571–6.
Kim MY, Van K, Lestari P, Moon JK, Lee SH. SNP identification and SNAP marker development for a
GmNARK gene controlling supernodulation in soybean. Theor Appl Genet 2005;110:1003–10.
Kwok S, Kellogg DE, McKinney N, Spasic D, Goda L, Levenson C, Sninsky JJ. Effects of primer-
template mismatches on the polymerase chain reaction: human immunodeficiency virus type 1 model
studies. Nucl Acids Res 1990;18:999–1005.
Liu Q, Thorland EC, Heit JA, Sommer SS. Overlapping PCR for bidirectional PCR amplification of
specific alleles: a rapid one-tube method for simultaneously differentiating homozygotes and
heterozygotes. Genome Res 1997;7:389–98.
Michaels SD, Amisino RM. A robust method for the detecting single-nucleotide changes as polymorphic
markers by PCR. Plant J 1998;14:381–5.
Neff MM, Neff JD, Chory J, Pepper AE. dCAPS, a simple technique for the genetic analysis of single
nucleotide polymorphisms: experimental applications in Arabidopsis thaliana genetics. Plant J
1998;14:387–92.
Neff MM, Turk E, Kalishman M. Web-based primer design for single nucleotide polymorphism analysis.
Trends Genet 2002;18:613–5.
Okimoto R, Dodgson JB. Improved PCR amplification of multiple specific alleles (PAMSA) using
internally mismatched primers. BioTechniques 1996;21:20–6.
Sachidanandam R, Weissman D, Schmidt SC, Kakol JM, Stein LD, Marth G et al. A map of human
genome sequence variation containing 1.42 million single nucleotide polymorphisms. Nature
2001;409:928–33.
Sasvari-Szekely M, Gerstner A, Ronai Z, Staub M, Guttman A. Rapid genotyping of factor V Leiden
mutation using single-tube bidirectional allele-specific amplification and automated ultrathin-layer
agarose gel electrophoresis. Electrophoresis 2000;21:816–21.
Soleimani VD, Baum BR, Johnson DA. Efficient validation of single nucleotide polymorphisms in plants
by allele-specific PCR, with an example from barley. Plant Mol Biol Rep 2003;21:281–8.
Waterfall CM, Cobb BD. Single tube genotyping of sickle cell anaemia using PCR-based SNP analysis.
Nucl Acids Res 2001;29:e119.
Waterfall CM, Cobb BD. SNP genotyping using single-tube fluorescent bidirectional PCR. BioTechniques
2002;33:80–90.
Wu WM, Tsai HJ, Pang JHS, Wang HS, Hong HS, Lee YS. Touchdown thermocycling program enables a
robust single nucleotide polymorphism typing method based on allele-specific real-time polymerase
chain reaction. Anal Biochem 2005;339:290–6.
Yamanaka S, Nakamura I, Watanabe KN, Sato YI. Identification of SNPs in the waxy gene among
glutinous rice cultivars and their evolutionary significance during the domestication process of rice.
Theor Appl Genet 2004;108:1200–4.
Yanagisawa T, Kiribuchi-Otobe C, Hirano H, Suzuki Y, Fujita M. Detection of single nucleotide
polymorphism (SNP) controlling the waxy character in wheat by using a derived cleaved amplified
polymorphic sequence (dCAPS) marker. Theor Appl Genet 2003;107:84–8.